Application of the apple MdWRI1 gene in regulating wax content in plant fruits and leaves

By constructing overexpression and silencing vectors of the MdWRI1 gene in apple plants, the wax content of apples was regulated, which solved the problem of unclear role of key genes in apple wax synthesis, increased the wax content of fruits and leaves, and enhanced stress resistance and fruit quality.

CN120118946BActive Publication Date: 2026-05-26QINGDAO AGRI UNIV +1
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
QINGDAO AGRI UNIV
Filing Date
2025-03-21
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

In the current technology, the role of MdWRI1, a key gene for apple wax synthesis, is not yet clear, leading to insufficient regulation of wax content in fruits and leaves, which affects fruit quality and stress resistance.

Method used

By constructing overexpression and silencing vectors for the apple MdWRI1 gene, Agrobacterium infection technology was used to regulate the expression of the MdWRI1 gene in apple plants, thereby increasing or decreasing wax content and achieving significant changes in the wax content of fruits and leaves.

Benefits of technology

It significantly increased the wax content of apple fruits and leaves, enhanced drought resistance and disease and pest resistance, optimized fruit quality and leaf water use efficiency, and reduced post-harvest losses and management costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120118946B_ABST
    Figure CN120118946B_ABST
Patent Text Reader

Abstract

This invention discloses the application of the apple MdWRI1 gene in regulating the wax content of apple fruits and leaves, belonging to the field of plant genetic engineering technology. This invention isolates an MdWRI1 gene with high expression levels in apple varieties with high wax content, its nucleotide sequence of which is shown in SEQ ID NO.1. Subcellular localization revealed that the transcription factor expressing the MdWRI1 gene is located in the cell nucleus. Experimental results show that overexpression of the MdWRI1 gene can significantly increase the wax content of apple fruits and leaves by promoting wax biosynthesis, indicating that the MdWRI1 gene plays a key role in regulating the wax content of apple fruits and leaves. This invention provides an efficient and rapid approach for apple breeding, provides genetic material for improving apple quality, and has broad application prospects in improving the economic and ecological benefits of apple cultivation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to the application of the apple MdWRI1 gene in regulating the wax content of plant fruits and leaves. Background Technology

[0002] Apples are a widely cultivated cash crop globally. As the world's largest producer and consumer of apples, my country's apple industry holds a vital position in the fruit and vegetable industry. The apple industry is significant in promoting farmers' income and rural economic development. The quality of the fruit directly affects its economic value and farmers' income. The waxy coating on the apple peel acts as a protective barrier, playing a crucial role in improving fruit quality and resistance.

[0003] The waxy coating on fruit acts as a natural protective barrier. On one hand, it effectively reduces water loss, maintains the freshness and plumpness of the fruit, and minimizes post-harvest shriveling and drying caused by water loss, thus greatly extending its shelf life. On the other hand, the dense waxy layer can resist pathogen infection, prevent the attachment and invasion of harmful microorganisms, reduce post-harvest rot, ensure fruit quality, and reduce economic losses. For leaves, sufficient wax helps regulate stomatal conductance, optimizes water use efficiency, and enables leaves to maintain normal photosynthesis and physiological metabolism under adverse conditions such as drought or high temperatures. Moreover, the wax can reflect some strong light, reduce photoinhibition damage to leaves, enhance the overall stress resistance of apple trees, ensure healthy tree growth, and lay the foundation for high-quality and high-yield fruit.

[0004] Previous studies have focused on various factors affecting apple growth and development, while also exploring key functional genes that can specifically increase the wax content of apple fruits and leaves. It is currently known that the synthesis of plant waxes involves a series of complex biochemical pathways regulated by multiple genes. However, the transcription factor MdWRI1's role in increasing wax content in apple fruits and leaves remains unclear. Therefore, in-depth research and analysis of this functional gene are of great significance for revealing the mechanism of apple wax synthesis, optimizing apple quality, and enhancing stress resistance. Summary of the Invention

[0005] The purpose of this invention is to provide an application of the apple MdWRI1 gene in regulating the wax content of plant fruits and leaves, in order to solve the problems existing in the prior art. This invention discovers the key role of the MdWRI1 gene in apple wax synthesis, and overexpression of the MdWRI1 gene can significantly increase the wax content on the surface of apple fruits.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides an application of the apple MdWRI1 gene in any of the following:

[0008] (1) Application in regulating wax content in plant fruits and / or leaves;

[0009] (2) Application in the cultivation of transgenic plants with high wax content in fruits and / or leaves;

[0010] (3) Application in the preparation of products that increase the wax content of plant fruits and / or leaves;

[0011] The nucleotide sequence of the MdWRI1 gene is shown in SEQ ID NO.1.

[0012] Preferably, the expression level of the apple MdWRI1 gene is upregulated in the plant to increase the wax content of the plant's fruit and / or leaves;

[0013] The plant in question is an apple.

[0014] Preferably, the method for upregulating the expression level of the apple MdWRI1 gene in plants includes the steps of constructing an overexpression vector of the apple MdWRI1 gene, transforming the overexpression vector into Agrobacterium, and then infecting the plant.

[0015] The present invention also provides the use of a recombinant vector containing the apple MdWRI1 gene in any of the following:

[0016] (1) Application in regulating wax content in plant fruits and / or leaves;

[0017] (2) Application in the cultivation of transgenic plants with high wax content in fruits and / or leaves;

[0018] (3) Application in the preparation of products that increase the wax content of plant fruits and / or leaves.

[0019] The present invention also provides the use of engineered bacteria comprising the recombinant vector in any of the following:

[0020] (1) Application in regulating wax content in plant fruits and / or leaves;

[0021] (2) Application in the cultivation of transgenic plants with high wax content in fruits and / or leaves;

[0022] (3) Application in the preparation of products that increase the wax content of plant fruits and / or leaves.

[0023] The present invention also provides a method for increasing the wax content of plant fruits and / or leaves, comprising the step of upregulating the expression level of the apple MdWRI1 gene in the plant to increase the wax content of the plant fruits and / or leaves;

[0024] The nucleotide sequence of the MdWRI1 gene is shown in SEQ ID NO.1;

[0025] The plant in question is an apple.

[0026] Preferably, the method for upregulating the expression level of the apple MdWRI1 gene in plants includes the steps of constructing an overexpression vector of the apple MdWRI1 gene, transforming the overexpression vector into Agrobacterium, and then infecting the plant.

[0027] This invention also provides a breeding method for transgenic plants with high wax content in fruits and / or leaves, comprising the following steps:

[0028] The apple MdWRI1 gene is overexpressed in plant cells, the plant cells are then cultured, and the plant cells are used to regenerate plants, resulting in transgenic plants with increased wax content in the fruit and / or leaves.

[0029] The nucleotide sequence of the MdWRI1 gene is shown in SEQ ID NO.1;

[0030] The plant in question is an apple.

[0031] The present invention also provides an application of the apple MdWRI1 gene in improving the drought resistance and / or disease and pest resistance of plants, wherein the nucleotide sequence of the MdWRI1 gene is shown in SEQ ID NO.1.

[0032] Preferably, the apple MdWRI1 gene enhances the plant's drought resistance and / or disease and pest resistance by increasing the wax content of the plant's fruit and / or leaves.

[0033] The present invention discloses the following technical effects:

[0034] This invention helps to deeply analyze the molecular regulatory network of apple wax synthesis, providing new theoretical support and key gene resources for genetic engineering strategies to improve apple quality. Through apple transient injection experiments, wax component determination, and gene expression analysis, it was shown that overexpression of the MdWRI1 gene significantly increases the wax content on the apple fruit surface, while silencing the MdWRI1 gene leads to a significant decrease in the wax content. This further verifies the crucial role of the MdWRI1 gene in apple wax synthesis.

[0035] Analysis of the appearance, wax content, gene expression, and leaf permeability of transgenic apple plants showed that overexpression of the MdWRI1 gene significantly increased wax deposition in leaves and significantly reduced permeability, while interference with the MdWRI1 gene resulted in a significant reduction in wax deposition and disruption of permeability. This invention provides a new possibility for improving the drought and pest resistance of apple plants through genetic engineering.

[0036] From the perspective of practical benefits in agricultural production, the application of the MdWRI1 gene of this invention can effectively reduce yield losses caused by problems such as postharvest water loss, disease infection, and premature leaf senescence, reduce the cost input of irrigation and plant protection in orchard management, and significantly improve the economic and ecological benefits of apple planting. Attached Figure Description

[0037] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0038] Figure 1 The images show the changes in MdWRI1 gene expression and the subcellular localization of MdWRI1 gene expression during fruit development. A represents the phenotypic observations during the development of rust-covered and rust-free fruits; B represents the changes in MdWRI1 gene expression during the development of rust-covered and rust-free fruits; and C represents the subcellular localization of MdWRI1 gene expression.

[0039] Figure 2 Figure 1 shows the phenotypic, wax composition, and gene expression analysis results of apple fruits infected with the MdWRI1 gene overexpression vector. In the figure, A represents the phenotype of apples overexpressing MdWRI1 and the control group (scale bar = 1 cm); B represents the wax content in the peel of apples overexpressing MdWRI1 and the control group; C represents the content of four common wax components; D represents the content of fatty aldehydes; E represents the content of fatty alcohols; F represents the content of alkanes; G represents the content of fatty acids; and H represents the expression level of wax biosynthesis-related genes in apples overexpressing MdWRI1 and the control group.

[0040] Figure 3Figure 1 shows the phenotypic, wax composition, and gene expression analysis results of apple fruits infected with the MdWRI1 gene interference vector. In this figure, A represents the phenotype of MdWRI1-silenced apples and control apples (scale bar = 1 cm); B represents the wax content in the peel of MdWRI1-silenced apples and control apples; C represents the content of common wax components in four groups; D represents the content of fatty aldehydes; E represents the content of fatty alcohols; F represents the content of alkanes; G represents the content of fatty acids; and H represents the expression level of wax biosynthesis-related genes in MdWRI1-silenced apples and control apples.

[0041] Figure 4 Figure 1 shows the phenotypic and related index results of apple 'GL-3' tissue culture seedlings transformed with leaf discs overexpressing the MdWRI1 gene. A represents the leaf phenotype of WT and MdWRI1-overexpressing apple lines; B represents the wax content of leaves in WT and MdWRI1-overexpressing apple lines; C represents the content of major wax components; D represents the alkane content; E represents the fatty acid content; F represents the phenolic content; G represents the chlorophyll leaching experiment results; H represents the toluidine blue staining results; I represents the water droplet experiment results; and J represents the expression levels of wax synthesis-related genes in WT and MdWRI1-overexpressing apple lines.

[0042] Figure 5 Figure 1 shows the phenotypic and related index results of apple 'GL-3' tissue culture seedlings transformed with leaf discs containing the MdWRI1 gene interference vector. A represents the leaf phenotype of WT and MdWRI1 interference apple lines; B represents the wax content of leaves in WT and MdWRI1 interference apple lines; C represents the content of major wax components; D represents the alkane content; E represents the fatty acid content; F represents the phenol content; G represents the chlorophyll leaching experiment results; H represents the toluidine blue staining results; I represents the water droplet experiment results; and J represents the expression level of wax synthesis-related genes in WT and MdWRI1 interference apple lines. Detailed Implementation

[0043] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0044] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0045] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0046] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0047] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0048] Current reports on the WRI1 gene mainly focus on lipid accumulation, with no reports on its role in regulating wax levels. Therefore, identifying and functionally studying the apple WRI1 gene is of significant importance.

[0049] This invention involved in-depth research, and transcriptome sequencing results of fruits from 'Fuji' × 'Golden Delicious' hybrid F1 lines with and without rust were used to identify a significantly differentially expressed transcription factor, MdWRI1. During fruit development, the expression level of the MdWRI1 gene was higher in the rust-free line than in the rust-free line. The full-length cDNA is 1212 bp, and its nucleotide sequence is shown in SEQ ID NO.1 of the sequence listing.

[0050] SEQ ID NO.1:

[0051]

[0052] To investigate the function of the MdWRI1 gene, this invention constructed overexpression vectors, silencing vectors, and interference vectors for the MdWRI1 gene. The method for constructing the gene overexpression vector is as follows:

[0053] Forward and reverse primers for the MdWRI1 gene were designed. The gene sequence was then cloned from the cDNA of rust-free fruit. The sequence was constructed into the plant overexpression vector pCAMBIA2300 using XbaⅠ and SmaⅠ double restriction sites, forming the fusion plasmid MdWRI1-pCAMBIA2300. This plasmid was then transformed into Agrobacterium tumefaciens GV3101 using a freeze-thaw method. The primer sequences are as follows:

[0054] MdWRI1(XbaI)-F: TCTAGAATGATGGTGAAGAATGAAGAAAACCCT (SEQ ID NO.2); MdWRI1(SmaI)-R: CCCGGGAGAAAAGAAAAATATAGAGTCTG (SEQ ID NO.3).

[0055] The gene silencing vector was constructed as follows:

[0056] A 400bp fragment of the non-conserved cDNA region of this gene was selected as the specific fragment, and its sequence is shown in SEQ ID NO.4.

[0057] SEQ ID NO.4:

[0058] ATCCTTCTCACACACCATCCTTTTGCCTCTGACTACCTGAACTCTCCGCGGAACCAAGAAGTCACCCGAAGCAGCACCAATCTTAACACGGGCAGCAAGTCGTCCTCTCCCACCGCACTTGGCCTCCTTCTTCAATCTTCAATTTTCCGAGAGCTGGTTCAGAAGAACTTGAATCTCTCCGAGGATGACAGCACTGACG ACGAAGAACCAAAGAACCAACCGCAGGCTGGCAGCGATGATGAGTATGGTGGGATCTTCTATGCTGGAACCGGCGAAAACCCTTTTGTTTGCTCCTCCGGCACTGACGGCAACAATCCATGGAACAACATCGCAAGCACTATTTTGCTCAATCAACCCACAAAGGCAAATGCTTCAGACTCTATATTTTTCTTTTCTTAG.

[0059] Then, using the XbaⅠ and KpnⅠ double restriction sites, the specific fragment was constructed into the viral silencing vector pTRV2, completing the pTRV2-MdWRI1 recombinant plasmid, which was then transformed into Agrobacterium tumefaciens GV3101 via freeze-thaw transformation. The primer sequences are as follows:

[0060] pTRV2-MdWRI1(BamHⅠ)-F:

[0061] GGATCCCTAAGAAAAGAAAAATATAGAGTCTGAAGCATTTGC (SEQ ID NO. 5);

[0062] pTRV2-MdWRI1(XhoⅠ-R):

[0063] CTCGAGATCCTTCTCACACACCAATCCTT (SEQ ID NO. 6).

[0064] The interference vector was constructed as follows:

[0065] A 400bp fragment of the non-conserved cDNA region of this gene was selected as the specific fragment, the sequence of which is shown in SEQ ID NO.4. Then, using the SpeⅠ and BamHI double restriction sites and the AscI and SwaI double restriction sites, SEQ ID NO.4 was constructed into the interference vector pFGC1008, completing the construction of the pFGC1008-MdWRI1 recombinant plasmid. This plasmid was then transformed into *Agrobacterium tumefaciens* LBA4404 using the freeze-thaw method. The primer sequences are as follows:

[0066] MdWRI1-RNAi-AscⅠ-F: GGCGCGCCATCCTTTCTCACACACCA (SEQ ID NO.7);

[0067] MdWRI1-RNAi-SwaI-R: ATTTAAATCTAAGAAAAGAAAAATATAGAGT (SEQ ID NO. 8).

[0068] MdWRI1-RNAi-SpeⅠ-F:ACTAGTATCCTTCTCACACACCAA (SEQ ID NO.9);

[0069] MdWRI1-RNAi-BamHI-R: GGATCCCTAAGAAAAGAAAAATATAGAGTCT (SEQ ID NO. 10).

[0070] Apple transient injection experiments, genetic transformation of apple tissue culture seedlings, wax component analysis, physiological data measurement, and gene expression analysis showed that overexpression of the MdWRI1 gene can improve fruit quality and enhance leaf stress resistance by promoting wax biosynthesis; while silencing the MdWRI1 gene reduces wax content and impairs leaf permeability. This indicates that the MdWRI1 gene plays a significant role in regulating apple wax content.

[0071] Example 1: Cloning of the full-length and specific fragments of the apple MdWRI1 gene

[0072] 1. RNA extraction and reverse transcription from rust-free apple fruits

[0073] 1.1 Extraction of total RNA from plants

[0074] The total RNA content of apple fruit samples was extracted using the RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (Tiangen Biotech Co., Ltd., Beijing). The specific steps are as follows:

[0075] 1) Homogenization treatment. Grind 50-100 mg of plant leaves or fruit pulp into powder rapidly in liquid nitrogen, add 500 μL of lysis buffer SL (please check whether β-mercaptoethanol has been added before use), and immediately vortex vigorously to mix.

[0076] 2) Centrifuge at 12000 rpm for 2 min.

[0077] 3) Transfer the supernatant to the CS filter column in the collection tube, centrifuge at 12000 rpm for 2 min, and carefully aspirate the supernatant from the collection tube into a new RNase-free centrifuge tube. Avoid contact between the pipette tip and the cell debris in the collection tube as much as possible.

[0078] 4) Slowly add 0.4 times the volume of supernatant in anhydrous ethanol, mix well, and transfer the resulting solution and precipitate into the adsorption column CR3. Centrifuge at 12000 rpm for 15 seconds, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.

[0079] 5) Add 350 μL of protein removal solution RW1 to the adsorption column CR3, centrifuge at 12000 rpm for 15 s, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.

[0080] 6) Preparation of DNase I working solution: Take 10 μL of DNase I stock solution and put it into a new RNase-Free centrifuge tube. Add 70 μL of RDD buffer and mix gently.

[0081] 7) Add 80 μL of DNase I working solution to the center of the adsorption column CR3 and let it stand at room temperature for 15 min.

[0082] 8) Add 350 μL of protein removal solution RW1 to the adsorption column CR3, centrifuge at 12000 rpm for 15 s, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.

[0083] 9) Add 500 μL of washing solution RW to the adsorption column CR3, centrifuge at 12000 rpm for 15 s, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.

[0084] 10) Repeat step 9).

[0085] 11) Centrifuge at 12000 rpm for 2 min, place the adsorption column CR3 into a new RNase-Free centrifuge tube, add 30-50 μL of RNase-Free ddH2O dropwise to the middle of the adsorption membrane, incubate at room temperature for 2 min, centrifuge at 12000 rpm for 1 min to obtain the RNA solution.

[0086] The RNA was stored at -80°C. Before storage, the integrity of the RNA was detected by agarose gel electrophoresis and the concentration of RNA was determined on an Agilent 2100 bioanalyzer (Santa Clara, California, USA).

[0087] 1.2 RNA reverse transcription into cDNA

[0088] The samples were reverse transcribed using the HiScript IIQ RT SuperMix for qPCR kit (Vazyme, Nanjing). The specific steps are as follows:

[0089] 1) Genomic DNA removal

[0090] Prepare the following mixture in an RNase-free centrifuge tube: 4×g DNA wiper mix 4μL, template RNA 1pg-1μg, and RNase-free ddH2O to a final volume of 16μL; gently mix by pipetting. Incubate at 42℃ for 2 min.

[0091] 2) Preparation of reverse transcription reaction system

[0092] Add the following reagents to the reaction tube in step 1: 4 μL of 5×HiScript II qRT SuperMix II and 16 μL of the reaction solution from step 1. Gently mix by pipetting.

[0093] 3) Perform reverse transcription: 50℃ for 15 min, 85℃ for 5 s. Obtain the reverse transcription product. The product can be used immediately for qPCR, or stored at -20℃ and used within six months; for long-term storage, it is recommended to aliquot and store at -70℃. Avoid repeated freeze-thaw cycles on cDNA.

[0094] 2. Cloning of the full-length MdWRI1 gene

[0095] Using the cDNA from "1.2 RNA reverse transcription to cDNA" as a template, amplification was performed using Phanta Max Super-Fidelity DNA Polymerase (P505) (Vazyme, Nanjing) high-fidelity enzyme. The upstream and downstream primers for MdWRI1 are as follows:

[0096] MdWRI1-F: ATGATGGTGAAGAATGAAGAAAAC (SEQ ID NO. 11);

[0097] MdWRI1-R: CTAAGAAAAGAAAAATATAGAGTCTGA (SEQ ID NO. 12).

[0098] The amplification steps are as follows:

[0099] 1) PCR reaction system

[0100] Upstream primer (10 μM) 2.5 μL, downstream primer (10 μM) 2.5 μL, 2×Phanta Max Buffer 25 μL, template DNA x μL, ddH2O to bring the total to 50 μL.

[0101] The template usage includes: 50-400 ng of genomic DNA, 10 pg-30 ng of plasmid or viral DNA, and 1-5 μL of cDNA (not exceeding 1 / 10 of the total PCR reaction volume).

[0102] 2) PCR reaction program: 95℃ pre-denaturation for 3 min; cycling parameters: 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 70 s, for 35 cycles; 72℃ extension for 5 min.

[0103] After the PCR reaction, the PCR product was recovered, ligated into the cloning vector pMD18-T, transformed into Escherichia coli DH5α, plated onto LB solid medium containing 50 mg / L ampicillin, and incubated overnight at 37°C. Single colonies were selected and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequencing results were compared with the JGI database (https: / / phytozome-next.jgi.doe.gov) by BLAST, and the cloned sequence was consistent with the MD09G1047600 sequence.

[0104] 3. Cloning of a MdWRI1 gene-specific fragment

[0105] Using the cDNA from “1.2 RNA reverse transcription to cDNA” as a template, amplification was performed using Phanta Max Super-Fidelity DNA Polymerase (P505) (Vazyme, Nanjing) high-fidelity enzyme.

[0106] The amplification steps and PCR reaction procedure are the same as those in "2. Cloning of the full length of the MdWRI1 gene".

[0107] After the PCR reaction, the PCR product was recovered, ligated into the cloning vector pMD18-T, transformed into Escherichia coli DH5α, plated onto LB solid medium containing 50 mg / L ampicillin, and incubated overnight at 37°C. Single colonies were selected and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Plasmids were extracted from the correctly sequenced single colonies to determine the specific fragment sequence of the MdWRI1 gene.

[0108] Example 2: Changes in MdWRI1 gene expression during development

[0109] 1) Sample the pericarps of rust-free and rust-free apples at different developmental stages and fix them rapidly in liquid nitrogen. Extract total RNA from the pulp of the above-mentioned apples at different developmental stages and reverse transcribe it into cDNA, using the same method as in "1. RNA extraction and reverse transcription of rust-free apple fruits" in Example 1.

[0110] 2) Design specific primers in the non-conserved region of MdWRI1, as well as apple internal reference primers MdActin-F and MdActin-R.

[0111] The sequence is as follows:

[0112] MdWRI1-qRT-F: CGACCTTCACCAACTTCC (SEQ ID NO. 13);

[0113] MdWRI1-qRT-R:TCTTGCTTCCCATCTGCC (SEQ ID NO. 14);

[0114] MdActin-F: TGACCGAATGAGCAAGGAAATTACT (SEQ ID NO. 15);

[0115] MdActin-R: TACTCAGCTTTTGGCAATCCACATC (SEQ ID NO. 16);

[0116] 3) Using the cDNA obtained in step 2) as templates, adjust these cDNA templates with apple internal reference primers MdActin-F and MdActin-R to make the concentration of each cDNA template consistent.

[0117] 4) Use cDNA templates of consistent concentration to perform qRT-PCR to detect the expression level of the MdWRI1 gene.

[0118] The results showed that the expression level of the MdWRI1 gene was significantly higher in rust-free fruits at 30 and 60 days than in fully rusted fruits. This may positively regulate fruit wax synthesis. Figure 1 (A and B), therefore, further research on the MdWRI1 gene will be conducted later.

[0119] Example 3: Construction of MdWRI1 gene-related vector

[0120] The full-length cDNA sequence of the MdWRI1 gene obtained in Example 1, “2. Cloning of the full-length MdWRI1 gene”, was amplified using primer sequences SEQ ID NO.2 and SEQ ID NO.3, which respectively contain XbaⅠ and SmaⅠ restriction sites. Following the gene cloning method in Example 1, “2. Cloning of the full-length MdWRI1 gene”, the cDNA was ligated into the cloning vector pMD18-T to obtain the fusion plasmid MdWRI1-pMD18-T(XbaⅠ, SmaⅠ).

[0121] Then, the empty vector pCAMBIA2300 and MdWRI1-pMD18-T (XbaⅠ, SmaⅠ) were digested with restriction endonucleases XbaⅠ and SmaⅠ, respectively. After agarose gel electrophoresis, gel recovery, and T4-DNA ligase, the linear pCAMBIA2300 vector and the target gene MdWRI1 fragment were ligated. The resulting fragment was transformed into E. coli DH5α. For single colonies with correct sequencing, the recombinant plasmid MdWRI1-pCAMBIA2300 was extracted.

[0122] The cDNA-specific fragment of the MdWRI1 gene obtained in Example 1, "3. Cloning of the MdWRI1 gene-specific fragment," was amplified using primer sequences of SEQ ID NO. 9 and SEQ ID NO. 10, respectively, containing SpeⅠ and BamHI restriction sites. Following the gene cloning method in Example 1, "2. Cloning of the full-length MdWRI1 gene," the fragment was ligated into the cloning vector pMD18-T to obtain the fusion plasmid pMD18-T(SpeⅠ, BamHI). Amplification was then performed using primer sequences of SEQ ID NO. 7 and SEQ ID NO. 8, respectively, containing Asc I and Swa I restriction sites. Following the gene cloning method in Example 1, "2. Cloning of the full-length MdWRI1 gene," the fragment was ligated into the cloning vector pMD18-T to obtain the fusion plasmid pMD18-T(Asc I, Swa I).

[0123] Then, the empty vector pFGC1008 and the lower-MdWRI1-pMD18-T (SpeⅠ, BamHI) were digested with restriction endonucleases SpeⅠ and BamHI, respectively. After agarose gel electrophoresis, gel recovery, and T4-DNA ligase, the linear pFGC1008 vector and the target gene MdWRI1 fragment were ligated and transformed into E. coli DH5α. For single colonies with correct sequencing, the recombinant plasmid lower-MdWRI1-pFGC1008 was extracted.

[0124] Next, the lower-MdWRI1-pFGC1008 and upper-MdWRI1-pMD18-T (Asc I, Swa I) were digested with restriction endonucleases Asc I and Swa I, respectively. After agarose gel electrophoresis, gel recovery, and ligation of the linear pFGC1008 vector and the target gene MdWRI1 fragment with T4-DNA ligase, the vector was transformed into E. coli DH5α. For single colonies with correct sequencing, the recombinant plasmid MdWRI1-pFGC1008 was extracted.

[0125] Similarly, the cDNA-specific fragment of the MdWRI1 gene obtained in Example 1, “3. Cloning of the MdWRI1 gene-specific fragment”, was amplified using primer sequences SEQ ID NO.5 and SEQ ID NO.6, which respectively contain BamHI and XhoⅠ restriction sites. Following the gene cloning method in Example 1, “2. Cloning of the full-length MdWRI1 gene”, the fragment was ligated into the cloning vector pMD18-T to obtain the fusion plasmid MdWRI1-VIGS-pMD18-T (BamHI, XhoⅠ). Then, the empty vector pTRV2 and MdWRI1-VIGS-pMD18-T (BamHI, XhoⅠ) were digested with restriction endonucleases BamHI and XhoⅠ, respectively. After agarose gel electrophoresis, gel recovery, and T4-DNA ligase, the linear pTRV2 vector and the target gene MdWRI1 specific fragment were ligated. The resulting fragment was transformed into E. coli DH5α. For single colonies with correct sequencing, the recombinant plasmid MdWRI1-pTRV2 was extracted.

[0126] The two recombinant plasmids, MdWRI1-pCAMBIA2300 and MdWRI1-pTRV2, were transformed into Agrobacterium GV3101 using the freeze-thaw method. The recombinant plasmid MdWRI1-pFGC1008 was transformed into Agrobacterium LBA4404 using electroporation.

[0127] Example 4: Transient transformation of apple fruit with the MdWRI1 gene

[0128] 1. Injection of an overexpression vector containing the MdWRI1 gene

[0129] 1) The MdWRI1-pCAMBIA2300 vector bacterial culture containing the target gene fragment, which has been shaken until golden yellow, is centrifuged at 20℃ and 5000 rpm for 10 min, and the supernatant is discarded.

[0130] 2) Resuspend the bacterial cells with ddH2O, centrifuge at 5000 rpm for 10 min at room temperature, and discard the supernatant.

[0131] 3) Resuspend the bacterial cells in 10mM MgCl2, centrifuge at 5000rpm for 10min at room temperature, and discard the supernatant.

[0132] 4) 10mM MgCl2 suspension of bacterial cells, adjusting OD 600nm =0.6-0.8.

[0133] 5) Add 10 mM MES and 150 mM acetylsuccinone (AS).

[0134] 6) After letting the mixture stand in the dark for 2-3 hours, inject the apple and observe the phenotype after 3-5 days.

[0135] 2. Injection of a silencing vector containing the MdWRI1 gene

[0136] 1) The pTRV2 and pTRV1 helper vector bacterial cultures containing the target gene fragment, which have been shaken until golden yellow, are centrifuged at 5000 rpm for 10 min at room temperature, and the supernatant is discarded.

[0137] 2) Resuspend the bacterial cells with ddH2O, centrifuge at 5000 rpm for 10 min at room temperature, and discard the supernatant.

[0138] 3) Resuspend the bacterial cells in 10mM MgCl2, centrifuge at 5000rpm for 10min at room temperature, and discard the supernatant.

[0139] 4) 10mM MgCl2 suspension of bacterial cells, adjusting OD 600nm =0.6-0.8.

[0140] 5) Mix the pTRV2 vector and pTRV1 helper vector containing the gene in equal volumes at a ratio of 1:1.

[0141] 6) Add 10mM MES and 150mM acetylsuccinone.

[0142] 7) After letting the mixture stand in the dark for 2-3 hours, inject the apple and observe the phenotype after 3-5 days.

[0143] Example 5: Subcellular localization of the MdWRI1 gene

[0144] Similar to the transient overexpression method in fruits described above, the enzyme-digested MdWRI1 fragment was inserted into the pCAMBIA2300-GFP vector (Sma I / Xba I) to generate the MdWRI1-green fluorescent protein (GFP) fusion protein construct. The resulting construct was transferred to Agrobacterium GV3101 and used to infect fresh onion scales. The infected onion scales were observed using an EVOS FL AUTO2 (Thermo Fisher Scientific, Massachusetts, USA). The specific steps are as follows:

[0145] 1) Use fresh onions. First, remove the outer scales. Then, on a clean bench, use a sterilized blade to cut the inner skin of the onion into small pieces. Use sterilized tweezers to remove the inner skin and spread it evenly on 1 / 2 MS solid culture medium without any hormones. Incubate in the dark at 28°C for about 24 hours.

[0146] 2) Under dark conditions, the previously transformed pCAMBIA2300-GFP-MdWRI1 Agrobacterium tumefaciens culture was added to LB liquid medium (containing 100 mg / L kanamycin and 100 mg / L rifamycin) and cultured on a shaker at 200 rpm at 28°C to obtain the optimal growth environment for the strain. OD was then measured. 600 The value is around 0.8-1.0, and Mcherry (the nuclear localization marker) is cultured to OD using the same steps. 600 The value is approximately 0.8-1.0. Based on the target gene and the final concentration of Agrobacterium tumefaciens in Mcherry, calculate the amount of each bacterial culture to be used, transfer it to a 50 mL centrifuge tube, centrifuge at 5000 rpm for 10 min, then discard the supernatant, retain the bacterial cells, and resuspend them in 1 / 2 MS liquid medium containing acetylsuccinone.

[0147] 3) Place the pretreated inner epidermis of the onion into the pre-prepared infection solution for 15 minutes, stirring regularly to improve the maceration effect. Then, remove the maceration solution using sterile filter paper and place it on 1 / 2 MS solid medium containing acetylsuccinone, and keep it at 28°C for 16 hours (the entire process is carried out on a clean bench).

[0148] 4) Under an AUTO2 microscope, the onion epidermis was first immersed in 1 / 2 MS liquid culture medium, then washed in sterile water, and finally spread out on a clean glass slide. A coverslip was then placed on top to remove air bubbles, and the localization of the target protein at the subcellular level was observed.

[0149] The results showed that MdWRI1-GFP was localized in the cell nucleus ( Figure 1 (C), with a scale bar of 125 μm.

[0150] Example 6: Phenotypic and waxy component analysis of apple fruits after instantaneous transformation

[0151] 1. Photograph of apple fruit appearance

[0152] Apples from the four experimental groups were placed in a small photography studio, and photographs were taken with a camera pointed directly at the injection holes. Clear injection holes were observed on the surface of the fruit from all four groups. See also pCAMBIA2300 and MdWRI1-pCAMBIA2300 apples. Figure 2 See also the fruits of pTRV2 and MdWRI1-pTRV2 (see A); Figure 3 A.

[0153] 2. Wax composition analysis diagram

[0154] 1) Fruit wax extraction: Fruit slices were immersed in chloroform. The combined extracts were concentrated using a rotary evaporator under a nitrogen flow at 55°C, and the wax yield was determined by gravimetric analysis. The wax content was calculated using the following equation:

[0155] Wax content (μg / dm) 2 = Wax weight / area of ​​the stripped sample.

[0156] 2) GC-MS analysis of wax components:

[0157] Wax extraction was performed on the pericarp of the injected samples. The wax content in the pericarp of MdWRI1-pCAMBIA2300 fruit was significantly increased, being twice that of pCAMBIA2300 fruit. Figure 2 The wax content in the pericarp of fruit containing MdWRI1-pTRV2 was significantly reduced (B); Figure 3 (B)

[0158] GC-MS analysis revealed that the main wax components, including alkanes, fatty acids, fatty aldehydes, and fatty alcohols, were all detected. Figure 2 In the fruit of MdWRI1-pCAMBIA2300, 15 monomeric alkanes were mainly detected. Among them, the components with carbon chain lengths of 9, 11, 13, 14, 16, 20, 26, 30, and 36 were significantly increased, with even-numbered carbon chains being dominant. The contents of C10 and C32 decreased relatively, and C15 and C29 were only detected in the pericarp of MdWRI1-pCAMBIA2300 fruit. Figure 2 (F). Four fatty acid monomers, C9, C19, C21, and C36, were detected, and their contents increased significantly after overexpression of the MdWRI1 gene. Figure 2 (Medium G). Small amounts of fatty aldehydes and fatty alcohols were detected, at twice the levels found in pCAMBIA2300 fruit. Figure 2 (D, E)

[0159] In MdWRI1-pTRV2, the total amount of fatty alcohols was significantly reduced, while the total amount of the other three components decreased only slightly. Figure 3 Further analysis of the changes in the content of each component in the injected sample revealed that among the 15 monomeric components detected in alkanes, the components with carbon chain lengths of 9, 13, 17, and 30 were significantly reduced, with odd-numbered carbon chains being dominant. Figure 3 (F). A decrease in the content of fatty alcohol monomers with a carbon chain length of 27 was detected, but the difference was not significant. Figure 3 (D). The content of fatty alcohol monomers with a carbon chain length of 31 decreased by approximately 1.5 times. Figure 3 (E). Four fatty acid monomers, C9, C19, C21, and C36, were detected, and their contents decreased in MdWRI1-pTRV2, with no significant difference. Figure 3 (G).

[0160] Example 7: Transient transformation of expression levels of genes related to wax in apple fruit

[0161] 1) Apple pulp samples were taken from the four experimental groups and rapidly fixed in liquid nitrogen. Total RNA was extracted from the pulp of the different groups and reverse transcribed into cDNA, using the same method as in "1. RNA extraction and reverse transcription of rust-free apple fruit" in Example 1.

[0162] 2) Specific primer sequences for the MdWRI1 gene are shown in SEQ ID NO.13 and SEQ ID NO.14. Specific primers were designed for the non-conserved regions of the MdCER1, MdCER2, MdKCS7, MdLTPG1, and MdLACS2 genes, with the following sequences:

[0163] MdCER1-qRT-F: CTTGGAAGCTTTAAGCATGTGG (SEQ ID NO. 17);

[0164] MdCER1-qRT-R: GGAGGAATGGTGATGTGAGTGG (SEQ ID NO. 18);

[0165] MdCER2-qRT-F: ATCCGGATAACCGAAACGGG (SEQ ID NO. 19);

[0166] MdCER2-qRT-R: AGGCAGAAAACGCATCTCCA (SEQ ID NO. 20);

[0167] MdKCS7-qRT-F: CCCTAAAAACCAACATCACCAC (SEQ ID NO. 21);

[0168] MdKCS7-qRT-R: AGGCACCTCTACAGGAAACTCA (SEQ ID NO. 22);

[0169] MdLTPG1-qRT-F: AAATGATTGCGGTGTTGTT (SEQ ID NO. 23);

[0170] MdLTPG1-qRT-R: TCCAGTAGTGGGAGTTGCT (SEQ ID NO. 24);

[0171] MdLACS2-qRT-F: CTCCCACAAGAAAAAGCAGCACC (SEQ ID NO. 25);

[0172] MdLACS2-qRT-R: CTCTCAGGCAAATCTCTCCACGG (SEQ ID NO. 26).

[0173] 3) Using the cDNA obtained in step 1) as templates, adjust these cDNA templates with apple internal reference primers MdActin-F (SEQ ID NO.15) and MdActin-R (SEQ ID NO.16) to make the concentration of each cDNA template consistent.

[0174] 4) Using cDNA templates of consistent concentration, qRT-PCR was performed to detect the expression differences of MdCER1, MdCER2, MdKCS7, MdLTPG1, MdLACS2 and MdWRI1 genes in fruits from different experimental groups.

[0175] The results showed that the expression level of the MdWRI1 gene in MdWRI1-pCAMBIA2300 fruit was significantly higher than that in the control fruit (empty vector pCAMBIA2300); while the expression level of wax-related genes in MdWRI1-pCAMBIA2300 fruit was significantly upregulated. Figure 2 (H). Compared with the control fruit (empty vector pTRV), the expression level of the MdWRI1 gene was significantly reduced in MdWRI1-pTRV fruit, while in MdWRI1-pTRV2 fruit, the expression level of wax-related genes was significantly downregulated (H). Figure 3 These results fully demonstrate that the MdWRI1 gene plays a positive regulatory role in fruit wax synthesis, and that the MdWRI1 gene exerts its positive regulatory role in fruit wax by promoting wax biosynthesis.

[0176] Example 8: Phenotypic analysis, wax composition analysis, and expression levels of wax-related genes in apple tissue culture seedlings transformed from leaf discs.

[0177] 1. Photographs of apple tissue culture seedling phenotypes

[0178] Photographs were taken of wild-type 'GL-3' and transgenic apple tissue culture seedlings. Figure 4 China A Figure 5 (A)

[0179] 2. Wax composition analysis diagram

[0180] The results showed that the total wax content in the leaves of MdWRI1-pCAMBIA2300 plants was significantly higher than that in the control group, reaching 1.5-2 times higher. Figure 4 (B). GC-MS results showed that the main components of the wax in apple 'GL-3' tissue culture seedlings were phenols, fatty acids, and alkanes, with a particularly significant increase in the content of alkanes. Figure 4 (C). Eleven monomeric components were screened from alkane compounds, with carbon chain lengths of 10, 12, 13, 15, and 22 all significantly increased in the three MdWRI1-pCAMBIA2300 lines. Figure 4 (D). The fatty acid monomer components C19, C21, and C36, and the phenolic monomer component C31, were significantly increased in OE-4 and OE-6. Figure 4 (E, F)

[0181] The total wax content in the leaves of MdWRI1-pFGC1008 plants was significantly lower than that in the control group. Figure 5 (B). GC-MS results showed a significant decrease in the contents of phenols, fatty acids, and alkanes. Figure 5 (C). Twelve monomeric components were screened from alkane compounds, and the carbon chain lengths of 9, 10, 12, 13, 14, 15, and 17 were all significantly reduced in the three MdWRI1-pFGC1008 lines. Figure 5 (D). The fatty acid monomer components C19 and C21 and the phenolic monomer components C30 and C31 were all significantly reduced. Figure 5 (E, F)

[0182] Therefore, we hypothesize that the MdWRI1 transcription factor in apple 'GL-3' not only promotes wax synthesis but also influences the composition of wax components. These components are primarily alkanes, with minor amounts of fatty acids and phenols.

[0183] 3. Expression levels of wax-related genes in transgenic plants

[0184] Expression levels of genes related to the wax synthesis pathway in transgenic apple plants were measured, revealing that the expression levels of wax synthesis genes KCS1, KCS7, LTPG1, and LACS2 were significantly upregulated in MdWRI1-pCAMBIA2300 plants compared to their respective controls. Figure 4In MdWRI1-RNAi plants, the expression levels of wax synthesis genes KCS1, KCS7, LTPG1, and LACS2 were significantly downregulated. Figure 5 (J). We infer that the MdWRI1 gene may affect the synthesis of waxes in transgenic plants by regulating the expression of these key genes.

[0185] Example 9: Determination of Physiological Indicators of Transgenic Plants

[0186] 1) TB staining: Leaves of four-week-old tissue culture seedlings were cut and completely immersed in 0.05% toluidine blue solution for 2 hours. The material was then removed and rinsed 2-3 times with deionized water.

[0187] 2) Chlorophyll extraction: Leaves from 6-week-old tissue culture seedlings were weighed and placed in 30 mL of 80% ethanol at room temperature with slow stirring (in the dark). Extracts were removed from each sample every 10 minutes, repeated ten times. Absorbance was measured at wavelengths of 664 nm and 647 nm, and the total chlorophyll concentration per gram of fresh weight was calculated using the following formula: Total micromolar chlorophyll = 7.93 (A 664 )+19.53(A 647 ).

[0188] 3) Hydrophobicity test: Lay the leaves of four-week-old tissue culture seedlings flat, add water droplets of the same volume to the surface and measure the angle between the water droplets.

[0189] The TB staining test was used to observe changes in wax permeability. The results showed that, compared with wild-type plants, the leaves of MdWRI1-pCAMBIA2300 exhibited lower permeability during the staining process. Figure 4 MdWRI1-RNAi leaves showed higher permeability during staining (H), Figure 5 The presence of H indicates that MdWRI1 can alter epidermal permeability. Furthermore, chlorophyll extraction experiments revealed that the extraction of chlorophyll from MdWRI1-pCAMBIA2300 plants was significantly slower. Figure 4 The process of extracting chlorophyll from MdWRI1-RNAi plants was significantly accelerated (G). Figure 5 The presence of water droplets (G) further confirmed the altered permeability of the leaf cuticle. To verify the hydrophobicity of the leaves, we applied water droplets of the same volume to the leaves. Observations revealed that the water droplets had a smaller contact area on the leaves of the MdWRI1-pCAMBIA2300 plant, indicating that the leaves of the MdWRI1-pCAMBIA2300 plant have higher hydrophobicity. Figure 4 (I). The larger contact area of ​​water droplets on the leaves of MdWRI1-RNAi plants indicates that the hydrophobicity of MdWRI1-RNAi plant leaves is reduced. Figure 5 (I). These findings provide a new perspective on understanding the role of the MdWRI1 gene in regulating leaf wax layer properties.

[0190] Based on the aforementioned techniques, a transcription factor, MdWRI1, was isolated from apples. Functional verification through transient injection experiments in apples and in transgenic plants showed that the MdWRI1 gene plays a significant role in promoting wax synthesis in apple fruits. The discovery of the MdWRI1 gene provides a basis for improving apple fruit quality and has significant economic and social benefits for enhancing apple quality.

[0191] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. An apple MdWRI1 use of the gene in any of the following: (1) Application in regulating wax content in plant fruits and / or leaves; (2) Application in the cultivation of transgenic plants with high wax content in fruits and / or leaves; (3) Application in the preparation of products that increase the wax content of plant fruits and / or leaves; The apple MdWRI1 The nucleotide sequence of the gene is shown as SEQ ID NO. 1; upregulate the expression of the apple MdWRI1 gene in the plant, increasing the wax content of the fruit and / or leaves of the plant; The plant in question is an apple.

2. Use according to claim 1, wherein The method for upregulating the expression level of the apple MdWRI1 gene in plants includes the steps of constructing an overexpression vector of the apple MdWRI1 gene, transforming the overexpression vector into Agrobacterium, and then infecting the plant.

3. A plant comprising the recombinant vector of claim 1. MdWRI1 Use of a recombinant vector comprising the gene of claim 1 in any of: (1) Application in regulating wax content in plant fruits and / or leaves; (2) Application in the cultivation of transgenic plants with high wax content in fruits and / or leaves; (3) Application in the preparation of products that increase the wax content of plant fruits and / or leaves; upregulating the expression of said apple MdWRI1 gene in a plant, increasing the wax content of the fruit and / or leaves of said plant; The plant in question is an apple.

4. The use of an engineered bacterium comprising the recombinant vector of claim 3 in any of the following: (1) Application in regulating wax content in plant fruits and / or leaves; (2) Application in the cultivation of transgenic plants with high wax content in fruits and / or leaves; (3) Application in the preparation of products that increase the wax content of plant fruits and / or leaves; upregulating the expression of said apple MdWRI1 gene in a plant, increasing the wax content of the fruit and / or leaves of said plant; The plant in question is an apple.

5. A method for increasing the wax content of plant fruits and / or leaves, characterized in that, Including upregulating apples in plants MdWRI1 The steps of increasing gene expression levels to improve the wax content of the plant's fruits and / or leaves; The MdWRI1 The nucleotide sequence of the gene is shown as SEQ ID NO. 1; The plant in question is an apple.

6. The method as described in claim 5, characterized in that, The method of up-regulating the expression amount of the apple MdWRI1 gene in the plant, comprising the steps of constructing a over-expression vector of the apple MdWRI1 gene, transforming the over-expression vector into Agrobacterium, and then infecting the plant.

7. A breeding method of a transgenic plant having high fruit and / or leaf wax content, characterized by, Includes the following steps: Overexpression of the apple MdWRI1 gene in plant cells, followed by growing the plant cells and regenerating plants from the plant cells, i.e. transgenic plants having increased fruit and / or leaf wax content. The apple MdWRI1 The nucleotide sequence of the gene is shown as SEQ ID NO. 1; The plant in question is an apple.

8. A type of apple MdWRI1 The application of genes in improving plant drought resistance and / or disease and pest resistance is characterized by, The apple MdWRI1 The nucleotide sequence of the gene is shown in SEQ ID NO.1; The plant in question is an apple.

9. The application as described in claim 8, characterized in that, The apple MdWRI1 The gene enhances the plant's drought resistance and / or disease and pest resistance by increasing the wax content of the plant's fruit and / or leaves.