Genetic marker linked with wheat grain nickel ion accumulation QTL qNi.hnaas-6BS

Abstract

The invention discloses a genetic marker linked with wheat grain nickel ion accumulation QTL qNi.hnaas-6BS. The genetic marker is characterized in that genotype data of a natural population is obtained through identification by adopting a Wheat Breeds 660K # imgabs0 # microarray chip, and genotype data of the grain nickel ion content of the natural population of wheat is combined to carry out whole genome association analysis (GWAS), so that the genetic marker linked with the wheat grain nickel ion accumulation QTL qNi.hnaas-6BS can be obtained, and the genetic marker linked with the wheat grain nickel ion accumulation QTL qNi.hnaas-6BS can be used for identifying the grain nickel ion accumulation QTL qNi.hnaas-6BS. It is identified that a quantitative trait locus (Quantitative Trait Locus, QTL) qNi.hnaas-6BS for controlling accumulation of nickel ions in wheat grains exists on a short arm of a wheat 6B chromosome, the QTL qNi.hnaas-6BS is closely linked with SNP6872 and is located at 125th, 482nd and 475th nucleotides of the 6B chromosome, and the SNP6872 has C / T polymorphism. A haplotype analysis result on a population level shows that when nucleotide at the site is CC, the wheat grains have relatively low nickel ion content, and are favorable allelic genotypes for limiting nickel ion accumulation of the wheat grains.

Description

Technical Field

[0001] The present invention relates to the technical field of wheat molecular breeding, and more specifically, it relates to the screening and application of genetic markers linked to the wheat grain nickel ion accumulation QTL qNi.hnaas-6BS. Background Art

[0002] Nickel pollution in soil has become a serious global environmental problem, mainly caused by human activities such as metal processing, mining, and the use of nickel-containing products, which are the main causes of soil nickel pollution (Rizwan et al., 2024). Once nickel ions enter the soil, they will be absorbed by wheat and enter the food chain, thus affecting human health. Research shows that high concentrations of nickel ions are carcinogenic, and long-term exposure or ingestion will increase the risk of cardiovascular diseases, lung diseases, and various cancers (Cangul et al., 2002). At the same time, high concentrations of nickel ions are toxic and can inhibit key physiological processes such as seed germination, nutrient absorption, and photosynthesis, resulting in a decline in wheat yield and quality (Nagajyoti et al., 2010). In addition, wheat is an important staple crop for humans, providing about 20% of the energy and protein in the human diet (data from the World Health Organization). Once contaminated by heavy metals such as nickel ions, it will pose a serious threat to human health. Therefore, breeding wheat varieties that can tolerate nickel stress and maintain an appropriate balance of nickel ion levels through biofortification is crucial for improving wheat yield and quality.

[0003] Like other trace element-related traits, the absorption and transport of nickel ions are typical quantitative traits, controlled by multiple genes, and showing continuous phenotypic variation in natural populations. However, so far, only 2 studies have identified a very small number of QTL loci controlling wheat grain nickel ion accumulation (Bhatta et al., 2018; Safdar et al., 2020), which provides very limited data for identifying the main genetic loci of nickel ion accumulation in wheat grains and screening superior haplotypes of excellent genes.

[0004] Genome-wide association analysis is an accurate statistical method for identifying genetic loci of quantitative traits, which greatly improves the resolution and accuracy of QTL mapping. Previous studies have used this method to identify QTL loci controlling grain nickel ion accumulation in various crops such as rice, soybean, and millet, and applied them to the genetic improvement process of crops (Liu et al., 2024; Bellaloui et al., 2023). Summary of the Invention

[0005] (1) Technical Problems to be Solved

[0006] In view of the problems existing in the prior art, the present invention provides a genetic marker linked to the wheat grain nickel ion accumulation QTL qNi.hnaas-6BS to solve the technical problems mentioned in the background art.

[0007] (II) Technical solution

[0008] To achieve the above object, the present invention provides the following technical solution: a genetic marker linked to the wheat grain nickel ion accumulation QTL qNi.hnaas-6BS, which locus is located at the 125,482,475th nucleotide on chromosome 6B of the wheat "Chinese Spring" reference genome, and its upstream and downstream sequences are CCAAGACGAGCCATGACACACAATCTTGCCTCACA[C / T]CTCATCAGTC GCTGCTTGTATGTATGTACCTTGTG, wherein the 36th base of the nucleotide sequence has C / T polymorphism.

[0009] The present invention is further configured to perform haplotype analysis using the SNP6872 genotyping data of the natural population and the wheat grain nickel ion content data, and it is found that the grain nickel ion content of individuals with the CC genotype is significantly lower than that of individuals with the TT genotype at the population level, that is, when the locus is the CC genotype, the nickel ion content of wheat grains is significantly lower than that of individuals with the TT genotype, indicating that the CC genotype is the dominant haplotype controlling wheat grain nickel ions and is a favorable allele for restricting wheat grain nickel ion accumulation.

[0010] The present invention is further configured to be applicable to the early prediction of wheat grain nickel ion content, which is not only beneficial for breeders to screen germplasm resource materials resistant to heavy metal stress, but also beneficial for cultivating new wheat varieties that are more resistant to nickel ion stress and have stronger environmental adaptability.

[0011] Genotyping using gene chip technology: The genotypes of the natural population are identified using a wheat 660K gene chip, and filtering is performed according to the criteria that the minor allele frequency (MAF) is greater than 0.05 and the genotype missing data is less than 10%, and a total of 224,706 effective marker loci are screened for subsequent genome-wide association analysis.

[0012] Method for measuring wheat grain nickel ion content: Harvest mature grains, after drying, grinding, and microwave digestion, the nickel ion content of wheat grains in the natural population is measured using inductively coupled plasma-mass spectrometry.

[0013] Identification of major genetic loci: Three analytical methods, namely GLM (General Linear Model), MLM (Mixed Linear Model), and FarmCPU (Fixed and Random Model Circulating Probability Unification Model), were used to identify genetic loci controlling nickel ion accumulation in wheat grains at the whole-genome level. Through analysis, a major genetic locus qNi.hnaas-6BS controlling nickel ion accumulation in wheat grains was found on chromosome 6BS, and an SNP marker SNP6872 with a tight linkage relationship with it under multiple environmental conditions was identified. The nucleotide sequences upstream and downstream of it are shown in SEQ IN NO:1. There is an allelic mutation of 36C-36T at the 36th base of this sequence, resulting in nucleotide polymorphism. Combining the phenotypic data of nickel ions in wheat grains in the natural population and the genotype data of this mutation site, haplotype analysis was carried out, and it was found that when this site is CC, wheat grains have a lower nickel ion content, and when this site is TT, they have a higher nickel ion content. It shows that the CC genotype is a favorable haplotype for controlling nickel ion accumulation in wheat grains and is a favorable allelic genotype for reducing the toxicity of nickel ions in wheat grains and enhancing the heavy metal stress tolerance ability.

[0014] The molecular marker identified in the present invention can be used to screen wheat germplasm resources materials resistant to heavy metal nickel ion stress and to breed new wheat varieties (lines) resistant to heavy metal stress, which has important application value for improving the nutritional and health quality of wheat and enhancing the environmental adaptability of varieties.

[0015] (III) Beneficial effects

[0016] Compared with the prior art, the present invention provides a genetic marker linked to the QTL qNi.hnaas-6BS for nickel ion accumulation in wheat grains, having the following beneficial effects:

[0017] The purpose of the present invention is to provide a genetic marker that can quickly and conveniently detect the nickel ion content in wheat grains. The SNPs of wheat are typed using a wheat 660K gene chip, and GWAS method is used to screen SNP sites related to nickel ion accumulation in wheat grains. The genetic marker of the present invention is SNP6872, located at the 125,482,475th nucleotide of chromosome 6BS of wheat. The nucleotide sequences upstream and downstream of it are as shown in SEQ INNO:1. Using this marker, the nickel ion content of mature grains can be accurately and quickly predicted in the early stage of wheat growth and development. It has the characteristics of large throughput and high detection efficiency, providing new marker resources and applications for the breeding of new wheat varieties resistant to heavy metal stress and the improvement of wheat biofortification breeding methods. Brief description of the drawings

[0018] Figure 1 It is a schematic diagram showing the normal distribution of the phenotypic data of nickel ion content in the natural population under different environments in the present invention;

[0019] Figure 2 Manhattan plots and QQ-plots for genome-wide association analysis of nickel ion content in wheat grains using GLM, MLM, and FarmCPU models;

[0020] Figure 3 Distribution map of different allelic genotypes and their corresponding phenotypic data of the tightly linked molecular marker SNP6872 for the major QTL qNi.hnaas-6BS controlling nickel ion accumulation in wheat grains in a natural population. Detailed implementation methods

[0021] The following examples are used to illustrate the screening process and results of SNP molecular markers related to nickel ion accumulation in wheat grains of the present invention, but are not used to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

[0022] Description of experimental materials: All experimental materials used in the present invention were provided by the Henan Academy of Agricultural Sciences. The natural population consisted of 207 wheat varieties (lines) with rich genetic backgrounds. After physiological maturity, they were harvested for subsequent analysis.

[0023] Example 1: Determination and statistical analysis of nickel ion content in wheat grains

[0024] In this example, the nickel ion content in wheat grains was determined, and the specific process is as follows.

[0025] The nickel ion concentration in wheat grains was determined by microwave digestion and inductively coupled plasma-mass spectrometry (Table 1).

[0026] (1) Sample pretreatment: After the wheat reached physiological maturity, the wheat in the natural population planted in Kaifeng and Shangqiu areas was harvested, threshed, dried at 55 °C for 24 hours, then ground using a small experimental mill, and screened using a sieve with a pore size of 0.15 mm to obtain experimental samples that met the requirements for subsequent nickel ion content determination; 200 mg of dry whole wheat flour was weighed and placed in 8 ml of concentrated nitric acid solution (8 mol / L, analytical pure grade), left to stand for 4 - 8 hours, and the sample was digested using a microwave digester according to the digestion steps of 120 °C - 5 minutes, 150 °C - 10 minutes, and 190 °C - 20 minutes; the digested solution was filtered and diluted to 50 mL with 1% nitric acid solution for standby.

[0027] (2) Establishment of the standard curve: The mixed standard solution was injected into the inductively coupled plasma-mass spectrometer to measure the signal response values of nickel and internal standard elements. A standard curve was plotted with the concentration of nickel as the abscissa and the ratio of the response signal value of nickel to the selected internal standard element as the ordinate.

[0028] (3) Determination of nickel ion content: Inject the blank solution and the sample solution into an inductively coupled plasma-mass spectrometer respectively, measure the signal response values of nickel element and internal standard element, obtain the concentration of nickel element in the digestion solution according to the standard curve, and repeat 3 times to obtain the nickel ion content data in wheat grains.

[0029] (4) Phenotypic data analysis of nickel ion content in wheat grains

[0030] First, use the "lem4" package of R software version 4.2.2. According to the method of Y=(1|Line)+(1|Loc)+(1|Rep%in%Line:Loc)+(1|Line:Loc), estimate the best linear unbiased prediction (BLUP) of each variety in two planting locations as one environmental data for candidate association analysis. Secondly, use the "psych" package to perform descriptive statistics on the phenotypic data of natural populations in different environments. As shown in Table 1, the variation range of nickel ion content in wheat grains in different environments is from 23.46 μg / kg to 294.05 μg / kg ( Figure 1 A, Table 2), and the phenotypic data of nickel ion content in natural populations under different environments all conform to the normal distribution ( Figure 1 B), indicating that the wheat varieties included in this population have extensive genetic diversity and are an ideal population for subsequent GWAS analysis.

[0031] Table 1 Nickel ion content in wheat grains of natural populations in different environments

[0032]

[0033]

[0034]

[0035]

[0036]

[0037]

[0038]

[0039]

[0040]

[0041]

[0042] Table 2 Descriptive statistics of nickel ion content data of natural populations in different environments

[0043]

[0044] 1SD, standard deviation;

[0045] 2Kurtosis, a characteristic number representing the peak height of the probability density distribution curve at the mean

[0046] 3Skewness, a measure of the direction and degree of skewness of the statistical data distribution, and a numerical characteristic of the asymmetry degree of the statistical data distribution

[0047] Example 2: Genotype detection

[0048] (I) Extracting genomic DNA from wheat leaves using the CTAB (Cetyl trimethylammonium bromide) method

[0049] 1) Take 0.5 g of fresh wheat leaf samples, quickly freeze them in liquid nitrogen for 30 s, and quickly grind and break them;

[0050] 2) Add 5000 μL of CTAB extraction solution at 65 °C, and perform water bath for 30 min to lyse the tissue;

[0051] 3) Cool to room temperature and add 500 μL of chloroform:isoamyl alcohol (24:1) solution to extract the samples;

[0052] 4) Centrifuge at room temperature for 5 min (12000 rpm / min), aspirate 400 μL of the supernatant, and transfer it to a 1.5 mL centrifuge tube;

[0053] 5) Add an equal volume of frozen isopropanol to precipitate flocculent DNA. Centrifuge for 5 min (12000 rpm / min), pour out the supernatant, and obtain the DNA precipitate;

[0054] 6) Rinse twice with 75% ethanol solution and 100% ethanol solution in sequence. Air dry for 8 hours, add 200 μL of deionized water to dissolve the DNA for standby (dissolve for 4 - 8 hours);

[0055] 7) Aspirate 2 μL of the dissolution solution and use the NanoDrop TM One system for concentration and purity detection.

[0056] (II) Determining genotypes using SNP chips

[0057] Using Wheat Breeders 660K The microarray chip was used to genotype all varieties (lines) in the natural population. This chip is a physical chip that contains more than 630,000 specific SNP loci evenly distributed across the wheat genome, providing a sufficient number of SNP markers for genotyping.

[0058] (III) Genotype quality control

[0059] Using the PLI NK v2.0 software (https: / / www.cog-genomics.org / plink / 2.0 / ), according to the criteria that the minor allele frequency (MAF) is greater than 0.05 and the missing rate of genotype data is less than 10%, the genotype data of 207 natural population materials were quality controlled, and finally 224,706 effective SNP markers were obtained for subsequent GWAS analysis.

[0060] Example 3: Identification and utilization of the SNP6872 molecular marker

[0061] (I) Genome-wide association analysis

[0062] Combined with the phenotypic data and genotype data of wheat grain nickel ion content of 207 different wheat varieties (lines), the GLM, MLM, and FarmCPU models of the GAPI T analysis software (Genome Association and Prediction Integrated Tool) were used for association analysis to identify stable genetic loci controlling wheat grain nickel ion accumulation jointly identified under different models and multiple environmental conditions.

[0063] (II) Result analysis

[0064] It was found that under multiple environmental conditions, the nucleotide at position 125,482,475 on chromosome 6BS jointly identified by the three analysis models was significantly associated with wheat grain nickel ion content ( Figure 2 ).

[0065] (III) Utilization of the SNP6872 molecular marker

[0066] The upstream and downstream nucleotide sequences of this marker are CCAAGACGAGCCATGACACACAATCTTGCCTCACA[C / T]CTCATCAGTC GCTGCTTGTATGTATGTACCTTGTG, and there is an allelic mutation of 36C-36T at the 36th base of this sequence. As shown in Table 3, the nickel ion content in wheat grains of individuals with the CC genotype was significantly lower than that of individuals with the TT genotype. It indicates that the CC genotype is a dominant haplotype controlling wheat grain nickel ion accumulation and is a favorable allelic genotype for reducing the nickel ion toxicity in wheat grains and enhancing the heavy metal stress tolerance ability.Figure 3 )。

[0067] Table 3 Effects of different genotypes of SNP6872 marker on nickel ion accumulation in wheat grains

[0068]

[0069] 1 Number of varieties (lines) with different allelic genotypes in the natural population;

[0070] 2 Analysis of variance was used to analyze the differences in nickel ion content in wheat grains among different allelic genotype populations. P-value < 0.05 indicates significant difference, and P-value < 0.01 indicates extremely significant difference.

[0071] Figure 2 Manhattan plots and QQ-plots of genome-wide association analysis of nickel ion content in wheat grains using GLM, MLM, and FarmCPU models. The red solid line is the threshold line of -log10P = 4. SNP loci above the threshold line are significantly associated with nickel ion content in wheat grains; the red circle represents the SNP locus SNP6872 that was commonly identified by the three analysis models and is significantly associated with nickel in wheat grains.

[0072] Figure 3 Distribution map of different allelic genotypes and their corresponding phenotypic data of the major QTL qNi.hnaas-6BS tightly linked molecular marker SNP6872 controlling nickel ion accumulation in wheat grains in the natural population. Orange represents the distribution of BLUP values of phenotypic data of CC genotype varieties (lines), and green represents the distribution of BLUP values of phenotypic data of TT genotype varieties (lines). The nickel ion content in wheat grains of CC genotype varieties (lines) is significantly lower than that of TT genotype varieties (lines), and it is the favorable allelic genotype.

[0073] Main references:

[0074] Rizwan,M,Usman,K,Alsafran,M.Ecological impacts and potential hazardsof nickel on soil microbes,plants,and human health[J].Chemosphere,2024,357,142028。

[0075] Cangul, H, Broday, L, Salnikow, K, Sutherland, J, Peng, W, Zhang, Q, Poltaratsky, V, Yee, H, Zoroddu, M A, Costa, M. Molecular mechanisms of nickel carcinogenesis[J]. Toxicology Letters, 2002, 127, 69 - 75.

[0076] Nagajyoti, P C, Lee, K D, Sreekanth, T V M. Heavy metals, occurrence and toxicity for plants: a review[J]. Environmental Chemistry Letters, 2010, 8, 199 - 216。

[0077] Bhatta, M, Baenziger, P S, Waters, B M, Poudel, R, Belamkar, V, Poland, J, Morgounov, A. Genome - wide association study reveals novel genomic regions associated with 10 grain minerals in synthetic hexaploid wheat[J]. Int J Mol Sci, 2018, 19, 3237.

[0078] Safdar, L B, Almas, F, Rehman, Au, Umer, M J, Ali Shah, S M, Uddin, S, Ashfaq, S, Rahman, H U, Quraishi, U M. Genetic dissection of Ni toxicity in a spring wheat diversity panel by using 90K SNP array[J]. Current Plant Biology, 2020, 24, 100175。

[0079] Liu, H, Zhang, X, Shang, Y, Zhao, S, Li, Y, Zhou, X, Huo, X, Qiao, P, Wang, X, Dai, K, Li, H, Guo, J, Shi, W. Genome-wide association study reveals genetic loci for tentrace elements in foxtail millet(Setaria italica)[J]. Theoretical and Applied Genetics, 2024, 137, 186.

[0080] Bellaloui, N, Knizia, D, Yuan, J, Song, Q, Betts, F, Register, T, Williams, E, Lakhssassi, N, Mazouz, H, Nguyen, H T, Meksem, K, Mengistu, A, Kassem, M A. Genetic mapping for QTL associated with seed nickel and molybdenum accumulation in the soybean ‘Forrest’ by ‘Williams 82’ RIL population[J]. Plants, 2023, 12, 3709。

[0081] Sequence

[0082] SEQ IN NO:1

[0083] CCAAGACGAGCCATGACACACAATCTTGCCTCACA[C / T]CTCATCAGTCGCTGCTTGTATGTATGTACCTTGTG。

[0084] Although the embodiments of the present invention have been shown and described, those of ordinary skill in the art can understand that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A genetic marker linked to the wheat grain nickel ion accumulation QTL qNi.hnaas-6BS, characterized by: The site is located at the 125,482,475th nucleotide on chromosome 6B of the wheat "Chinese Spring" reference genome, and its upstream and downstream sequences are CCAAGACGAGCCATGACACACAATCTTGCCTCACA[C / T]CTCATCAGTC GCTGCTTGTATGTATGTACCTTGTG, among which the 36th base of the nucleotide sequence has C / T polymorphism.

2. A genetic marker linked to the wheat grain nickel ion accumulation QTL qNi.hnaas-6BS according to claim 1, characterized in that: Haplotype analysis was performed using the natural population SNP6872 genotyping data and wheat grain nickel ion content data. It was found that at the population level, the grain nickel ion content of CC genotype individuals was significantly lower than that of TT genotype individuals, that is, when the site was CC genotype, the nickel ion content of wheat grains was significantly lower than that of TT genotype individuals, indicating that the CC genotype is the dominant haplotype controlling nickel ions in wheat grains and is a favorable allele that limits the accumulation of nickel ions in wheat grains.

3. A genetic marker linked to the wheat grain nickel ion accumulation QTL qNi.hnaas-6BS according to claim 2, characterized in that: It can be used for early prediction of nickel ion content in wheat grains, which is not only helpful for breeders to screen out germplasm resources resistant to heavy metal stress, but also conducive to breeding new wheat varieties that are more resistant to nickel ion stress and have stronger environmental adaptability.

Images