A molecular marker associated with leaf rust resistance, primer pair and application thereof

Abstract

The present application relates to the technical field of biomolecule detection, in particular to a molecular marker related to leaf rust resistance, a primer pair and application thereof. The present application uses 559 materials to perform whole genome association analysis on the resistance of leaf rust in three environments, and finds 1 SNP closely related to leaf rust on the short arm of 2B chromosome of hexaploid wheat. A molecular marker capable of large-scale screening of materials is developed using the SNP, and the close correlation with leaf rust resistance is verified using 414 materials, and finally the molecular marker provided by the present application is developed. The development of the molecular marker provides a simple and effective new screening marker for wheat leaf rust resistance breeding. Using the molecular marker linked to the resistance locus QLr.hazu-2BS.1, the disease-resistant wheat strains can be quickly and accurately screened, the breeding period and experimental cost are saved, and the wheat resistance breeding process is accelerated.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biomolecule detection, and particularly relates to a molecular marker related to leaf rust resistance, a primer pair and application thereof. BACKGROUND

[0002] Wheat leaf rust is a fungal disease caused by Puccinia triticina, which occurs widely in the world. Wheat leaf rust seriously endangers wheat yield, reducing yield by 5-20% during the outbreak period, and the peak reduction reaches 50%. In China, due to climate change and large-scale cultivation of wheat, the diversity of wheat varieties is low, and the epidemic area of wheat leaf rust has expanded from the Huanghuai River Basin to the main wheat production areas. Therefore, ensuring the stable and high yield of wheat is of great importance to the food production safety of China.

[0003] Chemical agents can effectively control leaf rust, but the cost is high and is not friendly to the environment, humans and animals. Therefore, using different resistance genes to improve wheat and cultivate new wheat varieties resistant to leaf rust is still the most effective method to solve this problem. So far, more than 100 wheat leaf rust resistance genes have been reported, of which 83 genes have been officially named. In addition, with the continuous variation of physiological races, only a few genes still maintain effective resistance. Therefore, continuously excavating new leaf rust resistance genes not only can cope with the continuous variation of physiological races, but also has important theoretical and practical significance for preventing wheat rust by using gene layout and disease resistance breeding.

[0004] At present, there are two main methods to excavate resistance sites, i.e. quantitative trait locus (QTL) mapping based on parental population and genome-wide association study (GWAS) mapping based on natural population. QTL mapping is a statistical method that correlates quantitative traits with specific regions in the genome to determine the location of genes controlling quantitative traits in the genome. However, QTL mapping has many limitations, requiring a large number of parental genetic populations, continuous generations of phenotypes and relatively less polymorphism. GWAS is a new strategy based on linkage instability, which uses high-density single nucleotide polymorphism (SNP) for comparative analysis or correlation analysis at the whole genome level. Compared with traditional QTL mapping analysis, GWAS has the advantages of high detection efficiency and accuracy, short cycle time, high throughput and low cost, and can study multiple traits at the same time. Therefore, more and more scientists are using GWAS to quickly find resistance genes.

[0005] In recent years, the development of DNA technology and the reduction of genotyping cost have made the analysis of complex traits easier and more efficient. In addition, the availability of the wheat reference genome and the progress of sequencing technology have helped to accurately determine the location of QTL and potential candidate genes. KASP markers are widely used due to their convenience, low cost, etc. (Christopherson et al. 1997; Stadhouders et al. 2010). However, there is no report on molecular markers associated with the wheat leaf rust resistance locus QLr.hazu-2BS.1. SUMMARY

[0006] The purpose of the present application is to provide a molecular marker, primer pair and its application related to leaf rust resistance to solve the problems existing in the prior art. The molecular marker provided by the present application is closely related to the leaf rust resistance trait. SNP genotyping by KASP technology can accurately, efficiently and cost-effectively identify plant leaf rust resistance traits.

[0007] To achieve the above-mentioned purpose, the present application provides the following solutions:

[0008] The present application provides a molecular marker (2B-209172) related to leaf rust resistance, the nucleotide sequence of which is shown in SEQ ID NO. 1, and there is a C / T mutation at the 18th base of the sequence.

[0009] The present application provides a KASP primer pair for detecting the above-mentioned molecular marker, which comprises a first upstream primer with a nucleotide sequence as shown in SEQ ID NO. 4, a second upstream primer with a nucleotide sequence as shown in SEQ ID NO. 5 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO. 6.

[0010] The present application provides a detection product of the above-mentioned molecular marker, which comprises the above-mentioned KASP primer pair.

[0011] Preferably, the detection product comprises a detection reagent, a detection kit or a detection chip.

[0012] The present application provides the above-mentioned molecular marker, the above-mentioned KASP primer pair or the above-mentioned detection product for use in any one of:

[0013] (1) identifying the level of plant leaf rust resistance;

[0014] (2) screening and / or predicting plant varieties or lines with high leaf rust resistance;

[0015] (3) screening and / or predicting improved plant varieties or lines with high leaf rust resistance;

[0016] (4) Application in plant molecular marker assisted breeding.

[0017] Preferably, the plant is a herbaceous plant.

[0018] Further preferably, the herbaceous plant is wheat.

[0019] The present application provides a method for identifying the resistance of a plant to leaf rust, comprising the following steps:

[0020] The genomic DNA of the plant sample to be tested is used as a template, and the template is subjected to PCR amplification using the KASP primer pair described above, and genotyping is performed according to the amplification results.

[0021] If the genotyping result is TT, the plant sample to be tested is determined to be a plant with high resistance to leaf rust; if the genotyping result is CC, the plant sample to be tested is determined to be a plant with low resistance to leaf rust.

[0022] Preferably, the PCR amplification system is: KASP PCR MIX 2.44 μL, Primer mix 0.056 μL, and template 2.5 μL; the volume ratio of the first upstream primer, the second upstream primer, and the downstream primer in the Primer mix is 1:1:1.

[0023] Preferably, the PCR amplification program is: 94℃ pre-denaturation for 15min; 94℃ denaturation for 20s; 55℃-61℃ gradient annealing / elongation for 60s, 10 cycles; 94℃ denaturation for 20s; 55℃ final elongation for 60s.

[0024] Preferably, the plant is a herbaceous plant.

[0025] Further preferably, the herbaceous plant is wheat.

[0026] The present application discloses the following technical effects:

[0027] The application uses 559 materials to perform whole genome association analysis on the resistance to leaf rust in three environments, and finds one SNP closely associated with leaf rust on the short arm of 2B chromosome of hexaploid wheat, which is located in the QLr.hazu-2BS.1 disease resistance site. The application develops a molecular marker 2B-209172 (KASP marker 2B-209172) that can be used to screen materials on a large scale, and the specific embodiments of the application use 414 materials to verify the close degree of association with leaf rust resistance, and finally develop the KASP marker 2B-209172. The development of the molecular marker provides a simple and effective new screening marker for wheat leaf rust resistance breeding. At the same time, using the KASP marker 2B-209172 linked to the resistance site QLr.hazu-2BS.1, the disease-resistant wheat lines can be quickly and accurately screened, the breeding period and experimental cost are saved, and the wheat leaf rust resistance breeding process is accelerated. BRIEF DESCRIPTION OF DRAWINGS

[0028] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings described below are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor.

[0029] Figure 1 Figure 4 is a disease severity distribution diagram of 414 wheat materials; wherein, A is the disease severity distribution of the material with genotype A(CC) in XX(2024) environment, B is the disease severity distribution of the material with genotype B(TT) in XX(2024) environment; the X axis represents the severity of the disease, and the Y axis represents the number of materials in each severity category;

[0030] Figure 2 Figure 5 is the result of verifying KASP molecular marker 2B-209172 of 414 wheat materials; wherein, A is the KASP marker detection of QLr.hazu-2BS.1 site, the X axis and the Y axis respectively represent the fluorescence signals corresponding to allele 1 and allele 2 detected by using FAM and HEX dyes, the blue dot represents the susceptible genotype, the orange dot represents the resistant genotype, and the green dot represents the heterozygous genotype; B is the single marker analysis of KASP molecular marker 2B-209172 in XX(2024) environment, the color represents the reaction type to the disease, red indicates susceptible, and green indicates resistant, ****P<0.0001. DETAILED DESCRIPTION

[0031] The following detailed description of various exemplary embodiments of the application will not be considered limiting of the application, but rather a description of certain aspects, features and embodiments of the application.

[0032] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. Additionally, for a range of values, the disclosure herein intends each intervening value between the upper limit and the lower limit to be specifically included. Any intervening value not explicitly stated in the specification and any other stated or intervening value in the stated range is specifically included in the application. The upper and lower limits of these intervening values can independently be included or excluded from the range.

[0033] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In case of conflict, the content of the specification will control.

[0034] Various modifications and changes can be made to the specific embodiments of the application described herein without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples herein. The description and examples are illustrative of the application and are not intended to limit the scope of the application.

[0035] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean including, but not limited to.

[0036] The following experimental methods are all conventional methods unless otherwise specified. The experimental materials used in the following experiments can be purchased from a conventional biochemical reagent store unless otherwise specified. The primers used in the application are synthesized by Wuhan Tianyi Huayu Gene Technology Co., Ltd.

[0037] Example 1

[0038] 1. Phenotype analysis of wheat leaf rust

[0039] The 559 wheat materials used in the whole genome association analysis of this example include 307 cultivars, 107 local varieties, 15 colored wheat, and 130 foreign varieties from CIMMYT; the 414 wheat materials used for KASP marker 2B-209172 verification are from the above-mentioned 559 materials, including 307 cultivars and 107 local varieties.

[0040] Materials were planted in ZK and WH in 2020 and 2021, and in XX in 2022 and 2023, respectively. Each material was sown in a single row with 3g, 1.5m in length and 25cm in spacing. The leaf rust susceptible variety Kenong 199 was used as the susceptible control and the inducing line, and all materials were subjected to standard field production management before harvest.

[0041] Field inoculation was performed when the inducing line grew to the jointing stage. The leaf rust races used in this experiment were 22105, 22107, 18054 and 18057 (which were disclosed in the literature “Identification and Toxicity Analysis of Wheat Leaf Rust Physiological Races in China in 2013” and promised to be released externally for 20 years), and four races were mixed in equal amounts at the time of inoculation. The leaf rust spores were activated by heating at 42°C for 5min. The activated mixed spores were suspended in light mineral oil (Soltrol 170) at a concentration of 1.0-1.5mg / ml, and the suspension was sprayed onto the inducing line using a spray bottle.

[0042] Forty-five to sixty days after inoculation, the maximum disease severity survey phenotype was determined, with severity scored from 0 to 100%. The disease resistance was classified into resistant type (≤20%), intermediate type (20%<MDS≤40%) and susceptible type (40%<MDS≤100%). The obtained phenotype data were statistically analyzed using Excel and SAS-9.2, and the results are shown in Figure 1 and Table 1.

[0043] Table 1 Correlation analysis of phenotypes in four environments

[0044] 20 ZK 21 WH 22 XX 21 WH 0.39* - - 22 XX 0.40* 0.42* - 23 XX 0.34* 0.31* 0.52*

[0045] Note: *P<0.0001.

[0046] As shown in Figure 1 and Table 1, the distribution of leaf rust disease severity in the four environments was continuous from 0 to 100%, and the phenotype correlation between the four environments was between 0.31 and 0.52, which was significantly correlated, indicating the accuracy and usability of the data.

[0047] 2. Genotype data analysis

[0048] The 559 wheat materials were re-sequenced using the MGISEQ-2000 platform, and the sequencing depth was 2x-6x. Using PLINK-1.9 software to filter out SNPs with a missing rate of >20% and an allele frequency of <5%, 547.1 Gb of genotype data was obtained, totaling 8,765,920 high-quality SNPs. These SNPs were distributed on the 21 chromosomes of wheat, with the B genome containing the most SNPs, 4,556,759, followed by the A genome, 3,719,374, and the D genome, the least, containing 489,787. The distribution of SNPs on the chromosomes was also different, with the most on chromosome 7B, 1,047,964, and the least on chromosome 4D, 33,309 (Table 2).

[0049] Table 2 Distribution of SNPs on chromosomes

[0050] Chromosome Chromosome length (Mb) Number of SNPs Marker density ( / Mb) Chr 1A 596 657,405 1103 Chr 1B 700 444,137 634 Chr 1D 498 88,980 179 Chr 2A 787 413,190 525 Chr 2B 812 738,583 910 Chr 2D 653 89,842 138 Chr 3A 754 318,466 422 Chr 3B 847 642,612 759 Chr 3D 616 63,976 104 Chr 4A 750 1,018,351 1,358 Chr 4B 670 526,541 786 Chr 4D 515 33,309 65 Chr 5A 709 317,073 447 Chr 5B 711 499,434 702 Chr 5D 567 59,188 104 Chr 6A 619 302,895 489 Chr 6B 727 657,488 904 Chr 6D 493 59,105 120 Chr 7A 741 691,994 934 Chr 7B 760 1,047,964 1,379 Chr 7D 639 95,387 149 A genome 4,956 3,719,374 750 B genome 5,227 4,556,759 872 D genome 3,981 489,787 123 Chr ALL 14,164 8,765,920 619

[0051] Note: Chr: chromosome; genome: genome.

[0052] 3. Association analysis

[0053] Using Fastlmm / v0.2.32 software, the phenotypes of the 559 wheat materials were associated with the filtered SNP data, and it was found that there were 184 SNPs significantly associated with leaf rust resistance at the QLr.hazu-2BS.1 locus, which could be located in the ZK, WH and XX three environments. The locus was located on the short arm of chromosome 2B of Chinese Spring, with a physical interval of 51.13-73.40 Mb, and the markers on the left and right sides were SNP-13159072 and SNP-13255957, respectively (Table 3).

[0054] Table 3 Physical location of leaf rust resistance locus QLr.hazu-2BS.1 on chromosomes

[0055]

[0056] 4. Development of KASP molecular markers

[0057] The significant SNP-13209172 at the QLr.hazu-2BS.1 locus was developed into KASP molecular marker 2B-209172, and its nucleotide sequence is shown in SEQ ID NO. 1, and there is a C / T mutation at the 18th base of the sequence.

[0058] SEQ ID NO. 1: GGGCCAGCTGGACTATGYGGCATGGGCGTGGCCCAGGAGGCAACTGGGGTCGCTGAGGAGGCAGAAGAGGAG, wherein Y is C / T.

[0059] 5. Development of primer pairs and amplification methods

[0060] The primers were designed according to the information of SNP sites in the molecular markers screened according to Example 1, and the specific steps were as follows:

[0061] (1) Obtain SNP site information, and require that the base sequences of two parents at the SNP position are different, and there are no other SNPs 20 bp upstream and 40 bp downstream of the SNP. The SNP information can be obtained by whole genome sequencing or resequencing.

[0062] (2) Extract parent DNA and dilute to 5-50 ng / μL for standby.

[0063] (3) Primer design

[0064] 1) Count 20 bp upstream from the base where the SNP is located as the left primer f, and the base of the SNP as the 20th base of the left primer, so there are left primers f1 and f2.

[0065] 2) Use primer design software or primer design website PolyMarker (https: / / www.polymarker.info / ) to fix the left primer f, and obtain the right primer R by BLAST. The product size needs to be less than 60 bp.

[0066] 3) Add adapter FAM and HEX (adapter FAM sequence: GAAGGTGACCAAGTTCATGCT, SEQ ID NO. 2; adapter HEX sequence: GAAGGTCGGAGTCAACGGATT, SEQ ID NO. 3) sequences to left primers f1 and f2 to obtain F1 and F2, i.e. F1 = A1f1 and F2 = A2f2.

[0067] 4) Synthesize sequences F1, F2, and R, and select ULTRPAGE purification method.

[0068] (4) Dissolve the primer dry powder, and the concentrations of F1 and F2 are 36 μM, and the concentration of R is 90 μM. Then mix the three primers in a volume ratio of 1:1:1 to obtain primer mix.

[0069] (5) Screening of KASP primer pairs

[0070] Each primer was run in at least two holes for each parent and F1. The PCR amplification system is shown in Table 4, and the PCR amplification program is shown in Table 5.

[0071] Table 4 PCR amplification system

[0072] Component Volume (μL) DNA 2.5 KASPP CR MIX 2.44 Primer mix 0.056

[0073] Table 5 PCR amplification procedure

[0074] Program Temperature Time Cycles Pre-denaturation 94℃ 15 min 1 Denaturation 94℃ 20s 1 Annealing / extension 61℃-55℃ 60 s (-0.6°C / cycle) 10 Denaturation 94℃ 20s 1 Final extension 55℃ 60s 30

[0075] (6) After the amplification, use the fluorescent quantitative PCR read tape

[0076] The read tape procedure is as follows:

[0077] 25 °C for 5 s + Plate Read (25 °C for 5 s + plate reading); after the read tape is completed, select the fluorescence types FAM, HEX and ROX, and select Allelic Discrimination for analysis.

[0078] (7) Select the primers with obvious clustering as candidate primer pairs, and use the candidate primer pairs in the population. If the clustering effect is obvious, the KASP primer pair can be used.

[0079] (8) Screening results

[0080] The information of the KASP primer pair with the most obvious clustering effect is shown in Table 6.

[0081] Table 6 Sequences of KASP primer pairs

[0082]

[0083] 6. Application of KASP primer pairs

[0084] Then, through t-test, the association between the KASP molecular marker and leaf rust in 414 wheat materials was verified, and the steps are as follows:

[0085] In the 2023 planting season, 414 wheat materials (numbered as shown in Table 7) were planted in Xinxiang (XX) in Henan; each material was single-row sowed 3g, with a row length of 1.5 meters and a row spacing of 25 cm. The leaf rust highly susceptible variety Kenong 199 was used as the disease susceptible control and the inducing row, and all materials were subjected to standard field production management before harvesting.

[0086] When the inducing row grows to the jointing stage, field inoculation is performed. The leaf rust races used in this experiment are 22105, 22107, 18054 and 18057. When inoculating, the four races are mixed in equal amounts, and the leaf rust spores are activated at 42 °C for 5 min; the activated mixed spores are suspended in light mineral oil (Soltrol 170) with a concentration of 1.0-1.5 mg / ml, and the suspension is sprayed onto the inducing row using a spray bottle.

[0087] The 414 materials were divided into resistant type (≤20%), intermediate type (20%<MDS≤40%) and susceptible type (40%<MDS≤100%) according to the maximum disease severity investigation form and the severity was scored as 0-100%, and the resistance classification results are shown in Table 7.

[0088] Meanwhile, the KASP primer pairs screened by step "5, development of primer pairs and amplification methods" were used for PCR amplification of the 414 materials to detect the genotypes of each material, and the PCR amplification program and system were the same as those in Table 4 and Table 5, and the amplification results are shown in Table 7. Figure 2 and Table 7.

[0089] Table 7 Phenotype and genotype of 414 wheat materials

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099] Note: a NA represents missing data; b A represents susceptible genotype (CC), B represents resistant genotype (TT), and H represents heterozygous genotype (CT).

[0100] The results are shown in Table 7. Figure 2 The results show that marker 2B-209172 has a very significant correlation with the phenotype data in XX(2023) environment (P<0.0001). In XX(2023) environment, the proportion of materials containing the site with resistant phenotype is 95.41%, while the proportion of materials not containing the site with susceptible phenotype in XX(2023) environment is 94% (Table 7 and Figure 2). Furthermore, it can be seen from Table 7 that the disease severity of 414 wheat materials is basically consistent with the genotype, and the difference between the phenotype and the genotype of individual materials may be caused by other resistance genes or antagonistic genes in the materials. In addition, the QLr.hazu-2BS.1 locus has the highest proportion of 70.09% in local wheat varieties and a lower proportion of 46.58% in cultivated varieties, indicating that a certain proportion of the locus is lost in the process of wheat variety breeding. The KASP molecular marker 2B-209172 developed for the QLr.hazu-2BS.1 resistance locus can detect the presence or absence of the locus at the molecular level, effectively improving the utilization efficiency of the resistance locus, shortening the breeding period, and accelerating the process of wheat resistance breeding.

[0101] The above-described embodiments are merely preferred modes of the present application and are not intended to limit the scope of the present application. Various modifications and improvements to the technical solutions of the present application made by those of ordinary skill in the art without departing from the design spirit of the present application shall fall within the scope of protection of the present application as defined by the claims.

Claims

1. Use of a KASP primer pair of a molecular marker or a detection product containing the KASP primer pair in any of the following: (1) use in identifying the level of resistance to leaf rust in wheat; (2) use in screening and / or predicting wheat varieties or lines with high resistance to leaf rust; (3) use in molecular marker assisted breeding of wheat; the trait of the breeding is resistance to leaf rust. The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, and there is a C / T mutation at the 18th base of the sequence; the KASP primer pair comprises a first upstream primer with a nucleotide sequence shown in SEQ ID NO. 4, a second upstream primer with a nucleotide sequence shown in SEQ ID NO. 5, and a downstream primer with a nucleotide sequence shown in SEQ ID NO.

6.

2. A method for identifying the level of resistance to leaf rust in wheat, characterized in that, The method comprises the following steps: using the genomic DNA of the wheat sample to be tested as a template, performing PCR amplification on the template by using the KASP primer pair described in claim 1, and performing genotyping according to the amplification results; if the genotyping result is TT, it is determined that the wheat sample to be tested is a wheat with high resistance to leaf rust; if the genotyping result is CC, it is determined that the wheat sample to be tested is a wheat with low resistance to leaf rust.

3. The method of claim 2, wherein, The system of the PCR amplification is: KASP PCR MIX 2.44 μL, primer mix 0.056 μL, and template 2.5 μL.

4. The method of claim 2, wherein, The program of the PCR amplification is: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s; 55℃-61℃ gradient annealing / elongation for 60 s, 10 cycles; 94℃ denaturation for 20 s; 55℃ final elongation for 60 s.

Images