Molecular marking method for sugarcane smut resistance

Through genome-wide association analysis and molecular marker development, the problems of long field identification cycles and limited molecular markers in sugarcane smut breeding have been solved, and a rapid screening system for sugarcane smut seedlings has been established, realizing the wide applicability of early-generation screening and markers.

CN121737327APending Publication Date: 2026-03-27INST OF NANFAN& SEED IND GUANGDONG ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-30
Publication Date
2026-03-27

AI Technical Summary

Technical Problem

Existing sugarcane smut resistance breeding techniques involve long field identification cycles and a limited number of molecular markers, making early-generation screening difficult.

Method used

By identifying significantly associated SNP sites through genome-wide association analysis, developing corresponding molecular markers, and establishing a rapid screening system for sugarcane smut seedlings, a collaborative effort involving units such as sample preparation, identification through inoculation in two sugarcane growing areas, genome-wide association analysis, SNP marker development, and marker validation is established.

Benefits of technology

This method enables early screening of sugarcane smut, overcomes the population and environmental limitations of marker application, improves the stability and applicability of detection, and reduces the limitations of markers.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121737327A_ABST
    Figure CN121737327A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of sugarcane smut resistance, and provides a molecular marking method for sugarcane smut resistance, which comprises a sample preparation unit, a double-sugarcane area inoculation identification unit, a whole genome association analysis unit, an SNP (Single Nucleotide Polymorphism) marker development unit, a marker verification unit and a result application unit, the output end of the sample preparation unit is connected with the input end of the double-sugarcane-area inoculation identification unit through a sample transmission channel, the double-sugarcane-area inoculation identification unit outputs phenotypic data to the whole-genome association analysis unit, and the whole-genome association analysis unit outputs remarkably associated SNP sites to the SNP marker development unit; and the SNP marker development unit outputs a specific primer to the marker verification unit. The molecular marker provided by the invention is based on the correlation between the candidate gene of the site and the known disease-resistant pathway of the plant, and the MYB transcription factor can improve or reduce the resistance level of the plant to pathogenic bacteria by regulating the synthesis of secondary metabolites, transduction of plant hormone signals, expression of defensive genes and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of sugarcane smut resistance technology, specifically to a molecular marker method for sugarcane smut resistance. Background Technology

[0002] Currently, there are very few molecular markers reported both domestically and internationally that are significantly associated with resistance to sugarcane smut (Sporisorium scritamineum), and their application has not yet been widely promoted. Preliminary reports include the following:

[0003] 1. KASP / SNP markers that can be directly used for early generation screening

[0004] The team led by Gao Yijing at the Guangxi Academy of Agricultural Sciences located multiple major-effect QTLs that can be repeatedly detected in hybrid populations and developed two KASP markers (without publicly available sequence numbers) that are highly significantly associated with resistance. These markers can be used to complete high-throughput genotyping within 3–5 days of seedling stage.

[0005] Sugar Research Australia (SRA) used a 48K SNP chip to perform association mapping on 480 clones and found that 5 SNPs (located in linkage groups 2L, 3L, 5L, and 7H) were significantly associated with smut disease severity (P<0.001). KASP primers have been designed and used in the SRA Northern Breeding Program for early elimination of susceptible clones.

[0006] 2. SCAR markers that have been validated but not yet widely adopted.

[0007] Khan et al. (2008) converted the RAPD fragment S-443 (approximately 443 bp) into the codominant SCAR marker SC-443, which showed 83% concordance with the resistance phenotype in 96 materials. The marker was located in an unknown linkage group and is currently only used for germplasm fingerprinting.

[0008] 3. Functional genes or their closely linked candidate markers

[0009] The ScWRKY2-ScLRR-RLK region: The Que Youxiong team used DAP-seq+RNA-seq to determine that the transcription factor ScWRKY2 negatively regulates immunity, and its target gene ScLRR-RLK (leucine-rich repeat receptor kinase) contains two SNPs (-603G / A and -420T / C) in its promoter region. These two SNPs were significantly associated with resistance in 187 natural populations (r = -0.72, P < 0.001) and can be considered as candidate functional markers.

[0010] ScNPR3 promoter InDel-18bp: Single-cell transcriptomics revealed that the disease-resistant variety YT93-159 has a deletion of 18bp at this site, resulting in continuous activation of the salicylic acid signaling pathway; the co-segregation rate of this InDel with resistance reached 89%, and the InDel-PCR marker has been developed and its stability is being verified at multiple sites.

[0011] Existing sugarcane smut resistance breeding techniques suffer from difficulties such as long field identification cycles and a lack of molecular markers. This invention addresses these challenges by identifying a SNP locus significantly associated with sugarcane smut resistance through genome-wide association analysis. Based on this locus, corresponding molecular markers were developed, and a rapid screening system for sugarcane smut seedlings was established to achieve early-generation screening of sugarcane smut. This invention proposes a molecular marker method for sugarcane smut resistance. Summary of the Invention

[0012] To address the shortcomings of existing technologies, this invention provides a molecular marker method for sugarcane smut resistance, which solves the difficulties of long field identification cycles and limited molecular markers in existing sugarcane smut resistance breeding techniques. This invention discovers a SNP locus significantly associated with sugarcane smut resistance through genome-wide association analysis, and develops corresponding molecular markers based on this locus to establish a rapid screening system for sugarcane smut seedlings, thus solving the problem of early-generation screening of sugarcane smut.

[0013] To achieve the above objectives, the present invention provides the following technical solution: a molecular marker method for sugarcane smut resistance, comprising a sample preparation unit, a double-sugary-region inoculation and identification unit, a genome-wide association analysis unit, a SNP marker development unit, a marker validation unit, and a result application unit. The output of the sample preparation unit is connected to the input of the double-sugary-region inoculation and identification unit via a sample transmission channel. The double-sugary-region inoculation and identification unit outputs phenotypic data to the genome-wide association analysis unit. The genome-wide association analysis unit outputs significantly associated SNP sites to the SNP marker development unit. The SNP marker development unit outputs specific primers to the marker validation unit. The marker validation unit outputs validation results to the result application unit. Each unit communicates bidirectionally via a data bus, collaboratively completing the development and application of molecular markers for sugarcane smut resistance.

[0014] Preferably, the sample preparation unit includes a parental screening subunit and a single-bud treatment subunit. The parental screening subunit selects core parents from different sugarcane growing areas and their derived lines to form a natural population. The screening criteria are that the agronomic traits meet the standards, including yield, sugar content, and basic resistance. The single-bud treatment subunit uses insect needles to make 5 puncture holes per bud around the sugarcane bud. The puncture depth is controlled to 1 / 3 of the thickness of the sugarcane bud. After treatment, the samples are placed in a ventilated environment at 25±2℃ and left to stand for 1 hour to ensure sample activity.

[0015] Preferably, the dual-succulent-area inoculation identification unit includes an inoculum collection subunit, an immersion inoculation subunit, and a disease resistance grading subunit. The inoculum collection subunit collects smut rhizomes from sugarcane areas with different climate types, removes surface impurities, grinds and filters to prepare a spore suspension. The immersion inoculation subunit immerses the treated single-bud samples in the spore suspension, controls the immersion time to 5-10 minutes, and then places them in a 28±1℃ humidity chamber to germinate for 24 hours. The disease resistance grading subunit classifies the disease incidence into 1-9 levels, regularly investigates the disease incidence, and records phenotypic data.

[0016] Preferably, the investigation cycle of the disease resistance grading subunit is set as follows: once every 15 days in the early stage of infection, once every 30 days after three consecutive investigations, until the sugarcane matures; a completely randomized group design is adopted during the investigation, with two replicate groups set in each sugarcane area, and the sample spacing, plant spacing and row spacing of each group are controlled according to the standardized planting specifications.

[0017] Preferably, the genome-wide association analysis unit includes a sequencing data processing subunit and an MLM model analysis subunit; the sequencing data processing subunit performs whole-genome resequencing on natural population samples, filters low-quality reads, and constructs an SNP dataset; the MLM model analysis subunit uses TASSEL 5.0 software, with population structure Q value calculated by ADMIXTURE software as a covariate, kinship K value as a random variable, sets P < 0.001 as a significant association threshold, and merges associated sites through LD analysis, taking the SNP with the smallest P value as the lead SNP, whose confidence interval is defined as a 250kb flanking region around the LD block.

[0018] Preferably, the SNP marker development unit includes a candidate gene screening subunit and a primer design subunit; the candidate gene screening subunit annotates genes within confidence intervals using Interproscan software to screen MYB transcription factor genes related to the disease resistance pathway as target genes; the primer design subunit designs specific primers based on the target gene sequence, with a primer length of 20-25 bp, a Tm value of 58±2℃, and an amplified fragment length of 150-300 bp. The primer sequences satisfy the following: the upstream primer contains a 200 bp conserved sequence upstream of the SNP site, and the downstream primer contains a 200 bp conserved sequence downstream of the SNP site.

[0019] Preferably, the primer pairs output by the primer design subunit include:

[0020] Upstream primer S1F: 5'-ATGTATGGGCCAAATTGGAGG-3';

[0021] Downstream primer S1R: 5'-CTACTGAGAAACATCACGCCTAGACT-3';

[0022] After the primers were purified by PAGE, they were diluted to 10 μM with TE buffer for later use to ensure primer specificity and amplification efficiency.

[0023] Preferably, the labeling verification unit includes a PCR amplification subunit and an electrophoresis detection subunit. The PCR amplification subunit uses a 20 μL reaction system: 2 μL of 10×PCR Buffer, 1.6 μL of dNTPs (2.5 mM), 0.8 μL each of forward and reverse primers (10 μM), 0.2 μL of Taq DNA polymerase (5 U / μL), 1 μL of template DNA (50 ng / μL), and 13.6 μL of ddH2O. The amplification program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; and 72℃ final extension for 10 min. The electrophoresis detection subunit uses 1.5% agarose gel electrophoresis at 120V constant voltage for 30 min. After EB staining, the bands are observed, and the presence of the target band indicates the presence of the resistance gene.

[0024] Preferably, the result application unit includes a seedling screening subunit and a breeding guidance subunit; the seedling screening subunit extracts leaf DNA during the sugarcane seedling stage and uses the detection method of the marker verification unit to determine resistance; the breeding guidance subunit, based on the detection results, includes materials carrying resistance markers into the hybrid parent library, and at the same time establishes a database of the association between resistance markers and agronomic traits, providing a basis for hybrid combination configuration and realizing the precision of molecular marker-assisted breeding.

[0025] Preferably, it also includes a data correction unit, which communicates bidirectionally with the genome-wide association analysis unit. It uses the R language CMplot software package to draw Manhattan plots and QQ plots to eliminate false positive association sites caused by population stratification. At the same time, it performs variance analysis on phenotypic data from different sugarcane areas to eliminate the influence of environmental errors on the association results.

[0026] This invention provides a molecular marker method for resistance to sugarcane smut. It has the following beneficial effects:

[0027] 1. This invention discovers a SNP locus that is significantly associated with resistance to sugarcane smut through genome-wide association analysis, and develops a corresponding molecular marker based on this locus to establish a rapid screening system for sugarcane smut in the seedling stage, thereby achieving early-generation screening of sugarcane smut.

[0028] 2. This invention breaks through the limitations of applicability and achieves stable detection across populations and environments: This method develops markers based on natural populations composed of core parents from multiple sources, covering different genetic backgrounds. At the same time, it combines verification with inoculation from multiple sugarcane growing areas. The markers show high consistency in detection under different varieties and environments. There is no need to redevelop markers for specific populations. The scope of application far exceeds that of existing markers that are only for a single population, greatly reducing the limitations of marker application. Attached Figure Description

[0029] Figure 1 This is a schematic diagram illustrating typical field symptoms of sugarcane smut in this invention;

[0030] Figure 2 This is a schematic diagram showing the frequency distribution of sugarcane natural populations after inoculation with smut spores in this invention;

[0031] Figure 3 This is a schematic diagram of the Manhattan and QQ of natural population sugarcane smut resistance in this invention;

[0032] Figure 4 This is a schematic diagram showing the presence of the Sh_Ss02E0111101 gene in sugarcane smut-resistant and susceptible varieties in this invention. Detailed Implementation

[0033] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0034] Example:

[0035] Please see the appendix Figure 1 - Appendix Figure 4 This invention provides a molecular marker method for sugarcane smut resistance, comprising:

[0036] The sample preparation unit includes a parental screening subunit and a single-bud treatment subunit. The parental screening subunit selects core parents and their derived lines from different sugarcane growing areas to form a natural population. The screening criteria are that the agronomic traits meet the standards, including yield, sugar content, and basic resistance. The single-bud treatment subunit uses insect needles to make 5 puncture holes per bud around the sugarcane bud. The puncture depth is controlled to 1 / 3 of the thickness of the sugarcane bud. After treatment, the samples are placed in a ventilated environment at 25±2℃ and left to stand for 1 hour to ensure sample activity.

[0037] The inoculation and identification unit in the dual sugarcane-growing areas includes a pathogen collection subunit, an immersion inoculation subunit, and a disease resistance grading subunit. The pathogen collection subunit collects smut rhizomes from sugarcane-growing areas with different climate types, removes surface impurities, grinds and filters to prepare spore suspensions. The immersion inoculation subunit immerses treated single bud samples in the spore suspension, controls the immersion time to 5-10 minutes, and then places them in a 28±1℃ humidity chamber to germinate for 24 hours. The disease resistance grading subunit classifies diseases into 1-9 levels according to the incidence rate, regularly investigates the disease situation, and records phenotypic data.

[0038] The survey cycle for the disease resistance grading subunit was set as follows: once every 15 days in the early stage of infection, and once every 30 days after three consecutive surveys, until the sugarcane matures. A completely randomized group design was used during the survey, with two replicate groups set up in each sugarcane area. The sample spacing, plant spacing, and row spacing of each group were controlled according to the standardized planting specifications.

[0039] The genome-wide association analysis (GWIA) unit comprises a sequencing data processing subunit and an MLM model analysis subunit. The sequencing data processing subunit performs whole-genome resequencing on natural population samples, filters low-quality reads, and constructs an SNP dataset. The MLM model analysis subunit uses TASSEL 5.0 software, with population structure Q value calculated by ADMIXTURE software as a covariate and kinship K value as a random variable. P < 0.001 is set as the significant association threshold. At the same time, associated sites are merged through LD analysis, and the SNP with the smallest P value is taken as the lead SNP. Its confidence interval is defined as the 250kb flanking region around the LD block.

[0040] The SNP marker development unit includes a candidate gene screening subunit and a primer design subunit. The candidate gene screening subunit uses Interproscan software to annotate genes within confidence intervals, screening for MYB transcription factor genes related to disease resistance pathways as target genes. The primer design subunit designs specific primers based on the target gene sequence. Primers are 20-25 bp in length, have a Tm value of 58±2℃, and amplified fragment length of 150-300 bp. The primer sequences satisfy the following: the upstream primer contains a 200 bp conserved sequence upstream of the SNP site, and the downstream primer contains a 200 bp conserved sequence downstream of the SNP site. The primer pairs output by the primer design subunit include:

[0041] Upstream primer S1F: 5'-ATGTATGGGCCAAATTGGAGG-3';

[0042] Downstream primer S1R: 5'-CTACTGAGAAACATCACGCCTAGACT-3';

[0043] After the primers were purified by PAGE, they were diluted to 10 μM with TE buffer for later use to ensure primer specificity and amplification efficiency.

[0044] The labeling and verification unit includes a PCR amplification subunit and an electrophoresis detection subunit. The PCR amplification subunit uses a 20 μL reaction system: 2 μL 10×PCR Buffer, 1.6 μL dNTPs (2.5 mM), 0.8 μL each of forward and reverse primers (10 μM), 0.2 μL Taq DNA polymerase (5 U / μL), 1 μL template DNA (50 ng / μL), and 13.6 μL ddH2O. The amplification program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; and 72℃ final extension for 10 min. The electrophoresis detection subunit uses 1.5% agarose gel electrophoresis at 120V constant voltage for 30 min. After EB staining, the bands are observed. The presence of the target band indicates the presence of the resistance gene.

[0045] The results application unit includes a seedling screening subunit and a breeding guidance subunit. The seedling screening subunit extracts leaf DNA during the sugarcane seedling stage and uses the detection method of the marker verification unit to determine resistance. Based on the detection results, the breeding guidance subunit includes materials carrying resistance markers into the hybrid parent library and establishes a database linking resistance markers with agronomic traits to provide a basis for hybrid combination configuration and achieve precision in molecular marker-assisted breeding.

[0046] The output of the sample preparation unit is connected to the input of the dual-sugary-region inoculation and identification unit via a sample transmission channel. The dual-sugary-region inoculation and identification unit outputs phenotypic data to the genome-wide association analysis unit. The genome-wide association analysis unit outputs significantly associated SNP sites to the SNP marker development unit. The SNP marker development unit outputs specific primers to the marker validation unit. The marker validation unit outputs validation results to the result application unit. Each unit achieves bidirectional communication through a data bus, collaboratively completing the development and application of molecular markers for sugarcane smut resistance.

[0047] The data correction unit communicates bidirectionally with the genome-wide association analysis unit. It uses the R language CMplot package to draw Manhattan plots and QQ plots to eliminate false positive association sites caused by population stratification. At the same time, it performs analysis of variance on phenotypic data from different sugarcane areas to eliminate the influence of environmental errors on the association results.

[0048] The following description, in conjunction with specific embodiments, will be provided.

[0049] Sugarcane smut is a fungal disease caused by *Sporisorium scritamineum*, which severely affects the quality and yield of sugarcane (Yane et al., 2015). This disease occurs in major sugarcane-growing regions worldwide, causing significant damage, typically reducing yield by 10%–30%, and in some cases by 50%–70%, greatly lowering sugar content and impacting sugarcane quality (Anon, 1979; Jing et al., 2019). Disease resistance breeding is the most economical and effective control method; however, reports on resistance breeding for sugarcane smut are scarce, attributed to the lack of effective resistance genes / molecular markers. This study used a natural population (216 accessions) of core sugarcane parents and their derived lines from my country as materials, performing whole-genome resequencing. Sugarcane smut was inoculated using fungal sources from Wengyuan and Zhanjiang in Guangdong Province. Genome-wide association studies (GWAS) identified 68 significantly associated SNP loci (164 candidate genes), one of which is associated with the MYB transcription factor family. Therefore, molecular markers were developed for this site associated with resistance to smut.

[0050] This application selected a natural population (216 materials) composed of core Chinese sugarcane parents and their derived lines. They came from multiple sugarcane-growing countries around the world, including China, the United States, Australia, and Brazil, and were selected as breeding parents in China because they exhibited excellent performance in multiple agronomic traits such as yield, disease resistance, and sugar content.

[0051] Each sample of natural population (20–60 sugarcane buds) was pricked five times around the bud using an insect needle. Smut rhizomes were collected from Zhanjiang and Shaoguan in Guangdong, China, and inoculated using a 10⁶ spore suspension at both locations (110.24°E, 21.39°N) for 5–10 minutes, followed by 24 hours of moistening at approximately 28°C. The samples were then planted at both locations with a spacing of 100 cm between samples, a plant spacing of 25 cm, and a row spacing of 110 cm. The experimental design included a completely randomized grouping, with two replicates per location. All other sugarcane management was performed according to standard practices. The occurrence of sugarcane smut was regularly investigated in newly planted sugarcane. The appearance of black stolons indicated disease. Infected plants were recorded and removed to prevent them from infecting other healthy plants. Investigations were conducted every 15 days in the early stages of infection, and then every 30 days until maturity. The total number of infected plants was counted, and the incidence rate for each treatment was calculated. A 1-9 graded system was used to evaluate the resistance of the natural population. The specific graded standards were as follows: Grade 1: 0%–3% incidence rate; Grade 2: 4%–6%; Grade 3: 7%–9%; Grade 4: 10%–12%; Grade 5: 13%–25%; Grade 6: 26%–35%; Grade 7: 36%–50%; Grade 8: 51%–75%; and Grade 9: 76%–100%.

[0052] Using natural population resequencing data, WAS association analysis was performed using a mixed linear model (MLM) in TASSEL 5.0 software. First, the Q-value of the natural population structure was calculated using ADMIXTURE software and used as a covariate, while the K-value of kinship was used as a random variable. Association analysis was then performed using the population's SNP data to determine associated loci. Significant loci were determined as follows: if two or more significant SNPs were located within the same LD interval, these SNPs were considered the same QTL, and the SNP with the smallest P-value was designated as the lead SNP, with its contribution rate representing the contribution rate of the QTL. Finally, the Manhattan plot and Quantile-Quantile plot of the association analysis results were plotted using the CMplot package in R.

[0053] Important SNPs ≥ 0.3 were merged based on the decline level r² of LD. Then, confidence intervals were defined as 250 kb flanking regions around each LD block. Genes located within the confidence intervals were classified as candidate genes. Interproscan software (v5.39-77.0) was used with default parameters, applying protein sequences as input files to annotate genes in sugarcane. Based on the candidate gene information, sites related to disease resistance pathways were screened as target sequences, and primers were designed as molecular markers.

[0054] The specific primer information is as follows:

[0055] SNP GeneID Primer Sequence (5' to 3') S2E_32475422 Sh_Ss02E0111101 S1 F ATGTATGGGCCAAATTGGAGG S2E_32475422 Sh_Ss02E0111101 S1 R CTACTGAGAAACATCACGCCTAGACT

[0056] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. A molecular marker method for resistance to sugarcane smut, comprising a sample preparation unit, a dual-growing-area inoculation identification unit, a genome-wide association analysis unit, a SNP marker development unit, a marker validation unit, and a result application unit, characterized in that, The output of the sample preparation unit is connected to the input of the dual-sugary-region inoculation and identification unit via a sample transmission channel. The dual-sugary-region inoculation and identification unit outputs phenotypic data to the genome-wide association analysis unit. The genome-wide association analysis unit outputs significantly associated SNP sites to the SNP marker development unit. The SNP marker development unit outputs specific primers to the marker validation unit. The marker validation unit outputs validation results to the result application unit. Each unit communicates bidirectionally via a data bus to collaboratively complete the development and application of molecular markers for sugarcane smut resistance.

2. The molecular marker method for sugarcane smut resistance according to claim 1, characterized in that, The sample preparation unit includes a parental screening subunit and a single-bud treatment subunit. The parental screening subunit selects core parents and their derived lines from different sugarcane growing areas to form a natural population. The screening criteria are that the agronomic traits meet the standards, including yield, sugar content, and basic resistance. The single-bud treatment subunit uses insect needles to make 5 puncture holes per bud around the sugarcane bud. The puncture depth is controlled to 1 / 3 of the thickness of the sugarcane bud. After treatment, the samples are placed in a ventilated environment at 25±2℃ and left to stand for 1 hour to ensure sample activity.

3. The molecular marker method for sugarcane smut resistance according to claim 1, characterized in that, The dual-sugarcane-growing inoculation and identification unit includes a pathogen collection subunit, an immersion inoculation subunit, and a disease resistance grading subunit. The pathogen collection subunit collects smut rhizomes from sugarcane-growing areas with different climate types, removes surface impurities, grinds and filters to prepare a spore suspension. The immersion inoculation subunit immerses the treated single-bud samples in the spore suspension, controls the immersion time to 5-10 minutes, and then places them in a 28±1℃ humidity chamber to germinate for 24 hours. The disease resistance grading subunit classifies the disease incidence into 1-9 levels, regularly investigates the disease incidence, and records phenotypic data.

4. The molecular marker method for sugarcane smut resistance according to claim 3, characterized in that, The investigation cycle for the disease resistance grading subunit is set as follows: once every 15 days in the early stage of infection, once every 30 days after three consecutive investigations, until the sugarcane matures; a completely randomized group design is used during the investigation, with two replicate groups set in each sugarcane area, and the sample spacing, plant spacing and row spacing of each group are controlled according to the standardized planting specifications.

5. The molecular marker method for sugarcane smut resistance according to claim 1, characterized in that, The genome-wide association analysis unit includes a sequencing data processing subunit and an MLM model analysis subunit; the sequencing data processing subunit performs whole-genome resequencing on natural population samples, filters low-quality reads, and constructs an SNP dataset; The MLM model analysis sub-units were analyzed using TASSEL 5.0 software. The population structure Q value calculated by ADMIXTURE software was a covariate, and the kinship K value was a random variable. P < 0.001 was set as the significant association threshold. At the same time, associated sites were merged through LD analysis, and the SNP with the smallest P value was taken as the lead SNP. Its confidence interval was defined as the 250kb flanking region around the LD block.

6. The molecular marker method for sugarcane smut resistance according to claim 1, characterized in that, The SNP marker development unit includes a candidate gene screening subunit and a primer design subunit. The candidate gene screening subunit uses Interproscan software to annotate genes within confidence intervals and screens MYB transcription factor genes related to disease resistance pathways as target genes. The primer design subunit designs specific primers based on the target gene sequence. The primer length is 20-25 bp, the Tm value is 58±2℃, the amplified fragment length is 150-300 bp, and the primer sequence satisfies the following: the upstream primer contains a 200 bp conserved sequence upstream of the SNP site, and the downstream primer contains a 200 bp conserved sequence downstream of the SNP site.

7. A molecular marker method for sugarcane smut resistance according to claim 6, characterized in that, The primer pairs output by the primer design subunit include: Upstream primer S1F: 5'-ATGTATGGGCCAAATTGGAGG-3'; Downstream primer S1R: 5'-CTACTGAGAAACATCACGCCTAGACT-3'; After the primers were purified by PAGE, they were diluted to 10 μM with TE buffer for later use to ensure primer specificity and amplification efficiency.

8. A molecular marker method for sugarcane smut resistance according to claim 1, characterized in that, The labeling verification unit includes a PCR amplification subunit and an electrophoresis detection subunit; The PCR amplification unit used a 20 μL reaction system: 2 μL 10×PCR Buffer, 1.6 μL dNTPs (2.5 mM), 0.8 μL each of forward and reverse primers (10 μM), 0.2 μL Taq DNA polymerase (5 U / μL), 1 μL template DNA (50 ng / μL), and 13.6 μL ddH2O. The amplification program was: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; and 72℃ final extension for 10 min. The electrophoresis detection unit used 1.5% agarose gel electrophoresis at 120V constant voltage for 30 min. After EB staining, the bands were observed, and the presence of the target band indicated the presence of the resistance gene.

9. A molecular marker method for sugarcane smut resistance according to claim 1, characterized in that, The results application unit includes a seedling screening subunit and a breeding guidance subunit; the seedling screening subunit extracts leaf DNA during the sugarcane seedling stage and uses the detection method of the marker verification unit to determine resistance; Based on the test results, the breeding guidance subunit will include materials carrying resistance markers into the hybrid parent library, and at the same time establish a database linking resistance markers and agronomic traits to provide a basis for hybrid combination configuration and achieve precision in molecular marker-assisted breeding.

10. A molecular marker method for sugarcane smut resistance according to claim 1, characterized in that, It also includes a data correction unit, which communicates bidirectionally with the genome-wide association analysis unit. It uses the R language CMplot package to draw Manhattan plots and QQ plots to eliminate false positive association sites caused by population stratification. At the same time, it performs variance analysis on phenotypic data from different sugarcane areas to eliminate the influence of environmental errors on the association results.