RPA primer pair for detecting duck plague virus virulent strain, kit and detection method thereof
By designing specific RPA primer pairs and probe sets, high sensitivity and specificity detection of strong strains of duck plague virus are achieved, solving the problem of low detection sensitivity and specificity in the prior art, and is suitable for rapid on-site detection.
Patent Information
- Application Number
- CN202510364774.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-26
- Publication Date
- 2025-06-10
AI Technical Summary
The existing duck plague virus detection methods have problems with low sensitivity and specificity when applied on site, and it is difficult to effectively distinguish between strong duck plague virus strains and vaccine strains.
A RPA primer pair and probe set for detecting strong strains of duck plague virus were designed, including specific nucleotide sequences, which can achieve high sensitivity and specific detection in real-time quantitative RPA detection, and distinguish naturally infected strong strains of duck plague virus from vaccine strains.
The specific detection of the strong strain of duck plague virus is achieved, with high sensitivity and specificity, and the detection limit is 0.1fg/μL. It is suitable for rapid on-site detection and can quickly and accurately determine whether the sample carries the strong strain of duck plague.
Smart Images

Figure CN120119038A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to an RPA primer pair, a kit and a detection method for detecting a virulent strain of duck plague virus. Background Art
[0002] Duck plague virus (DEV) belongs to the family Herpesviridae, subfamily Alphaherpesvirinae, genus Mardivirus. DEV is spherical, with a double-stranded linear DNA genome. It mainly infects ducks, geese and other birds of the Anseriformes order, with rapid onset, strong infectivity and high mortality, seriously damaging the economic losses of the duck breeding industry. At present, the prevention and control of duck plague virus mainly relies on inoculating attenuated duck plague vaccines, but immune failure occurs continuously. Rapidly differentiating vaccinated ducks with attenuated duck plague vaccines from ducks infected with virulent strains of duck plague virus in production plays an important role in controlling the prevalence and even purifying duck plague.
[0003] At present, there are various reported detection methods for DPV, such as immunofluorescence, polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA), etc. However, the current detection methods have problems of low sensitivity and specificity when applied in the field. Summary of the Invention
[0004] In view of this, the present invention provides a primer pair for detecting a virulent strain of duck plague virus, which can not only specifically detect duck plague virus, but also distinguish duck plague virus vaccine strains, realizing the specific detection of virulent strains of naturally infected duck plague virus, and at the same time having the characteristics of high detection sensitivity.
[0005] The present invention also provides a primer-probe group for detecting a virulent strain of duck plague, which has the characteristics of high sensitivity, strong specificity, fast detection speed and convenient operation when detecting a virulent strain of duck plague.
[0006] In order to achieve the above object, the present invention provides the following technical solutions:
[0007] The present invention provides an RPA primer pair for detecting a virulent strain of duck plague, including a forward primer DEV F with a nucleotide sequence as shown in SEQ ID NO:1 and a reverse primer DEV R with a nucleotide sequence as shown in SEQ ID NO:2.
[0008] The present invention provides an RPA primer-probe group for detecting a virulent strain of duck plague, including the RPA primer pair and a probe DEVP;
[0009] The nucleotide sequence of the probe DEVP is as shown in SEQ ID NO:3.
[0010] Preferably, the 31st base of the probe DEVP is modified with a fluorescent reporter group in the direction from the 5′ end to the 3′ end;
[0011] The 16th base of the probe DEVP is modified with a fluorescent quenching group in the direction from the 3′ end to the 5′ end;
[0012] The base A between the fluorescent reporter group and the fluorescent quenching group is replaced with a tetrahydrofuran residue;
[0013] The 3′ end of the probe DEV P is modified with a protection label to prevent polymerization reaction.
[0014] Preferably, it includes any one of the following: FAM, TAMRA, CY3, and CY5. The fluorescent quenching group includes BHQ1, and the protection label to prevent polymerization reaction includes C3-spacer.
[0015] The present invention provides the application of the RPA primer pair or the RPA primer-probe group in the preparation of a detection kit for duck plague virulent strains.
[0016] The present invention provides a detection kit for duck plague virulent strains, including the RPA primer pair or the RPA primer-probe group.
[0017] Preferably, it further includes an RPA amplification reagent;
[0018] The RPA amplification reagent includes at least one of the following: dNTPs, binding single-stranded nucleic acid recombinase, single-stranded DNA binding protease, strand displacement DNA polymerase, RPA buffer, and magnesium acetate solution.
[0019] The present invention provides a detection method for duck plague virulent strains for non-disease diagnosis purposes, including the following steps:
[0020] Using the genomic DNA of the sample to be tested as a template, performing real-time fluorescence quantitative RPA detection with the RPA primer-probe group or the detection kit;
[0021] Judging whether the sample carries duck plague virulent strains according to the results of real-time fluorescence quantitative RPA detection:
[0022] If an "S"-shaped amplification curve appears, it is determined that the sample carries duck plague virulent strains; if an "S"-shaped amplification curve does not appear, it is determined that the sample does not carry duck plague virulent strains.
[0023] Preferably, the reaction system for the real-time fluorescence quantitative RPA detection is 50 μl. In the reaction system, the final concentration of the forward primer DEVF or the reverse primer DEV R is 200 - 500 nM / μL, and the final concentration of the probe DEV P is 40 - 160 nM / μL.
[0024] Preferably, the reaction program of the real-time fluorescence quantitative RPA detection is: reacting at 25-45°C for 15-25 min , Collect the fluorescence signal every 30 s.
[0025] The present invention has the following advantages compared with the prior art:
[0026] The present invention provides an RPA primer pair for detecting virulent duck plague virus strains, including a forward primer DEV F with a nucleotide sequence as shown in SEQ ID NO:1 and a reverse primer DEV R with a nucleotide sequence as shown in SEQ ID NO:2. The primer pair of the present invention is designed based on the differential fragment of the virulent duck plague virus strain and the vaccine strain gene, which can not only specifically detect duck plague virus, but also distinguish duck plague virus vaccine strains, realizing the specific detection of virulent duck plague virus strains in natural infection. At the same time, the detection limit of the primer pair is 0.1 fg / μL, featuring high detection sensitivity.
[0027] The present invention provides an RPA primer-probe group for detecting virulent duck plague virus strains, including the RPA primer pair and a probe DEVP; the nucleotide sequence of the probe DEVP is as shown in SEQ ID NO:3. The RPA primer-probe group of the present invention has strong specificity and only specifically amplifies virulent duck plague virus strains, and cannot amplify DEV vaccine strains, Tembusu virus (TMUV), Muscovy duck parvovirus (MDPV), influenza virus (AIVH5), reovirus (DRV), duck hepatitis virus (DHAV), Salmonella spp. The RPA primer-probe group has high sensitivity. The results of real-time fluorescence quantitative RPA detection show that the detection limit of the RPA primer-probe group is 0.1 fg / μL. It can be seen that the RPA primer-probe group of the present invention features strong detection specificity, high sensitivity and fast detection speed.
[0028] The present invention provides a method for detecting virulent duck plague virus for non-disease diagnosis purposes, comprising the following steps: using the genomic DNA of a sample to be tested as a template, and performing real-time fluorescence quantitative RPA detection with the primer-probe set or the detection kit; determining whether the sample carries virulent duck plague virus according to the real-time fluorescence quantitative detection result: if an "S"-shaped amplification curve appears, it is determined that the sample carries virulent duck plague virus; if an "S"-shaped amplification curve does not appear, it is determined that the sample does not carry virulent duck plague virus. The detection method of the present invention first uses real-time fluorescence quantitative RPA technology to establish a method for rapidly detecting virulent duck plague virus, and through specificity, sensitivity and stability evaluation, it can provide a sensitive and reliable new method for on-site detection of virulent duck plague virus. The detection method of the present invention has strong specificity and can effectively amplify virulent duck plague virus, while other avian disease viruses (DEV vaccine strain, TMUV, MDPV, AIV H5, DRV, DHAV and Salmonella) cannot be amplified. At the same time, it has high sensitivity, with a detection limit of 0.1 fg / μL, and can amplify trace nucleic acid templates to a detectable level and accurately detect them. In addition, the detection method of the present invention has a simple operation method, accurate and rapid detection results, does not require expensive instruments such as a PCR amplifier, does not go through a temperature change process, and can complete the reaction in about 20 minutes. It is especially suitable for grass-roots laboratories and on-site rapid nucleic acid detection, and can realize the daily monitoring and epidemiological investigation of duck plague virus in duck flocks. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 It is a diagram of the primer pair screening result;
[0030] Figure 2 It is a diagram of the optimal primer concentration screening result;
[0031] Figure 3 It is a diagram of the optimal probe concentration screening result;
[0032] Figure 4 It is a diagram of the optimal reaction temperature screening result;
[0033] Figure 5 It is a diagram of the optimal reaction time screening result;
[0034] Figure 6 It is a diagram of the reaction specificity detection result;
[0035] Figure 7 It is a diagram of the reaction sensitivity detection result. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0036] The present invention provides an RPA primer pair for detecting virulent strains of duck plague, including a forward primer DEV F (5′-CGAACGGCCGATAATATATTACGTAGGCTAG-3′) with a nucleotide sequence as shown in SEQ ID NO:1 and a reverse primer DEV R (5′-CATGGACGAGGTACTGTGCTCCATCGGATG-3′) with a nucleotide sequence as shown in SEQ ID NO:2.
[0037] In the present invention, the RPA primer pair is designed based on the differential fragments of the genes of virulent strains and vaccine strains of duck plague virus. It can not only specifically detect duck plague virus, but also distinguish vaccine strains of duck plague virus, realizing the specific detection of virulent strains of duck plague virus in natural infection, and at the same time having the characteristics of high detection sensitivity. When the test sample contains virulent strains of duck plague virus, the RPA primer pair can amplify an amplification fragment with a length of 154 bp. When the sample contains duck plague vaccine strains, the RPA primer pair cannot amplify the sample. In an embodiment of the present invention, the detection sensitivities of different primer pairs (F1R1, F1R2, F1R3, F2R1, F2R2, F2R3, F3R1, F3R2 and F3R3) and the probe DEVP combination were compared respectively. The results showed that compared with other primer pairs, F2R1 (the RPA primer pair of the present invention) had a relatively faster starting speed, the highest peak value of the amplification curve at the same time, and the best sensitivity. The fluorescence quantitative RPA detection results showed that the detection limit of the RPA primer pair was 0.1 fg / μL. It can be seen that the RPA primer realizes the specific detection of virulent strains of duck plague virus in natural infection, and at the same time has the characteristics of high detection sensitivity. The present invention has no special limitation on the source of the RPA primer pair, and the primer artificial synthesis method well-known in the art can be used. In the embodiment of the present invention, the primer pair was entrusted to Tsingke Biotechnology Co., Ltd. for synthesis.
[0038] The present invention provides an RPA primer-probe set for detecting virulent strains of duck plague, including the RPA primer pair and the probe DEV P; the nucleotide sequence of the probe DEV P is as shown in SEQ ID NO:3 (5′-CTGAATGCGAGCCCGTGAGCCTGGCCGGGTTGATGATATGGATCTTGCC-3′). The probe DEV P is designed based on the differential fragments of the genes of virulent strains and vaccine strains of duck plague virus. The combination of the probe DEV P and the RPA primer pair, when added to the fluorescence quantitative RPA detection reaction system, can further improve the specificity of amplification, increase the reaction rate, and improve the sensitivity compared with the system without adding the probe.
[0039] In the present invention, the 31st base of the probe DEV P is preferably modified with a fluorescent reporter group in the direction from the 5'-end to the 3'-end, and the fluorescent reporter group preferably includes any one of the following: FAM, TAMRA, CY3, and CY5; the 16th base of the probe DEV P is preferably modified with a fluorescent quenching group in the direction from the 3'-end to the 5'-end, and the fluorescent quenching group preferably includes BHQ1; the base A between the fluorescent reporter group and the fluorescent quenching group is replaced with a tetrahydrofuran residue; the 3'-end of the probe DEV P is modified with a protection tag to prevent polymerization reaction, and the protection tag to prevent polymerization reaction includes C3-spacer. The nucleotide sequence of the probe RPA P after modification and replacement is as shown in SEQ ID NO:4: (5'-CTGAATGCGAGCCCGTGAGCCTGGCCGGGT(dT-FAM)G(THF)(dT-BHQ1)GATATGGATCTTGCC-C3spacer-3'). The present invention has no special limitation on the source of the probe DEV P, and the probe artificial synthesis method well-known in the art can be used. In the embodiment of the present invention, the probe DEV P was synthesized by Beijing Zixi Biotechnology Co., Ltd.
[0040] In the present invention, the RPA primer-probe group has strong specificity and only specifically amplifies the virulent strain of duck plague virus, and cannot amplify the DEV vaccine strain, Tembusu virus (TMUV), Muscovy duck parvovirus (MDPV), influenza virus (AIVH5), reovirus (DRV), duck hepatitis virus (DHAV), Salmonella spp. The RPA primer-probe group has high sensitivity, and the fluorescence quantitative RPA detection result shows that the detection limit of the RPA primer-probe group is 0.1 fg / μL.
[0041] The present invention provides the application of the RPA primer pair or the RPA primer-probe group in the preparation of a detection kit for the virulent strain of duck plague.
[0042] The present invention provides a detection kit for the virulent strain of duck plague, including the RPA primer pair or the RPA primer-probe group.
[0043] In the present invention, it further includes an RPA amplification reagent; the RPA amplification reagent preferably includes at least one of the following: dNTPs, recombinase that binds to single-stranded nucleic acid, single-stranded DNA-binding protease, strand-displacement DNA polymerase, RPA buffer, and magnesium acetate solution, and preferably further includes an eight-tube enzyme amplification tube. The present invention has no special limitation on the source of the RPA amplification reagent, and the well-known reagent purchase sources in the art can be adopted. In the embodiments of the present invention, the recombinase that binds to single-stranded nucleic acid, single-stranded DNA-binding protease, strand-displacement DNA polymerase, RPA buffer, magnesium acetate solution, and eight-tube enzyme amplification tube are purchased from Yeasen Biotechnology (Shanghai) Co., Ltd.
[0044] The present invention provides a method for detecting a virulent strain of duck plague for non-disease diagnosis purposes, including the following steps:
[0045] Using the genomic DNA of the sample to be tested as a template, real-time fluorescence quantitative RPA detection is carried out using the RPA primer-probe set or the detection kit;
[0046] Determine whether the sample carries a virulent strain of duck plague according to the results of real-time fluorescence quantitative detection:
[0047] If an "S"-shaped amplification curve appears, it is determined that the sample carries a virulent strain of duck plague; if an "S"-shaped amplification curve does not appear, it is determined that the sample does not carry a virulent strain of duck plague.
[0048] In the present invention, using the genomic DNA of the sample to be tested as a template, real-time fluorescence quantitative RPA detection is carried out using the RPA primer-probe set. In the present invention, the sample to be tested preferably includes poultry meat products and their processed foods, and may also include feces, feed, and water samples. The poultry preferably includes Anseriformes, and more preferably includes ducks and / or geese. The present invention preferably includes the genomic extraction kit method for the method of extracting the genomic DNA. The present invention has no special limitation on the source of the kit method, and the well-known genomic extraction kit purchase sources in the art can be adopted. In the embodiments of the present invention, the genomic extraction kit is purchased from Jifan Science and Technology Biology Co., Ltd. (Guangzhou, China), and the commodity name is Magnetic Bead Method Virus DNA Extraction Kit.
[0049] The present invention has no special limitation on the preparation method of the reaction system for real-time fluorescence quantitative RPA detection, and the well-known preparation method of the reaction system for real-time fluorescence quantitative RPA detection in the art can be adopted. In the embodiments of the present invention, the preparation method of the reaction system for real-time fluorescence quantitative RPA detection is to use DEVF, DEV R, probe DEV P, RPA buffer template, and DEPCH 2After adding O to the reaction tube, mixing well and centrifuging, then add the initiator containing magnesium acetate solution to the lid of the reaction tube, tighten the tube lid, invert the reaction tube up and down to mix well and centrifuge, so that the reaction solution is placed at the bottom of the reaction tube. The rotation speed of the centrifugation is 1000 rpm, and the time of the centrifugation is 10 s.
[0050] In the present invention, the reaction system of the real-time fluorescence quantitative RPA detection is preferably: DEVF 1.5 μL, DEV R 1.5 μL, probe DEVP 0.6 μL, initiator containing magnesium acetate solution 2.5 μl, buffer 29.4 μL, template 2 μl, DEPC H 2 O is made up to 50 μl; the final concentration of DEVF or DEV R is preferably 200 - 500 nM / μL, more preferably 300 - 400 nM / μL, and most preferably 300 nM / μL. The final concentration of the probe DEV P is preferably 40 - 160 nM / μL, more preferably 80 - 120 nM / μL, and most preferably 120 nM / μL.
[0051] The reaction program of the real-time fluorescence quantitative RPA detection is preferably: react at 25 - 45 °C for 15 - 25 min , Collect fluorescence signals every 30 s. The reaction temperature is more preferably 30 - 43 °C, further preferably 35 - 42 °C, and most preferably 40 °C. The reaction time is more preferably 17 - 23 min, further preferably 19 - 22 °C, and most preferably 20 min.
[0052] After completing the real-time fluorescence quantitative RPA detection, the present invention determines whether the sample carries the virulent strain of duck plague according to the real-time fluorescence quantitative detection result:
[0053] If an "S"-shaped amplification curve appears, it is determined that the sample carries the virulent strain of duck plague; if the "S"-shaped amplification curve does not appear, it is determined that the sample does not carry the virulent strain of duck plague.
[0054] In the reaction system of the real-time fluorescence quantitative RPA detection of the detection method of the present invention, the independent concentration of the RPA primer is 300 nM / μL, the concentration of the probe DEV P is 120 nM / μL, reacting at 40 °C, the amplification efficiency is the highest, the detection sensitivity can reach 0.1 fg / μL, and the detection can be completed within 20 min, greatly shortening the detection time of duck plague virus. At the same time, the primer-probe group of the present invention has strong specificity, can effectively amplify the virulent strain virus of duck plague, and cannot amplify other avian disease viruses (DEV vaccine strain, TMUV, MDPV, AIVH5, DRV, DHAV and Salmonella). In addition, the detection method of the present invention has a simple operation method, accurate and rapid detection results, does not require expensive instruments such as a PCR amplifier, and can realize the daily monitoring and epidemiological investigation of duck plague virus in duck flocks.
[0055] To further illustrate the present invention, a recombinase polymerase amplification (RPA) primer pair, a kit and a detection method for detecting a virulent strain of duck plague virus provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0056] Example 1
[0057] Design and screening of specific RPA primers and probes
[0058] According to the gene sequence of the DEV standard virulent strain CHv (CVCC AV1221) with the accession number, by analyzing the conserved gene UL2 gene sequence, 1 probe sequence was designed, and 3 upstream and downstream RPA primers were designed respectively according to this probe sequence, as shown in Table 1.
[0059] Table 1 Alternative primer pairs and probes for RPA detection
[0060]
[0061] Using the nucleic acid of the virulent strain of duck plague virus diluted 1000 times as a template, RPA amplification was carried out with the primers and probes in Table 1, and the best primer-probe group was screened, and the results were observed by a fluorescence detector. The commercial name of the virulent strain of duck plague is DEV standard virulent strain CHv (CVCC AV1221), which is purchased from the China Institute of Veterinary Drug Control.
[0062] The amplification system was: 1.5 μL of 10 μM DEV F, 1.5 μL of 10 μM DEV R, 0.6 μL of 10 μM probe DEV P, 2.5 μl of the initiator containing magnesium acetate solution, 29.4 μL of buffer, 2 μl of template, and DEPC H 2 O was made up to 50 μl.
[0063] The amplification conditions were: reacting at 40 °C for 20 min. The results showed that compared with other primer pairs, the primer pair DEV F2 and DEVR1 had a relatively faster starting speed, and the peak value of the amplification curve was the highest at the same time ( Figure 1) Therefore, the best primer pair was determined to be DEVF2 and DEV R1. The amplified fragment length of DEV F2 and DEV R1 for the virulent strain of duck plague was 154 bp, and the nucleotide sequence was as shown in SEQ ID NO:9 (CGAACGGCCGATAATATATTACGTAGGCTAGGAGGTATCTGAATACCTCTCCGCACGCTGAATGCGAGCCCGTGAGCCTGGCCGGGTTGATGATATGGATC TTGCCCAACTATGATGACTTTTACATCCGATGGAGCACAGTACCTCGTCCAT G). DEV F2 and DEV R1 could not amplify the vaccine strain of duck plague. Therefore, the primer pair DEV F2 and DEV R1 with better sensitivity and specificity was selected as the primer pair for RAP detection. DEVF2 was denoted as DEVF, and DEV R1 was denoted as DEV R. DEV F, DEV R, and the probe DEVP were combined for subsequent RAP detection.
[0064] Example 2
[0065] Primer concentration optimization experiment
[0066] In the amplification system, independent final concentration gradients of DEV F and DEV R were set at 200 nM, 300 nM, 400 nM, and 500 nM respectively, and the dosages of other components in the amplification system were added according to the amplification system in Example 1. The reaction procedure was: react at 40 °C for 20 min. By monitoring the fluorescence signal with a fluorescence detector, the amplification curve as shown in Figure 2 could be obtained. Figure 2 The results showed that when the reaction proceeded to 7 min, the amplification curves corresponding to the 4 primer concentrations all started to rise, and the peaks were comparable. However, after the reaction proceeded to 18 min, the peak of the 300 nM group amplification curve was higher than the other 3 groups. Therefore, the best primer concentration was determined to be 300 nM, and 300 nM was used as the independent concentration of DEV F and DEV R for subsequent detection.
[0067] Example 3
[0068] Probe concentration optimization experiment
[0069] In the amplification system, the concentrations of the probe DEV P were set at 40 nM, 80 nM, 120 nM, and 160 nM respectively, and the dosages of other components in the amplification system were added according to the optimized amplification system in Example 2. The reaction procedure was: react at 40 °C for 20 min. By monitoring the fluorescence signal with a fluorescence detector, the amplification curve as shown in Figure 3 could be obtained. From Figure 3It can be seen that the peak of the amplification curve of the 120 nM group is higher than that of the other three groups. Therefore, the optimal concentration of the probe DEV P can be determined to be 120 nM, and 120 nM is used as the concentration of DEV P during subsequent detection.
[0070] Example 4
[0071] Reaction temperature optimization experiment
[0072] In the amplification system, the concentrations of the nucleic acid templates are set to 100 fg / μL and 1 fg / μL respectively, and the dosages of other components in the amplification system are added according to the optimized amplification system in Example 3. The prepared amplification systems are reacted at 25°C, 30°C, 35°C, 40°C and 45°C for 20 min respectively. By monitoring the fluorescence signal with a fluorescence detector, the amplification curves as shown in Figure 4 can be obtained. It can be seen from Figure 4 that the reaction starting speeds of the two amplification curves of the 40°C group are relatively fast, and the peak values of the amplification curves are the highest at the same time. Therefore, the optimal reaction temperature is determined to be 40°C, and 40°C is used as the reaction temperature during subsequent detection.
[0073] Example 5
[0074] Reaction time optimization experiment
[0075] In the amplification system, the concentrations of the nucleic acid templates are set to 100 fg / μL and 1 fg / μL respectively, and the dosages of other components in the amplification system are added according to the optimized amplification system in Example 3. The prepared amplification systems are reacted at 40°C for 10 min, 15 min, 20 min and 25 min respectively. By monitoring the fluorescence signal with a fluorescence detector, the amplification curves as shown in Figure 5 can be obtained. It can be seen from Figure 5 that the reaction starting speed of the amplification curve of the 20 min group is relatively fast, and the peak value of the amplification curve is the highest at the same time. Therefore, the optimal reaction time is determined to be 20 min, and 20 min is used as the reaction time during subsequent detection.
[0076] Example 6
[0077] Reaction specificity detection experiment
[0078] To verify the specificity of the primers and probes, nucleic acid templates were respectively set as the virulent strain of duck plague virus, duck plague vaccine strain, Tembusu virus (TMUV), parvovirus (GPV), avian influenza virus (AIV H9), avian reovirus (DRV), duck hepatitis A virus (DHAV), and Salmonella spp. in the amplification system, and the dosages of other components were added according to the optimized amplification system in Example 3. The commercial name of the virulent strain of duck plague virus is DEV standard virulent strain CHv (CVCC AV1221), which was purchased from the China Institute of Veterinary Drug Control. The commercial name of the duck plague vaccine strain is DEV chicken embryo attenuated strain C-KCE (CVCC AV1222), which was purchased from the China Institute of Veterinary Drug Control. The reaction program was: reaction at 40°C for 20 min. By monitoring the fluorescence signal with a fluorescence detector, the results as shown in Figure 6 can be obtained. Figure 6 In Figure 6 , BC is the blank control group. As can be seen from
[0079] Example 7
[0080] Reaction sensitivity detection experiment
[0081] In the amplification system, the concentrations of the nucleic acid templates were respectively set as 1 pg / μL, 100 fg / μL, 10 fg / μL, 1 fg / μL, and 0.1 fg / μL, and the dosages of other components in the amplification system were added according to the optimized amplification system in Example 3. The reaction program was: reaction at 40°C for 20 min. By monitoring the fluorescence signal with a fluorescence detector, the reaction results as shown in Figure 7 can be obtained, and the lowest detection value is 0.1 fg / μL.
[0082] From the above experimental results, it can be known that the present invention provides a fluorescence RPA primer and probe for detecting the virulent strain of duck plague virus. In the reaction system, the primer concentration is 300 nM / μL, the probe concentration is 120 nM / μL, the reaction is carried out at 40°C, the amplification efficiency is the highest, the detection sensitivity can reach 0.1 fg / μL, and the detection can be completed within 20 min, greatly shortening the detection time of duck plague virus. At the same time, the primer-probe group of the present invention has strong specificity and can effectively amplify the virulent strain of duck plague virus, but cannot amplify other avian disease viruses. In addition, the detection method described in the embodiments of the present invention is applied to the detection of the virulent strain of duck plague virus, and the operation method is simple, and the detection results are accurate, rapid, and sensitive.
[0083] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. Other embodiments can also be obtained based on these embodiments without creative efforts, and these embodiments all fall within the protection scope of the present invention.
Claims
1. An RPA primer pair for detecting a strong strain of duck plague, characterized in that: It comprises a forward primer DEV F having a nucleotide sequence as shown in SEQ ID NO:1 and a reverse primer DEV R having a nucleotide sequence as shown in SEQ ID NO:
2.
2. An RPA primer probe set for detecting a strong strain of duck plague, characterized in that: Comprising the RPA primer pair and probe DEV P according to claim 1; The nucleotide sequence of the probe DEV P is shown in SEQ ID NO:
3.
3. The probe RPA primer probe set according to claim 2, characterized in that: In the probe DEV P, the 31st base is modified with a fluorescent reporter group in the direction from the 5′ end to the 3′ end; In the probe DEV P, the 16th base from the 3′ end to the 5′ end is modified with a fluorescence quenching group; The base A between the fluorescent reporter group and the fluorescent quencher group is replaced with a tetrahydrofuran residue; The 3′ end of the probe DEV P is modified with a protective tag to prevent polymerization.
4. The RPA primer probe set according to claim 3, characterized in that: The fluorescent reporter group includes any one of the following: FAM, TAMRA, CY3 and CY5, the fluorescent quenching group includes BHQ1, and the protective label for preventing polymerization reaction includes C3-spacer.
5. Use of the RPA primer pair according to claim 1 or the RPA primer probe set according to any one of claims 2 to 4 in preparing a detection kit for a strong strain of duck plague.
6. A detection kit for a strong strain of duck plague, characterized in that: It comprises the RPA primer pair according to claim 1 or the RPA primer probe set according to any one of claims 2 to 4.
7. The detection kit according to claim 6, characterized in that: Also included are RPA amplification reagents; The RPA amplification reagent comprises at least one of the following: dNTPs, a single-stranded nucleic acid recombinase, a single-stranded DNA-binding protease, a strand-displacing DNA polymerase, an RPA buffer, and a magnesium acetate solution.
8. A method for detecting a strong strain of duck plague for non-disease diagnosis purposes, characterized in that: The following steps are involved: Using the genomic DNA of the sample to be tested as a template, the RPA primer probe set described in claim 2 or the detection kit described in claim 6 or 7 is used to perform real-time fluorescent quantitative RPA detection; Determine whether the sample carries a strong strain of duck plague based on the real-time fluorescence quantitative RPA test results: If an "S"-shaped amplification curve appears, the sample is judged to carry a strong strain of duck plague; if no "S"-shaped amplification curve appears, the sample is judged not to carry a strong strain of duck plague.
9. The method according to claim 8, characterized in that: The reaction system of the real-time fluorescence quantitative RPA detection is 50 μl, the final concentration of the forward primer DEV F or the reverse primer DEV R in the reaction system is 200-500 nM / μL, and the final concentration of the probe DEV P is 40-160 nM / μL.
10. The method according to claim 9, characterized in that: The reaction procedure of the real-time fluorescence quantitative RPA detection is: 25-45°C for 15-25 minutes , Fluorescence signals were collected every 30 s.