Method for replacing high temperature denaturation to produce single strand in multiplex PCR detection reaction and method for improving sensitivity and accuracy of liquid phase hybridization detection of multiplex PCR product and matching kit

Abstract

The application discloses a method for replacing high-temperature denaturation to produce single strands in a multiplex PCR detection reaction and a method for improving the sensitivity and accuracy of liquid-phase hybridization detection of multiplex PCR products and a matching kit. The method mainly comprises the following steps: a 5' end of a primer is designed and modified to have a phosphate group, so that a PCR product with a phosphorylated end of one strand is amplified; and the PCR amplification product is subjected to digestion treatment by using Lambda exonuclease, so that the DNA strand with the phosphorylated end is completely removed, and a single strand is obtained. The method for replacing high-temperature denaturation to produce single strands in the ordinary multiplex PCR detection reaction eliminates the negative influence of DNA recombination on hybridization of a probe and a target sequence, improves the hybridization efficiency, and improves the accuracy and sensitivity of a liquid chip technology platform in application of molecular detection.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of gene detection, and particularly relates to a method for replacing high-temperature denaturation to produce single strands in a multiplex PCR detection reaction, and a method for improving the sensitivity and accuracy of liquid-phase hybridization detection of multiplex PCR products and a matching kit. BACKGROUND

[0002] Liquid chip technology uses liquid hybridization technology to hybridize the sample to be detected and the probe in liquid. The method uses microspheres or magnetic beads with special markers or codes as reaction carriers, and then covalently crosslinks each coded microsphere or magnetic bead with antigen, antibody or nucleic acid probe, etc. capture molecules for specific detection. After adding the sample to be detected, under liquid conditions, the target molecules specifically bind to the capture molecules covalently crosslinked on the surface of the microspheres or magnetic beads. Up to 100 different reactions can be completed in one reaction well. Finally, the liquid chip detector is used for automatic analysis, the microsphere or magnetic bead number and its fluorescence intensity are identified, so as to complete real-time, qualitative and quantitative analysis of the reaction.

[0003] Multiplex PCR (MPCR) is a technology that simultaneously amplifies multiple targets through one PCR reaction, and detects the amplification products by combining certain detection methods to realize the diagnosis of multiple targets. Since Chamberlain first proposed this concept in 1988, MPCR has been intensively studied and widely applied in various fields such as gene mutation and deletion, genotyping and quantification, genetic detection, companion drug diagnosis, etc. due to its wide range of applications, ability to simultaneously detect multiple targets, significant improvement in detection efficiency, and reduction in detection cost, as well as its high efficiency, high throughput, and low cost.

[0004] In the detection of multiplex PCR products, the prerequisite for specific binding of target molecules to capture probes covalently crosslinked on the surface of microspheres or magnetic beads under liquid conditions is to denature the amplified double-stranded DNA into single-stranded DNA. The main denaturation method is thermal denaturation, i.e. breaking the hydrogen bonds that maintain the stability of the double helix and destroying the stacking force between the bases by high temperature to form the required single-stranded DNA. However, thermal denatured DNA can be renatured after cooling, which affects the hybridization efficiency of the probe and the target sequence, and reduces the detection sensitivity and accuracy.

[0005] Lambda exonuclease is a highly persistent, phosphodiester group-liking alkaline exonuclease, which can continuously cut nucleic acid into single base, which is incomparable to many exonucleases including exonuclease I, exonuclease III, S1 enzyme, DNAase I and other nucleases. Moreover, the cutting rate reaches 1000 nt / s. In addition, it has very strong phosphodiester group-liking, and the cutting efficiency of phosphorylated nucleic acid chain and non-phosphorylated nucleic acid chain is more than 200 times. Lambda exonuclease digests double-stranded DNA (dsDNA) in a highly ordered manner, more than 3000 nucleotides per digestion, but the efficiency of cutting single-stranded DNA (ssDNA) is very low. Studies have also shown that it cannot initiate cutting from nick or gap sites. These unique properties are outstanding advantages that can be utilized when establishing a biological analysis sensor method based on Lambda exonuclease. Therefore, Lambda exonuclease plays a crucial role in nucleic acid recombination, replication, typing, gene repair and molecular cloning, and has become one of the important tools for studying genome composition, function and expression. SUMMARY

[0006] In order to solve the above technical problems, the primary object of the present application is to provide a method for replacing high-temperature denaturation to produce single-stranded in multiplex PCR detection reaction, eliminating the negative effects of DNA recombination on probe and target sequence hybridization, improving hybridization efficiency, and improving the accuracy and sensitivity of liquid chip technology platform in application of molecular detection.

[0007] A method for replacing high-temperature denaturation to produce single-stranded in multiplex PCR detection reaction, comprising the following steps:

[0008] 1) One of the primers of each set of upstream and downstream primers in the multiplex PCR has a phosphate group modification at the 5' end, so as to amplify a PCR product with one end phosphorylated;

[0009] or

[0010] adding a universal sequence to the 5' end of the specific primer of the multiplex PCR, and designing a pair of universal primers with 3' end partial sequence complementary to the universal sequence, one of the universal primers having a phosphate group modification at the 5' end, and using the specific primer and the universal primer to amplify a PCR product with one end phosphorylated;

[0011] 2) The obtained PCR amplification product is subjected to digestion treatment with Lambda exonuclease to completely remove the DNA chain with one end phosphorylated, so as to obtain single-stranded.

[0012] Further, the enzyme digestion system of step 2) is 25-50 μL; the enzyme dosage of Lambda exonuclease digestion treatment is 0.5-2 μL, and the enzyme digestion time is 25-30 min.

[0013] Further preferably, the enzyme digestion system in step 2) is 25 μL; the Lambda exonuclease digestion enzyme is 1 μL, and the enzyme digestion time is 30 min.

[0014] The second aspect of the present application is to provide a method for improving the sensitivity and accuracy of liquid hybridization detection of multiplex PCR products, wherein the single strand obtained by the aforementioned method is used in the liquid hybridization detection.

[0015] Further, the method comprises the following steps:

[0016] (1) the single strand obtained by the aforementioned method;

[0017] (2) designing a corresponding specific probe according to the target sequence of the multiplex PCR and the amplified region of the primer, wherein the sequence of the specific probe is within the amplified range of the upstream and downstream primers, and the 5' end is modified with NH2;

[0018] (3) coupling the specific probe to a magnetic bead with a unique code;

[0019] (4) mixing the single strand with the magnetic bead coupled with the specific probe with a corresponding code for hybridization reaction;

[0020] (5) analyzing the detection result.

[0021] Further, the method further comprises the following steps:

[0022] After the hybridization reaction, a staining reagent is added for staining reaction, and then the magnetic bead code and fluorescence are scanned and recognized by a fluorescence quantitative analyzer; finally, the detection result is analyzed according to the fluorescence intensity of different magnetic beads.

[0023] Further,

[0024] The specific probe in step (2) has a sequence of TTTTTTTTTATTTTTTTTT at the 5' end.

[0025] The specific probe has a length of 25-35 bp and is complementary to the sequence of the single strand in step 1).

[0026] The Tm value is 55-65℃.

[0027] The specific probe has a locked nucleic acid modification.

[0028] One specific probe corresponds to one magnetic bead code, and different specific probes correspond to different magnetic bead codes.

[0029] The amount of single strand (single strand means multiple PCR product participating in hybridization reaction) in step (4) is 5-10 μL; the amount of magnetic beads is 120-300; the volume of the whole hybridization reaction system is 45-50 μL; the hybridization reaction temperature is determined according to the Tm value of the probe, and is 40-50 DEG C; further, the hybridization temperature is 45 DEG C; and the hybridization reaction time is 20-30 min.

[0030] The staining reagent is SA-PE, and the concentration is 2-5 μg / mL; the staining reaction time is 15-20 min; the washing liquid is 1xPBS-T, and the washing time is 30-60 s each time; and the washing is performed 2-3 times.

[0031] The method for replacing high-temperature denaturation to produce single strand in the multiple PCR detection reaction and the method for improving the sensitivity and accuracy of liquid-phase hybridization detection of multiple PCR product of the application are all used in non-diagnostic or therapeutic purposes.

[0032] The method or kit of the application can be applied in SNP typing detection or gene point mutation detection; and the detection accuracy and sensitivity are mainly improved.

[0033] The third aspect of the application is to provide a multiple PCR product liquid-phase hybridization detection kit, which comprises the reagent used in combination with the method for improving the sensitivity and accuracy of liquid-phase hybridization detection of multiple PCR product.

[0034] In the application, the 5' end of one primer of multiple PCR is modified by phosphoric group (P), so that the PCR product with one end of one strand phosphorylated is amplified, and then the PCR amplification product is subjected to enzyme digestion treatment by Lambda exonuclease, so that single strand DNA is obtained. The method is innovatively applied to multiple PCR reaction for the first time, and the problem of traditional high-temperature denaturation and cooling reversion is eliminated, and the product can be directly used for subsequent liquid-phase hybridization detection. In summary, the method for replacing high-temperature denaturation to produce single strand in the ordinary multiple PCR reaction eliminates the negative influence of DNA reversion on the hybridization of probe and target sequence, improves the hybridization efficiency, and improves the accuracy and sensitivity of the liquid chip technology platform in the application of molecular detection. BRIEF DESCRIPTION OF DRAWINGS

[0035] Figure 1 The average value line graph of fluorescence difference of traditional multiple PCR and multiple PCR liquid-phase hybridization detection in example 4. DETAILED DESCRIPTION

[0036] The following examples are intended to further illustrate the application, but not to limit the application.

[0037] Example 1: Magnetic bead coupled probe

[0038] 1) Add 100 μL of lx PBS-T to a 2 mL microfuge tube, add 20,000 beads to the 2 mL microfuge tube, place on magnetic stand for 2 minutes, remove supernatant.

[0039] 2) Add 300 μL of Methanol solution, vortex for 15 seconds, spin down, place on magnetic stand for 2 minutes, remove supernatant. Repeat 2 times.

[0040] 3) Add 300 μL of MES-T buffer, vortex for 15 seconds, spin down, place on magnetic stand for 2 minutes, remove supernatant.

[0041] 4) Add 300 μL of MES buffer, vortex for 15 seconds, spin down, place on magnetic stand for 2 minutes, remove supernatant.

[0042] 5) Add 180 μL of MES buffer, add 20 μL of specific probe to be coupled (100 μM concentration), vortex for 15 seconds immediately after addition, spin down, and vortex at 1600 rpm for 10 minutes at room temperature using a microfuge tube vortexer.

[0043] 6) Add 50 μL of freshly prepared 20 mg / mL EDTA coupling solution to each microfuge tube, vortex for 15 seconds immediately after addition, spin down, and vortex at 1600 rpm for 15 hours at room temperature.

[0044] 7) After the coupling reaction is complete, spin down the 2 mL microfuge tube, place on magnetic stand for 2 minutes, remove supernatant.

[0045] 8) Add 300 μL of Tris-HCl solution (50 mM, pH 7.4) and terminate the coupling reaction by vortexing at 1600 rpm for 15 minutes at room temperature using a microfuge tube vortexer.

[0046] 9) Spin down the 2 mL microfuge tube after the termination reaction procedure, place on magnetic stand for 2 minutes, remove supernatant, add 300 μL of Blocking buffer (1% BSA in lx PBS buffer) solution, vortex for 15 seconds, spin down, and place on magnetic stand for 2 minutes, remove supernatant.

[0047] 10) Add 300 μL of Blocking buffer solution, place in microfuge tube vortexer, and vortex at 1600 rpm for 60 minutes at room temperature.

[0048] 11) Spin down the 2 mL microfuge tube after the blocking procedure is complete, place on magnetic stand for 2 minutes, remove supernatant.

[0049] 12) Add 300 μL PBS-T solution (0.05% Tween-20 in 1xPBS), shake for about 15 seconds, then centrifuge quickly, and then place on a magnetic stand for 2 minutes, and remove the supernatant. Repeat 2 times.

[0050] 13) Add 100 μL PBS-T solution for reconstitution, and then take a sample for counting after homogenization.

[0051] 14) The probe-coupled magnetic bead solution is stored at 2-8°C, and can be directly used for sample detection.

[0052] Example 2, Lambda Exonuclease Reaction Condition Test

[0053] Although the reaction condition has been given by the Lambda Exonuclease manufacturer (New England Biolabs) (50 μL reaction system, enzyme amount 1 μL, reaction time 30 min), the Lambda Exonuclease can also slowly degrade single-stranded DNA and non-phosphorylated substrates. In order to explore the best reaction condition in the method of the present application and achieve the best enzyme cutting effect, according to the reaction condition given by the manufacturer and the actual situation of the method of the present application, the SPSS software is used to design an orthogonal experiment to obtain the best reaction condition. The test sample is 10 ng of 2% EGFR (E746_A750del) mutant sample, the orthogonal experiment designed by the SPSS software is 9 groups, and the reaction condition given by the manufacturer (50 μL system, 37°C, 30 min) is taken as a control, a total of 10 groups of experiments.

[0054] Table 1: Design and synthesis of primers and hybridization probes with 5' end phosphate group (P) modification:

[0055]

[0056] The primer purity is HPLC grade.

[0057] 1. PCR amplification reaction:

[0058] Reaction system: 2xPCR mix 10 μL, 10 μM upper and lower primers 1 μL each, 10 ng / μL DNA 1 μL, Nuclease-Free Water 7 μL;

[0059] 2. Amplification reaction program: 95°C for 10 min, 1 cycle; 95°C denaturation for 30 sec, 60°C annealing for 30 sec, 72°C extension for 30 sec, 35 cycles; 72°C extension for 7 min.

[0060] 3. Orthogonal experiment scheme and test data are as follows:

[0061] Table 2

[0062]

[0063] The mean values ​​of the 10 test results were analyzed using SPSS software to obtain the optimal reaction conditions. The analysis results are as follows:

[0064] Table 3 Enzyme Amount

[0065]

[0066] Table 4 Reaction Time

[0067]

[0068] Table 5 Reaction Volume

[0069]

[0070] The analysis results show that the reaction conditions with the highest average detection value are 1 μL of enzyme, 30 min of reaction time, and 25 μL of reaction volume. Therefore, these conditions are set as the enzyme digestion reaction conditions.

[0071] Example 3: SNP Genotyping Detection

[0072] The rs2279744 site is a mutation at position 309 (T>G) in the promoter region of the MDM2 gene. Its global minimum allele frequency is G=36.66%. Studies have shown that the rs2279744 polymorphism of the MDM2 gene is involved in the pathogenesis of hepatocellular carcinoma and affects its prognosis. It is an important genetic susceptibility factor for hepatocellular carcinoma.

[0073] rs1801394 is an A / G polymorphism located at the second exon of the MTRR gene between 5p15.3 and p15.2, which can form three genotypes: A / A, A / G, and G / G. The rs1801394 site is a major mutation on MTRR, causing vitamin methylation deficiency, and is associated with diseases such as spina bifida, Down syndrome, neural tube defects, and leukemia.

[0074] This embodiment uses two SNP loci, rs2279744 and rs1801394, as target loci to examine the beneficial effects that the present invention can achieve in dual SNP detection.

[0075] Sample source: Whole blood DNA from individuals with known SNP genotypes. Specific genotyping details are shown in the table below.

[0076] Table 6

[0077] RS Number rs2279744 rs1801394 Sample 1 TG AA Sample 2 TG AG Sample 3 TG GG Sample 4 TT AA Sample 5 TG AG Sample 6 GG AG

[0078] Design and synthesis of primers and hybridization probes modified with phosphate (P) groups at the 1.5' end:

[0079] Table 7

[0080]

[0081]

[0082] Primer purity is HPLC grade. / iLNA_N / indicates locked nucleic acid modification.

[0083] 2. PCR amplification reaction:

[0084] Reaction system: 10 μL 2xPCR mix, 0.6 μL 10 μM rs2279744 upstream and downstream primers, 1 μL 10 μM rs1801394 upstream and downstream primers, 1 μL 10 ng / μL DNA, 7.4 μL Nuclease-Free Water;

[0085] Amplification reaction program: 95℃ for 10 min, 1 cycle; 95℃ denaturation for 30 sec, 60℃ annealing for 30 sec, 72℃ extension for 30 sec, 35 cycles; 72℃ extension for 7 min.

[0086] 3. After the PCR product is digested with Lambda Exonuclease.

[0087] Enzyme digestion reaction system:

[0088] Table 8

[0089] Reagent Volume μL PCR product from previous step 20 Lambda Exonuclease buffer 2.5 Lambda Exonuclease 1 Nuclease-Free Water 1.5 Total 25

[0090] Enzyme digestion reaction procedure;

[0091] Table 9

[0092] Temperature Time Cycle Number 37℃ 30 min 1 4℃ Hold 1

[0093] 4. Sample hybridization reaction

[0094] 1) Mix the two types of magnetic beads corresponding to rs2279744T / G and rs1801394A / G with blank magnetic beads (without any probe), add hybridization buffer to 45 μL per reaction tube, and place on a super thermostat mixer to react at the hybridization temperature at 1600 rpm for 5 minutes.

[0095] 2) Then, add 5 μL of the enzyme-digested nucleic acid sample to each reaction tube and perform the hybridization reaction at 1600 rpm for 20 minutes on a super thermostat.

[0096] 3) After the hybridization reaction is complete, place the reaction tube on a magnetic rack and let it stand for 2 minutes. Then, slowly remove the supernatant, add 50 μL of 5 μg / ml SA-PE solution to the reaction tube, and place it in a super thermostat mixer to stain at 1600 rpm for 15 minutes at room temperature.

[0097] 4) After staining, place the reaction tube on a magnetic rack for 2 minutes to fix the magnetic beads. After removing the supernatant, add 150uL of 1xPBS-T and wash the tube in a super thermostatic mixer at room temperature and 1600rpm for 30 seconds (repeat twice).

[0098] 5) Add 200 μL of detection buffer to each reaction tube and repeatedly pipette at least 10 times to ensure that the magnetic beads are evenly distributed. Use a fluorescence quantitative analyzer to identify the magnetic beads and detect the fluorescence.

[0099] 6) Data processing: Subtract the fluorescence value of the corresponding magnetic bead from the fluorescence value of each magnetic bead in the test sample;

[0100] 7) Perform difference / ratio calculations on the fluorescence values ​​of the magnetic beads corresponding to the two probes according to the result interpretation criteria, and interpret the results. The final result is consistent with the genotyping results of the first-generation sequencing.

[0101] Method of the present invention:

[0102] Table 10

[0103]

[0104]

[0105] Traditional comparison method: PCR products are not digested with enzymes and denatured at 95°C.

[0106] Table 11

[0107]

[0108] The fluorescence differences between probe A and probe G at rs1801394 and probe T and probe G at rs2279744 were statistically analyzed for six samples, and the results are shown in the table below:

[0109] Method of the present invention:

[0110] Table 12

[0111] Site Sample 1 Sample 2 Sample 3 Sample 4 Sample 5 Sample 6 Mean rs1801394-A 4084 2045 441 4094 2212 1982 2476.33 rs1801394-G 230 3724 6789 306 3633 4013 3115.83 rs2279744-T 3573 3855 3537 6057 3533 313 3478.00 rs2279744-G 6044 5832 6245 591 5820 10839 5895.17

[0112] Traditional comparison method:

[0113] Table 13

[0114] Site Sample 1 Sample 2 Sample 3 Sample 4 Sample 5 Sample 6 Mean rs1801394-A 1258 960 106 1636 1079 1289 1054.67 rs1801394-G 222 1216 3016 115 2137 2403 1518.17 rs2279744-T 1738 1342 1152 2654 1152 275 1385.50 rs2279744-G 2546 2123 3505 304 2116 4453 2507.83

[0115] Experimental results show that both the method of this invention and the traditional high-temperature denaturation method can simultaneously detect two SNP sites in the same sample using a single tube. However, compared with hybridization after enzyme digestion, the fluorescence difference after high-temperature denaturation is 2-3 times that of the traditional high-temperature denaturation method. The fluorescence value obtained by hybridization after enzyme digestion is higher, and the fluorescence difference ratio of the two probes corresponding to the same homozygote is larger, all exceeding 10 times, resulting in stronger discrimination. The method of this invention can effectively improve the accuracy and precision of genotyping detection.

[0116] Example 4: Detection of Hotspot Mutations in the EGFR Gene

[0117] Epidermal growth factor receptor (EGFR) is one of the main targets for targeted therapy of colorectal cancer and lung cancer. The main forms of EGFR gene mutations found in tumor cells are: (1) point mutations: mainly concentrated in the EGFR-TK region, leading to amino acid variations or premature termination of translation; (2) gene amplification: refers to an increase in the overall copy number of the gene; (3) gene fragment insertion or deletion, mainly seen in three situations: first, a small fragment insertion in exon 20; second, a short sequence deletion in exon 19 - in-frame deletion; and third, the appearance of EGFR mutant variant III, which is due to gene rearrangement or selective mRNA splicing leading to the deletion of exons 2-7 in the extracellular ligand binding region. Based on the above mutation forms, the incomplete protein can activate TK itself and trigger the activation of downstream signaling pathways. This embodiment detects hotspot mutation sites in the EGFR gene (L858R in exon 21, L861Q in exon 21, E746_A750del in exon 19, c.2310_2311insGGT in exon 20, and G719A in exon 18) to examine the effectiveness of the method of the present invention.

[0118] Sample source:

[0119] Negative control A: Human leukocyte DNA

[0120] Positive Sample B: A mixture of human leukocyte DNA and EGFR E746_A750del, EGFR L861Q, EGFR InS2-M4, EGFR L858R, and EGFR G719A mutant plasmids, with a mutation frequency of 10 ng (10%).

[0121] Design and synthesis of primers and hybridization probes modified with phosphate (P) groups at the 1.5' end:

[0122] Table 14

[0123]

[0124]

[0125] Primer purity is HPLC grade.

[0126] 2. PCR amplification reaction:

[0127] Reaction system: 10 μL of 2xPCR mix, 10 μM EGFR E746_A750del upstream and downstream primers

[0128] 0.1 μL of 10 μM EGFR L861Q primers, 1.2 μL of 10 μM EGFR InS2-M4 primers, 0.4 μL of 10 μM EGFR L858R primers, 0.3 μL of 10 μM EGFR G719A primers, 0.6 μL of 10 μM EGFR internal control primers, 0.2 μL of sample, and 5.2 μL of Nuclease-Free Water;

[0129] Amplification reaction program: 95℃ for 5 min, 1 cycle; 95℃ denaturation for 15 sec, 60℃ annealing for 40 sec.

[0130] 50 cycles.

[0131] 3. The product after the reaction was completed was subjected to enzymatic digestion with Lambda Exonuclease.

[0132] Enzyme digestion reaction system:

[0133] Table 15

[0134] Reagent Volume μL PCR product from previous step 20 Lambda Exonuclease buffer 2.5 Lambda Exonuclease 1 Nuclease-Free Water 1.5 Total 25

[0135] Enzyme digestion reaction procedure;

[0136] Table 16

[0137] Temperature Time Cycle Number 37℃ 30 min 1 4℃ Hold 1

[0138] 4. Sample hybridization reaction

[0139] 1) Combine EGFR E746_A750del, EGFR L861Q, EGFR InS2-M4, EGFR

[0140] Mix the magnetic beads corresponding to L858R, EGFR G719A and EGFR internal control with blank magnetic beads (without any probes), add hybridization buffer to 45 μL per reaction tube, place on a super thermostat mixer, and react at the hybridization temperature for 5 minutes at 1600 rpm.

[0141] 2) Then, add 5 μL of the enzyme-digested nucleic acid sample to each reaction tube and perform the hybridization reaction at 1600 rpm for 20 minutes on a super thermostat.

[0142] 3) After the hybridization reaction is complete, place the reaction tube on a magnetic rack and let it stand for 2 minutes. Then, slowly remove the supernatant, add 50 μL of 5 μg / mL SA-PE solution to the reaction tube, and incubate in a super-temperature constant temperature environment to mix.

[0143] The staining reaction was carried out at 1600 rpm for 15 minutes at room temperature using an instrument.

[0144] 4) After the staining reaction, place the reaction tube on a magnetic rack for 2 minutes, remove the supernatant, and then add...

[0145] 150 μL of 1xPBS-T was washed after reacting at 1600 rpm for 30 seconds in a super thermostatic mixer at room temperature (repeated twice).

[0146] 5) Add 200 μL of detection buffer to each reaction tube, and repeatedly pipette at least 10 times to ensure even distribution of the magnetic beads. Detect the results using a fluorescence quantitative analyzer.

[0147] 6) Data processing: Subtract the fluorescence value of the magnetic bead corresponding to NTC from the fluorescence value of each magnetic bead in the test sample, and then subtract the fluorescence value of the magnetic bead corresponding to the negative control from the fluorescence value of the magnetic bead corresponding to the target to obtain the fluorescence difference corresponding to each target;

[0148] Method of the present invention:

[0149] Table 17

[0150]

[0151] Traditional comparison method: PCR products are not digested with enzymes, denatured at 95℃, and other processes remain unchanged.

[0152] Table 18

[0153]

[0154] The mean line graph of the fluorescence difference between the two methods is shown below. Figure 1 .

[0155] Experimental results show that, compared with traditional high-temperature denaturation hybridization, the fluorescence difference obtained by hybridization after enzyme digestion in this invention is increased by 2-3 times, resulting in stronger differentiation from negative samples and making it more conducive to the judgment of positive results, thus improving detection accuracy. Furthermore, the mean CV% is 1.14%, much lower than the 7.05% of the traditional method, indicating that the method of this invention can significantly improve detection precision.

[0156] Example 5: Study on the detection limit of gene point mutation detection

[0157] Test sample:

[0158] Negative control A: Human leukocyte DNA

[0159] Positive sample B: a mixture of human leukocyte DNA and EGFR E746_A750del, EGFR L861Q, EGFR InS2-M4, EGFR L858R, and EGFR G719A mutant plasmids, with a mutation frequency of 10 ng (0.1%).

[0160] Positive sample C: a mixture of human leukocyte DNA and EGFR E746_A750del, EGFR L861Q, EGFR InS2-M4, EGFR L858R, and EGFR G719A mutant plasmids, with a mutation frequency of 10 ng (0.5%).

[0161] Positive sample D: a mixture of human leukocyte DNA and EGFR E746_A750del, EGFR L861Q, EGFR InS2-M4, EGFRL858R, and EGFRG719A mutant plasmids, with a mutation frequency of 10 ng.

[0162] Positive sample E: a mixture of human leukocyte DNA and EGFR E746_A750del, EGFR L861Q, EGFR InS2-M4, EGFR L858R, and EGFR G719A mutant plasmids, with a mutation frequency of 10 ng (10%).

[0163] Positive sample F: a mixture of human leukocyte DNA and EGFR E746_A750del, EGFR L861Q, EGFR InS2-M4, EGFR L858R, and EGFR G719A mutant plasmids, with a mutation frequency of 10 ng 50%. 1. Primer design is the same as in Example 4.

[0164] 2. PCR amplification reaction:

[0165] Reaction system: 10 μL of 2xPCR mix, 10 μM EGFR E746_A750del upstream and downstream primers

[0166] 0.1 μL of 10 μM EGFR L861Q primers, 1.2 μL of 10 μM EGFR InS2-M4 primers, 0.4 μL of 10 μM EGFR L858R primers, 0.3 μL of 10 μM EGFR G719A primers, 0.6 μL of 10 μM EGFR internal control primers, 0.2 μL of sample, and Nuclease-

[0167] 5.2 μL of free water;

[0168] Amplification reaction program: 95℃ for 5 min, 1 cycle; 95℃ denaturation for 15 sec, 60℃ annealing for 40 sec.

[0169] 50 cycles.

[0170] 3. The product after the reaction was completed was subjected to enzymatic digestion with Lambda Exonuclease.

[0171] Enzyme digestion reaction system:

[0172] Table 19

[0173] Reagent Volume μL PCR product from previous step 20 Lambda Exonuclease buffer 2.5 Lambda Exonuclease 1 Nuclease-Free Water 1.5 Total 25

[0174] Enzyme digestion reaction procedure;

[0175] Table 20

[0176] Temperature Time Cycle Number 37℃ 30 min 1 4℃ Hold 1

[0177] 4. Sample hybridization reaction

[0178] 1) Combine EGFR E746_A750del, EGFR L861Q, EGFR InS2-M4, EGFR

[0179] Mix the L858R, EGFR G719A, and EGFR internal control magnetic beads with blank magnetic beads (not coupled with any probe), add hybridization buffer to 45 μL per reaction tube, and place in a super-temperature constant temperature mixer at a speed of [speed not specified].

[0180] React at 1600 rpm at the hybridization temperature for 5 minutes;

[0181] 2) Then, add 5 μL of the enzyme-digested nucleic acid sample to each reaction tube and perform the hybridization reaction at 1600 rpm for 20 minutes on a super thermostat.

[0182] 3) After the hybridization reaction is complete, place the reaction tube on a magnetic rack, let it stand for 2 minutes, then slowly remove the supernatant, add 50 μL of 5 μg / ml SA-PE solution to the reaction tube, and place it in a super constant temperature mixer to perform the staining reaction at room temperature and 1600 rpm for 15 minutes.

[0183] 4) After the staining reaction, place the reaction tube on a magnetic rack for 2 minutes, remove the supernatant, and then add...

[0184] 150 μL of 1xPBS-T was washed after reacting at 1600 rpm for 30 seconds in a super thermostatic mixer at room temperature (repeated twice).

[0185] 5) Add 200 μL of detection buffer to each reaction tube, and repeatedly pipette at least 10 times to ensure even distribution of the magnetic beads. Detect the results using a fluorescence quantitative analyzer.

[0186] 6) Data Processing: The fluorescence difference is obtained by subtracting the fluorescence value of the corresponding magnetic bead for the NTC from the fluorescence value of each magnetic bead in the test sample. Based on the result interpretation criteria, the fluorescence values ​​of the corresponding magnetic beads for different target probes are calculated and interpreted. According to the resolution of the detection platform, a fluorescence difference > 5000 with the negative sample test result is interpreted as positive. The fluorescence difference data is shown in the table below:

[0187] Method of the present invention:

[0188] Table 21

[0189]

[0190]

[0191] Traditional comparison method: PCR products are not digested with enzymes and denatured at 95°C.

[0192] Table 22

[0193]

[0194]

[0195] The test results analysis is as follows:

[0196] Method of the present invention:

[0197] Table 23

[0198]

[0199] Traditional comparison method:

[0200] Table 24

[0201]

[0202]

[0203] Interpretation of positive and negative samples:

[0204] Based on the resolution of the detection platform, a fluorescence difference of >5000 between the target and negative sample detection results is interpreted as positive. The statistics of positive and negative interpretation results are as follows:

[0205] Table 25

[0206]

[0207]

[0208] Experimental results show that, compared with traditional methods, the detection limit of the method of this invention is [insert value here].

[0209] The method of this invention uses 10 ng of 0.5% mutation, while the conventional method uses 10 ng of 2.0% mutation. This method is more sensitive, and...

[0210] The method of this invention detects CV values ​​within 5.00%, while the maximum CV value of the traditional method is 12.56%. The method of this invention has higher precision for detecting low-frequency samples.

[0211] Example 6: Application of Universal Primer Sequences

[0212] Universal primers simplify design, improve efficiency, and reduce costs in multiplex PCR, and are widely used in pathogen detection, genotyping, and expression analysis. This invention introduces universal primers that effectively reduce the number of primers requiring modification, lowering costs, while balancing the amplification efficiency of primers at different sites and improving experimental consistency. This example uses eight common functional genes in the genome—PIK3CA, NRG1, VHL, EGFR, ERBB2, PDGFRA, BRAF, and CEACAM5—as examples to test the feasibility and effectiveness of universal primers in multiplex PCR detection.

[0213] Test sample:

[0214] Positive control: Human leukocyte DNA

[0215] Negative control: Nuclease-Free Water

[0216] 1. Primer design:

[0217] Table 26

[0218]

[0219]

[0220]

[0221] 2. PCR amplification reaction:

[0222] Reaction system: 10 μL 2xPCR mix, 2 μL 10 μM universal primers (forward and reverse), 0.2 μL 100 nM EGFR primers (forward and reverse), 0.2 μL 100 nM PIK3CA primers (forward and reverse), 0.4 μL 100 nM NRG1 primers (forward and reverse), 0.2 μL 100 nM VHL primers (forward and reverse), 0.2 μL 100 nM BRAF primers (forward and reverse), 0.2 μL 100 nM PDGFRA primers (forward and reverse), 0.1 μL 100 nM CEACAM5 primers (forward and reverse), 0.5 μL 100 nM ERBB2 primers (forward and reverse), 1 μL corresponding negative / positive sample, 5 μL Nuclease-Free Water;

[0223] Amplification reaction program: 95℃ for 5 min, 1 cycle; 95℃ denaturation for 15 sec, 60℃ annealing for 30 min, 72℃ extension for 1 min, 3 cycles; 95℃ denaturation for 15 sec, 72℃ annealing and extension for 1 min, 38 cycles.

[0224] 3. The product after the reaction was completed was subjected to enzymatic digestion with Lambda Exonuclease.

[0225] Enzyme digestion reaction system:

[0226] Table 27

[0227] Reagent Volume μL PCR product from previous step 20 Lambda Exonuclease buffer 2.5 Lambda Exonuclease 1 Nuclease-Free Water 1.5 Total 25

[0228] Enzyme digestion reaction procedure;

[0229] Table 28

[0230] Temperature Time Cycle Number 37℃ 30 min 1 4℃ Hold 1

[0231] 4. Sample hybridization reaction

[0232] 1) Mix the magnetic beads corresponding to EGFR, PIK3CA, NRG1, VHL, ERBB2, PDGFRA, BRAF and CEACAM5 with blank magnetic beads (without any probes), add hybridization buffer to 45 μL per reaction tube, and place in a super thermostat mixer to react at the hybridization temperature at 1600 rpm for 5 minutes.

[0233] 2) Then, add 5 μL of the enzyme-digested nucleic acid sample to each reaction tube and perform the hybridization reaction at 1600 rpm for 20 minutes on a super thermostat.

[0234] 3) After the hybridization reaction is complete, place the reaction tube on a magnetic rack, let it stand for 2 minutes, then slowly remove the supernatant, add 50 μL of 5 μg / ml SA-PE solution to the reaction tube, and place it in a super constant temperature mixer to perform the staining reaction at room temperature and 1600 rpm for 15 minutes.

[0235] 4) After staining, place the reaction tube on a magnetic rack for 2 minutes, remove the supernatant, add 150uL of 1xPBS-T, and wash the tube in a super thermostatic mixer at room temperature and 1600rpm for 30 seconds (repeat twice).

[0236] 5) Add 200 μL of detection buffer to each reaction tube, and repeatedly pipette at least 10 times to ensure even distribution of the magnetic beads. Detect the results using a fluorescence quantitative analyzer.

[0237] 6) Data Processing: The fluorescence difference is obtained by subtracting the fluorescence value of the corresponding magnetic bead for the NTC from the fluorescence value of each magnetic bead in the test sample. Based on the result interpretation criteria, the fluorescence values ​​of the corresponding magnetic beads for different target probes are calculated and interpreted. According to the resolution of the detection platform, a fluorescence difference >1000 with the negative sample test result is interpreted as positive. The fluorescence difference data is shown in the table below:

[0238] Table 29

[0239]

[0240]

[0241] Table 30

[0242]

[0243] The results showed that 8-fold PCR amplified using universal sequence primers could detect the presence of genomic DNA as low as 0.2 ng after enzyme digestion and hybridization.

Claims

1. The application of a detection primer that improves the sensitivity and accuracy of liquid phase hybridization detection of multiplex PCR products in the preparation of a detection kit, characterized in that, Includes the following steps: (1) Obtain a single chain; (2) Design specific probes based on multiplex PCR target sequences and primer amplification regions. The specific probe sequences are within the amplification range of upstream and downstream primers and have NH2 modification at the 5' end. (3) Couple the specific probe to a magnetic bead with a unique code; (4) The single strand is mixed with magnetic beads containing the corresponding coding specific probe to carry out the hybridization reaction; (5) Analyze the test results; The method for obtaining a single chain in step (1) is as follows: A universal sequence is added to the 5' end of the specific primers for multiplex PCR. Then, a pair of universal primers with 3' end partial sequences complementary to the universal sequence are designed. One of the universal primers has a phosphate group modified at the 5' end. The specific primers and universal primers are used together to amplify the PCR product with one end phosphorylated on one strand. The enzyme amount in the enzyme digestion reaction system is 1 μL, the reaction time is 30 min, and the reaction volume is 25 μL. For simultaneous detection of the following genes: PIK3CA, NRG1, VHL, EGFR, ERBB2, PDGFRA, BRAF, and CEACAM5; Universal primer sequence: UP-F: TACGACTTCGTCCGAGACACTGACTAGGG, 5'-Biotin; UP-R:GAAGGTGCGACATAACACGTAAGTTCAGCT, 5'-P; The primer and probe sequences for PIK3CA are as follows: PIK3CA-F1-T: TACGACTTCGTCCGAGACACTGACTAGGGTGGAATGATAGTGACTTTAGAATGCC, PIK3CA-R1-T:GAAGGTGCGACATAACACGTAAGTTCAGCTATCTTGAAGAAGTTGATGGAGGG; PIK3CA-P probe: TTTTTTTTTATTTTTTTTTGTTCATGCTTTATGGTTATTAATGTAGCCTC, 5'-NH2; The primer and probe sequences for NRG1 are as follows: NRG1 -F1-T: TACGACTTCGTCCGAGACACTGACTAGGGTTTCCGAAAGCCACTCTGTAATC; NRG1-R1-T:GAAGGTGCGACATAACACGTAAGTTCAGCTGCATGCCTGAGGAAGCTGTTAC; NRG1-P probe: TTTTTTTTATTTTTTTTTAGTTGGGCTGCTGTGCCTACTGTTTTCTACGG, 5'-NH2; The primer and probe sequences for VHL are as follows: VHL-F1-T: TACGACTTCGTCCGAGACACTGACTAGGGAGTTCTGCGTAGTCCCTGCC; VHL-R1-T:GAAGGTGCGACATAACACGTAAGTTCAGCTACACACGGTCGGCTCTTCC; VHL-P probe:TTTTTTTTATTTTTTTTTTTGCATCTGTCAGTCTCCCCAGGAGGAATG, 5'-NH2; The primer and probe sequences for EGFR are as follows: EGFR-F1-T: TACGACTTCGTCCGAGACACTGACTAGGGCTCAACACAGTGGAGCGAATTC; EGFR-R1-T:GAAGGTGCGACATAACACGTAAGTTCAGCTTTCAGTCCGGGTTTTATTTGCATC; EGFR-P probe: TTTTTTTTTATTTTTTTTTACATATTTCCTCTGATGATCTGCAGGTTTTCC, 5'-NH2; The primer and probe sequences for ERBB2 are as follows: ERBB2-F1-T: TACGACTTCGTCCGAGACACTGACTAGGGCGTGCTCATCGCTCACAACC; ERBB2-R3-T:GAAGGTGCGACATAACACGTAAGTTCAGCTTGAGGCTTCGAAGCTGCAG; ERBB2-P probe: TTTTTTTTATTTTTTTTTCCTCAAAGAGCTGGGTGCCTCGCACAATCC, 5'-NH2; The primer and probe sequences for PDGFRA are as follows: PDGFRA-F1-T: TACGACTTCGTCCGAGACACTGACTAGGGGGTTGTGCAGCTGAATTCATCC; PDGFRA-R1-T: GAAGGTGCGACATAACACGTAAGTTCAGCTTTGTTTTCTTCATTTCTGATTTCCAC; PDGFRA -P probe: TTTTTTTTTATTTTTTTTTAGCTCACTTCACTCTCCCCAAAGCATCTCAG; 5'-NH2; The primer and probe sequences for BRAF are as follows: BRAF-F1-T:TACGACTTCGTCCGAGACACTGACTAGGGCAGCAAGCTAGATGCACTCCAAC; BRAF-R1-T: GAAGGTGCGACATAACACGTAAGTTCAGCTTGAAAGGCTAGAAGAGGAAGAAGATG; BRAF -P probe:TTTTTTTTATTTTTTTTTTAGAAACAGAAAAATCAGTTCCGTTCCCCAGA, 5'-NH2; The primer and probe sequences for CEACAM5 are as follows: CEACAM5-F1-T: TACGACTTCGTCCGAGACACTGACTAGGGGTGAAAGAGTGGATGGCAACC; CEACAM5-R1-T:GAAGGTGCGACATAACACGTAAGTTCAGCTGATCAGCAGGGATGCATTGG; CEACAM5-P probe: TTTTTTTTTATTTTTTTTTGGGTAGCTTGTTGAGTTCCTATTACATATCC, 5'-NH2; Sample hybridization reaction 1) Mix the magnetic beads corresponding to EGFR, PIK3CA, NRG1, VHL, ERBB2, PDGFRA, BRAF and CEACAM5 with blank magnetic beads, add hybridization buffer to 45 μL per reaction tube, and place in a super thermostat mixer to react at the hybridization temperature at 1600 rpm for 5 minutes. 2) Then, add 5 μL of the enzyme-digested nucleic acid sample to each reaction tube, and perform the hybridization reaction at 1600 rpm for 20 minutes on a super thermostat. 3) After the hybridization reaction is completed, place the reaction tube on a magnetic rack, let it stand for 2 minutes, then slowly remove the supernatant, add 50 μL of 5 μg / mL SA-PE solution to the reaction tube, and place it in a super constant temperature mixer to perform the staining reaction at room temperature and 1600 rpm for 15 minutes. 4) After staining, place the reaction tube on a magnetic rack for 2 minutes, remove the supernatant, add 150 μL of 1xPBS-T, and wash the tube after 30 seconds of reaction in a super thermostatic mixer at room temperature and 1600 rpm. Repeat twice. 5) Add 200 μL of detection buffer to each reaction tube, and repeatedly pipette at least 10 times to ensure even distribution of the magnetic beads. Detect the results using a fluorescence quantitative analyzer.

Images