Alzheimer's disease risk gene defect nerve cell as well as preparation method and application thereof

By knocking out the ABCA7 gene in pluripotent stem cells and introducing the Ngn2 gene, the Alzheimer's neural cell model was established using CRISPR-Cas9 technology, which solved the problems of time-consuming, high cost and ethical approval of traditional methods, and achieved rapid and low-cost Alzheimer's cell preparation and research.

CN120158429APending Publication Date: 2025-06-17SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311722122.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-14
Publication Date
2025-06-17

AI Technical Summary

Technical Problem

It is difficult for the existing technology to quickly build a humanized Alzheimer's cell model, and the traditional methods are time-consuming, costly, technically difficult, and there are problems of ethical approval and genetic background differences.

Method used

The CRISPR-Cas9 gene editing technology was used to knock out the ABCA7 gene and introduce the Ngn2 gene in the pluripotent stem cell line. The engineered AD risk gene defect pluripotent stem cell line was established through lentiviral vectors, and directed differentiation and culture were carried out to prepare Alzheimer's disease-related nerve cells.

Benefits of technology

It has achieved rapid, large-scale and low-cost preparation of Alzheimer's neural cell models, avoided ethical approval and genetic background differences, reduced technical difficulty, and was suitable for AD pathogenesis research and drug screening.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120158429A_ABST
    Figure CN120158429A_ABST
Patent Text Reader

Abstract

The invention discloses an Alzheimer's disease risk gene defect nerve cell as well as a preparation method and application thereof. The engineered induced pluripotent stem cell comprises an induced pluripotent stem cell which is deficient in ABCA7 gene and expresses a neural differentiation transcription factor in an inducible manner. According to the present invention, the Alzheimer's disease (AD) risk gene defect is introduced into the existing pluripotent stem cell line through the CRISPR and other gene editing means, and the inducible expression neural differentiation transcription factor is introduced through the lentiviral vector so as to establish the engineered AD risk gene defect pluripotent stem cell line, the engineered AD risky gene defect pluripotent stem cell line can be used for rapidly preparing nerve cells with Alzheimer's disease related A beta pathological phenotypes in a large scale by adding antibiotics for induced differentiation and screening culture, and is used for researching AD related pathogenesis and intervention means.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to a nerve cell with Alzheimer's disease risk gene defect, a preparation method thereof and an application thereof Background Art

[0002] Alzheimer's Disease (AD) is the most common type of dementia clinically and the most common chronic neurodegenerative disease among the elderly. Patients show comprehensive cognitive deficits, including memory impairment, inability to take care of themselves, personality and behavior changes, and decline in cognitive ability. The main pathological features of AD patients include deposition of amyloid β (Aβ) and neurofibrillary tangles composed of hyperphosphorylated tau protein. Traditional studies on the mechanism and drug evaluation of AD are mostly based on familial AD (fAD) animal models (such as APP / PS1 and 5XFAD transgenic mice, etc.). Although it has greatly promoted the understanding of the pathological mechanism of AD, however, due to the large differences between humans and mice in terms of genetic background, brain structure, cognitive behavior, and immune system, mouse models can often only partially reflect the clinical pathology and symptom characteristics of AD and are not sufficient to support the drug research and development of AD or fully clarify the related pathogenesis process. In addition, familial AD accounts for only about 2-5% of the AD population, while for sporadic AD (sAD, accounting for more than 95% of AD), except for relatively more research on a few hot spot risk genes such as APOE, TREM2, and SORL1, most sporadic AD risk genes such as ABCA7 generally lack suitable targeted humanized research models, which limits the development of related disease mechanisms and intervention strategies

[0003] Cukier et al. utilized somatic cells from AD patients (African Americans carrying the ABCA7 p.Arg578Alafs frameshift mutation) and cognitively normal individuals with different genetic backgrounds, reprogrammed them to obtain induced pluripotent stem cells (iPSCs), and then obtained cortical neurons and microglia through neural cell directed differentiation technology. Based on this system, they found that neurons differentiated from iPSCs of AD patients carrying the ABCA7 p.Arg578Alafs frameshift mutation produced higher levels of Aβ40 and Aβ42, and the Aβ phagocytosis and clearance ability of microglia was impaired. However, there are the following disadvantages: 1. It is not easy to obtain somatic cells of AD patients carrying specific risk gene mutations, which requires the informed consent of the patients, and the application of clinical resources needs to go through strict ethical and other approvals; 2. The primary culture of patient-derived somatic cells and the reprogramming of somatic cells into iPSCs have certain technical difficulties and take a long time, which is not conducive to rapid disease modeling and research applications; 3. There are individual differences between AD patient-derived and healthy control iPSCs, and a large number of control groups with similar age, gender, health status, etc. are needed to balance the effects of genetic background and individual differences during the technical application process.

[0004] In summary, how to rapidly construct a humanized Alzheimer's disease cell model remains one of the urgent problems to be solved in the field of Alzheimer's disease research. Summary of the Invention

[0005] In view of the deficiencies of the prior art and the actual needs, the present invention provides an Alzheimer's disease risk gene-deficient nerve cell, its preparation method and application, in order to develop a method for batch, large-scale, rapid and efficient preparation of cells with Alzheimer's disease phenotypes.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] In the first aspect, the present invention provides an engineered induced pluripotent stem cell, and the engineered induced pluripotent stem cell includes an induced pluripotent stem cell lacking the ABCA7 gene and inducibly expressing a neural differentiation transcription factor.

[0008] In the present invention, an engineered preparation method and application of rapidly Alzheimer's disease risk gene-deficient nerve cells are developed, including introducing Alzheimer's disease risk gene defects into existing pluripotent stem cell lines by means of gene editing such as CRISPR, and then introducing inducibly expressed neural differentiation transcription factors through lentiviral vectors, thereby establishing an engineered AD risk gene-deficient pluripotent stem cell line. This engineered AD risk gene-deficient pluripotent stem cell line can be induced to differentiate and screened for culture by adding antibiotics, and rapidly and large-scale prepare nerve cells with Alzheimer's disease-related Aβ pathological phenotypes for research on AD-related pathogenesis and intervention means.

[0009] Preferably, the induced pluripotent stem cells include human induced pluripotent stem cells.

[0010] Preferably, the neural differentiation transcription factor includes Ngn2.

[0011] In a second aspect, the present invention provides a nerve cell with Alzheimer's disease risk gene defect, and the nerve cell with Alzheimer's disease risk gene defect is derived from the engineered induced pluripotent stem cells described in the first aspect; the nerve cell with Alzheimer's disease risk gene defect is obtained by subjecting the engineered induced pluripotent stem cells described in the first aspect to directed differentiation culture.

[0012] In a third aspect, the present invention provides a method for preparing the engineered induced pluripotent stem cells described in the first aspect, and the preparation method includes the steps:

[0013] Knock out the ABCA7 gene in the induced pluripotent stem cells and introduce the Ngn2 gene to obtain the engineered induced pluripotent stem cells.

[0014] Preferably, the knocking out method includes the CRISPR-Cas9 method.

[0015] Preferably, the nucleic acid sequence of the gRNA of the CRISPR-Cas9 method includes the sequence shown in SEQ ID NO.1.

[0016] SEQ ID NO.1: ACAGGACGCUGGCUGGCCUA.

[0017] Preferably, the method for introducing the Ngn2 gene includes introducing the pTet-O-Ngn2-puro plasmid.

[0018] In a fourth aspect, the present invention provides the application of the engineered induced pluripotent stem cells described in the first aspect in the preparation of cells with Alzheimer's disease phenotype.

[0019] In a fifth aspect, the present invention provides a method for preparing a nerve cell with Alzheimer's disease risk gene defect, and the method includes:

[0020] Subjecting the engineered induced pluripotent stem cells described in the first aspect to directed differentiation culture to obtain the nerve cell with Alzheimer's disease risk gene defect.

[0021] Preferably, the directed differentiation culture includes:

[0022] Culturing the engineered induced pluripotent stem cells in a medium containing doxycycline to induce the expression of Ngn2, adding puromycin to screen the positively expressed cells, and culturing to obtain a nerve cell with Alzheimer's disease risk gene defect having an Alzheimer's disease phenotype.

[0023] In a sixth aspect, the present invention provides the use of the Alzheimer's disease risk gene-deficient nerve cells described in the second aspect as an Alzheimer's disease model.

[0024] In the present invention, to prepare induced nerve cells based on the deficiency of the risk gene ABCA7, the nerve cell model induced by the ABCA7 gene deficiency can be used as a disease model for studying Alzheimer's disease to analyze the pathogenesis of Alzheimer's disease.

[0025] In a seventh aspect, the present invention provides the use of the engineered induced pluripotent stem cells described in the first aspect or the Alzheimer's disease risk gene-deficient nerve cells described in the second aspect in screening drugs and / or methods for treating Alzheimer's disease.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] The underlying pluripotent stem cells used in the present invention are derived from an established commercial healthy human-derived pluripotent stem cell line, avoiding the links such as patient informed consent and ethical review involved in traditional patient-derived pluripotent stem cells; the present invention uses gene editing technologies such as CRISPR-Cas9 to perform gene editing on commercial pluripotent stem cells to establish pluripotent stem cells with ABCA7 gene deficiency. Compared with the traditional patient-derived pluripotent stem cell technology, it does not need to go through the links of somatic cell sampling, culture expansion, somatic cell reprogramming, etc., saving the modeling time, reducing the cost and technical difficulty; the risk gene ABCA7-deficient pluripotent stem cells established by gene editing technology have the same genetic background as their parental healthy control pluripotent stem cells theoretically except for the editing site, avoiding the influence of genetic background and individual differences between traditional patient- and healthy control-derived iPSCs; through gene editing technologies such as CRISPR-Cas9, most clinical variations can be knocked in or gene knockout can be performed, and it is basically not restricted by the patient's genotype. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1A It is a construction strategy and genotype detection result diagram of induced pluripotent stem cells with functional knockout of the Alzheimer's disease risk gene ABCA7;

[0029] Figure 1B It is a protein level detection result diagram of ABCA7-deficient induced pluripotent stem cells;

[0030] Figure 1C It is a bright field display diagram of ABCA7-deficient induced pluripotent stem cells;

[0031] Figure 2 It is a result diagram of neurons induced from ABCA7-deficient induced pluripotent stem cells;

[0032] Figure 3It is a result graph of the ratio of Aβ42 / 40 in the conditioned medium of neurons induced by ABCA7 deficiency. Detailed implementation manners

[0033] To further elaborate on the technical means and effects adopted by the present invention, the present invention will be further described below in conjunction with examples and drawings. It can be understood that the specific implementation manners described herein are only used to explain the present invention, rather than limiting the present invention.

[0034] For those not specifying specific techniques or conditions in the examples, they shall be in accordance with the techniques or conditions described in the literature in this field or in accordance with the product specifications. For reagents or instruments not indicating the manufacturer, they are all conventional products that can be obtained through regular channels.

[0035] Example 1

[0036] In this example, pluripotent stem cells with Alzheimer's disease risk gene deficiency are prepared.

[0037] (1) Obtaining pluripotent stem cells with AD risk gene deficiency through gene editing technology

[0038] Using the CRISPOR website (http: / / crispor.tefor.net) to design a CRISPR guide RNA (gRNA: ACAGGACGCUGGCUGGCCUA) targeting exon 5 of the Alzheimer's disease risk gene ABCA7, and ligating the gRNA into the modified pSpCas9(BB)-2A-Puro expression vector; transfecting this gene editing vector into iPSCs derived from healthy humans (DYR0100 iPS cells, Cell Bank of the Chinese Academy of Sciences, catalog number: SCSP-1301), as shown in the knockout schematic diagram. PCR and Sanger sequencing identification of the target genomic editing site are performed on the single-cell clones grown after gene editing to obtain iPSCs with ABCA7 genotype knockout (ABCA7 KO), using the unknocked iPSC cells as a control; and detecting the quality of the pluripotent stem cell line with risk gene deficiency through detection of iPSC stemness markers, karyotype detection, microsatellite sequence detection (STR), and protein level detection. Figure 1A For the protein level detection of induced pluripotent stem cells, the results show that the protein level knockout of ABCA7 is successfully achieved in ABCA7-deficient pluripotent stem cells. Figure 1B For the bright field image of induced pluripotent stem cells, the results show that the pluripotent stem cells with the risk gene ABCA7 deficiency maintain a typical stem cell clone morphology. Figure 1C

[0039] (2) Obtaining engineered AD risk gene-deficient iPSCs with inducible expression of the transcription factor Ngn2 through viral transduction​

[0040] Package the Ngn2-GFP-Puro and FUdeltaGW-rtTA plasmids as lentiviruses, add the lentiviruses to StemFlex medium to infect ABCA7-deficient and control iPSCs, change the medium the next day, and continuously culture, passage and amplify or cryopreserve the group of inducible ABCA7-deficient and control iPSCs expressing Ngn2.

[0041] (3) Batch obtain nerve cells with Alzheimer's disease risk gene defects through induced differentiation

[0042] Induce the expression of Ngn2-GFP-Puro by adding doxycycline (Dox, 1-2 μg / mL), screen the positively expressed cells with puromycin (puro, 2-5 μg / mL (selected according to the needs of different cell lines)), and continuously induce and culture with N2 and B27 media for 21-28 days to obtain differentiated and mature neurons with Alzheimer's disease-related phenotypes ( Figure 2 ), and the main components of the medium used in each stage are shown in Table 1.

[0043] Table 1 Main components of the neuron-induced differentiation medium

[0044]

[0045]

[0046] N2 medium: N2 (1X) + DMEM / F12 + NEAA (1X).

[0047] B27 medium: B27 (1X) + Neurobasal + GlutaMAX (1X) + Laminnin (0.2 μg / mL) + AA2P (200 uM).

[0048] The above shows that the present invention can batch-produce and scale up nerve cells with Alzheimer's disease risk gene ABCA7 defects.

[0049] Example 2

[0050] In this example, the ELISA method was used to detect the AD pathological marker Aβ of the ABCA7-deficient nerve cells prepared in Example 1, and the results are as Figure 3As shown, the ratio of Aβ42 / 40 in the cell - secreted supernatant of neurons with the risk gene ABCA7 deficiency (ABCA7KO) is significantly higher than that of its control group (WT), indicating that by directly knocking out the ABCA7 gene in induced pluripotent stem cells and inducing the expression of the transcription factor Ngn2, the present invention can rapidly prepare a cell model with Alzheimer's disease phenotype. Compared with the traditional patient - derived pluripotent stem cell technology, it does not need to go through procedures such as somatic cell sampling, culture expansion, and somatic cell reprogramming, saving the modeling time, reducing the cost and technical difficulty.

[0051] In summary, based on a healthy - human - derived pluripotent stem cell line, the present invention designs a modification strategy. By knocking out the ABCA7 gene and inducing the expression of the transcription factor Ngn2, it can rapidly prepare a nerve cell model with Alzheimer's disease phenotype without going through procedures such as somatic cell sampling, culture expansion, and somatic cell reprogramming, saving the modeling time, reducing the cost and technical difficulty. The prepared cell model has the same genetic background as its parental healthy control pluripotent stem cells except for the editing site in theory, avoiding the influence of genetic background and individual differences between traditional patient - and healthy - control - derived iPSCs. Moreover, through gene - editing technologies such as CRISPR - Cas9, most clinical variations can be knocked in or knocked out, and it is basically not restricted by the patient's genotype, having good application prospects.

[0052] The applicant declares that the present invention uses the above - mentioned embodiments to illustrate the detailed method of the present invention, but the present invention is not limited to the above - detailed method, that is, it does not mean that the present invention must rely on the above - detailed method to be implemented. Those skilled in the art should understand that any improvement of the present invention, the equivalent substitution of each raw material of the product of the present invention, the addition of auxiliary components, and the selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. An engineered induced pluripotent stem cell, characterized in that, The engineered induced pluripotent stem cells include induced pluripotent stem cells lacking the ABCA7 gene and inducibly expressing neural differentiation transcription factors.

2. The engineered induced pluripotent stem cell according to claim 1, characterized in that, The induced pluripotent stem cells include human induced pluripotent stem cells; Preferably, the neural differentiation transcription factor includes Ngn2.

3. A nerve cell with Alzheimer's disease risk gene defect, characterized in that, The Alzheimer's disease risk gene-deficient nerve cells are derived from the engineered induced pluripotent stem cells described in claim 1 or 2; The Alzheimer's disease risk gene-deficient nerve cells are obtained by directionally differentiating and culturing the engineered induced pluripotent stem cells described in claim 1 or 2.

4. A method for preparing the engineered induced pluripotent stem cell according to claim 1 or 2, characterized in that, The preparation method includes the steps: Knock out the ABCA7 gene in the induced pluripotent stem cells and introduce the Ngn2 gene to obtain the engineered induced pluripotent stem cells.

5. The method for preparing the engineered induced pluripotent stem cell according to claim 4, characterized in that, The method for knocking out includes the CRISPR-Cas9 method; Preferably, the nucleic acid sequence of the gRNA of the CRISPR-Cas9 method includes the sequence shown in SEQ ID NO.1; Preferably, the method for introducing the Ngn2 gene includes introducing the pTet-O-Ngn2-puro plasmid.

6. Use of the engineered induced pluripotent stem cell according to claim 1 or 2 in the preparation of cells with Alzheimer's phenotype.

7. A method for preparing a nerve cell with Alzheimer's disease risk gene defect, characterized in that, The method includes: Directionally differentiating and culturing the engineered induced pluripotent stem cells described in claim 1 or 2.

8. The method for preparing a nerve cell with Alzheimer's disease risk gene defect according to claim 7, characterized in that, The directional differentiation culture includes: Culturing the engineered induced pluripotent stem cells in a medium containing doxycycline to induce Ngn2 expression, adding puromycin to screen the positive-expressing cells, and culturing to obtain Alzheimer's disease risk gene-deficient nerve cells with Alzheimer's disease phenotypes.

9. Use of the nerve cell with Alzheimer's disease risk gene defect according to claim 3 in an Alzheimer's disease model.

10. Use of the engineered induced pluripotent stem cell according to claim 1 or 2 or the nerve cell with Alzheimer's disease risk gene defect according to claim 3 in the screening of drugs and / or methods for treating Alzheimer's disease.