Nucleic acid for increasing the serotonin content of tomato and use thereof

Abstract

The application provides a mutant promoter sequence, wherein the mutant promoter sequence has a base mutation relative to a parent promoter, the parent promoter is a promoter derived from a tomato SlTDC1 gene, and the mutant promoter sequence leads to an increase in the content of serotonin in tomato fruits, and has a wide application prospect.

Description

[0001] This application claims priority to Chinese Patent Application No. CN 202410687238X, filed on May 30, 2024, entitled "Nucleic Acid for Increasing Serotonin Content in Tomatoes and Its Application Thereof". The entire contents of the aforementioned Chinese Patent Application are incorporated herein by reference. Technical Field

[0002] This invention belongs to the fields of biotechnology and crop genetics and breeding, and relates to nucleic acids that increase serotonin content and their applications, especially nucleic acids that increase serotonin content in tomatoes and their applications. Background Technology

[0003] Serotonin, also known as 5-hydroxytryptamine (5-HT), is widely found in mammals. As a monoamine inhibitory neurotransmitter, it plays an important role in multiple physiological processes, such as regulating the sleep-wake cycle, promoting slow-wave sleep, maintaining gastrointestinal motility, and maintaining normal mental state. In humans, approximately 5% of serotonin is found in the central nervous system, with the remaining 95% in the gastrointestinal tract. Studies have shown that abnormal serotonin function in the central nervous system can cause various diseases, including mental illness and migraines; while serotonin's inability to function properly in the gastrointestinal tract can lead to irritable bowel syndrome. Given that vegetables, fruits, and seeds are the main sources of serotonin, increasing the serotonin content in food will facilitate more adequate serotonin intake, thereby better leveraging its regulatory role in physiological processes.

[0004] SlTDC1 (Tryptophan decarboxylase 1) is a key rate-limiting enzyme for serotonin synthesis in tomato fruit. This invention introduces a mutant form that favors the upregulation of SlTDC1 expression into the promoter region of the tomato SlTDC1 gene using gene editing technology, thereby significantly increasing the synthesis of SlTDC1 protein and enhancing the activity of tryptophan decarboxylase, the rate-limiting enzyme for serotonin synthesis, resulting in the accumulation of more serotonin in the fruit. Summary of the Invention

[0005] The purpose of this invention is to provide a nucleic acid that can increase the serotonin content of tomatoes and its application.

[0006] On one hand, the present invention provides a mutated promoter sequence, wherein the mutated promoter sequence has a base mutation relative to the parental promoter, wherein the parental promoter is derived from the SlTDC1 gene, and the mutated promoter sequence leads to an increase in tomato serotonin content. The mutated promoter sequence is selected from one or any of the following:

[0007] a. Relative to the parent promoter sequence, there is at least one base mutation at bases 250-269 and / or bases 451-470 corresponding to the sequence shown in SEQ ID No. 1;

[0008] b. A sequence complementary to a;

[0009] Preferably, the base mutation includes base deletion, insertion, or substitution.

[0010] In a preferred embodiment, in step a: there is a continuous mutation of at least one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20) bases at positions 250-269 of the sequence corresponding to SEQ ID No. 1, and simultaneously, there is a continuous mutation of at least one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20) bases at positions 451-470 of the sequence corresponding to SEQ ID No. 1.

[0011] More preferably, the mutated promoter sequence is selected from one or any of the following:

[0012] i. Relative to the parent promoter, bases 260-266 and 454 corresponding to the sequence shown in SEQ ID No. 1 are missing;

[0013] ii. Relative to the parent promoter, bases 455-459 corresponding to the sequence shown in SEQ ID No. 1 are missing;

[0014] iii. Any complementary sequence of i-ii above.

[0015] In one embodiment, the parental promoter is a promoter derived from the tomato SlTDC1 gene.

[0016] In one embodiment, the parent promoter sequence has at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with the sequence shown in SEQ ID No. 1.

[0017] In one embodiment, the parent promoter sequence is shown in SEQ ID No. 1.

[0018] In a preferred embodiment, the mutated promoter sequence is as shown in SEQ ID No. 2 or SEQ ID No. 3.

[0019] On the other hand, the present invention also provides a nucleic acid construct comprising the above-mentioned mutated promoter sequence.

[0020] In one embodiment, the nucleic acid construct further includes an integration element comprising a homologous arm sequence.

[0021] In one embodiment, the 3' end of the nucleic acid construct further includes a terminator, which includes a terminator suitable for plant gene editing.

[0022] The integrative elements in the nucleic acid constructs of this invention enable the integration of sequences located in the integrative elements into the genome of the target host.

[0023] On the other hand, the present invention also provides a vector comprising the mutated promoter sequence of the present invention or the nucleic acid construct thereof.

[0024] In one embodiment, the carrier includes an expression carrier, a shuttle carrier, and an integration carrier.

[0025] In one embodiment, the backbone of the carrier is a pGWB series carrier such as pGWB501, pGWB502, pGWB415, pGWB505, or a pCAMBIA series carrier such as pCAMBIA1300, pCAMBIA1301, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, etc., or a pBI series carrier such as pBI101, pBI121, pBI221, etc.

[0026] In one embodiment, the construct is integrated into the T-DNA region of the vector.

[0027] In one embodiment, the carrier is ring-shaped or linear.

[0028] As used herein, the term "vector" refers to a nucleic acid construct designed for transfer between different host cells. "Expression vector" refers to a vector capable of incorporating and expressing heterologous DNA fragments into foreign cells. Many prokaryotic and eukaryotic expression vectors are commercially available. The selection of a suitable expression vector is well known to those skilled in the art.

[0029] The vector can be of the following types: plasmid, virus, granule, bacteriophage, etc., which are well known to those skilled in the art.

[0030] Preferably, the expression vector in this invention is a plasmid.

[0031] On the other hand, the present invention provides a host cell containing the mutant promoter sequence, the nucleic acid construct, or the vector.

[0032] In one embodiment, the host cell is a eukaryotic cell, such as a yeast cell, animal cell, or plant cell.

[0033] In one embodiment, the host cell is a prokaryotic cell, such as Escherichia coli.

[0034] On the other hand, the present invention provides a method for increasing plant serotonin content, the method comprising the step of introducing the aforementioned mutated promoter sequence into plant cells, plant seeds, plant tissues, plant parts or plants.

[0035] In one embodiment, the plant is selected from the group consisting of monocotyledons, dicotyledons, gymnosperms, or combinations thereof.

[0036] In one embodiment, the plant includes tomato, rice, wheat, soybean, Arabidopsis thaliana, potato, or corn, preferably tomato.

[0037] In one embodiment, the parent promoter is derived from tomatoes, rice, wheat, soybeans, Arabidopsis thaliana, potatoes, or corn, etc., preferably, the parent promoter is derived from tomatoes.

[0038] In a preferred embodiment, the plant serotonin enhancement refers to an increase in the serotonin content in the plant fruit.

[0039] On the other hand, the present invention provides a method for preparing plants with increased serotonin content, the method comprising the step of introducing the above-mentioned mutated promoter sequence into plant cells, plant seeds, plant tissues, plant parts or plants.

[0040] In one embodiment, the promoter is derived from tomatoes, rice, wheat, soybeans, Arabidopsis thaliana, potatoes, or corn, etc., preferably, the promoter is derived from tomatoes.

[0041] In one embodiment, the plant is selected from the group consisting of monocotyledons, dicotyledons, gymnosperms, or combinations thereof.

[0042] In one embodiment, the plant includes tomato, rice, wheat, soybean, Arabidopsis thaliana, potato, or corn, preferably tomato. In a preferred embodiment, the phytoserotonin enhancement refers to an increase in the serotonin content in the plant fruit.

[0043] In one embodiment, the introduction of a mutated promoter sequence according to the present invention includes the step of introducing the mutated promoter sequence by mutating a plant endogenous promoter sequence (or, referred to as, parental promoter sequence).

[0044] In one implementation, the mutated promoter sequence can be introduced into a plant using gene editing methods.

[0045] In a preferred embodiment, the gene-editing tool includes CRISPR, TALEN, and ZFN. Furthermore, the method further includes a step of isolating the gene-editing tool.

[0046] In one implementation, the gene editing is performed using CRISPR technology.

[0047] In one embodiment, the Cas enzyme used in the CRISPR technology is selected from Cas9, Cas12 (e.g., Cas12a, Cas12b, Cas12i, Cas12j) and other Cas enzymes.

[0048] In one embodiment, introducing the mutated promoter sequence includes expressing the mutated promoter sequence in plant cells, plant seeds, plant tissues, plant parts, or plants, or integrating the mutated promoter sequence into the plant genome for expression.

[0049] On the other hand, the present invention provides the application of the above-mentioned mutated promoter sequence, nucleic acid construct, vector or host cell in the preparation of plants with increased serotonin content.

[0050] On the other hand, the present invention provides the application of the aforementioned mutated promoter sequences, nucleic acid constructs, vectors, or host cells in the preparation of reagents or kits for preparing plants with increased serotonin levels. In a preferred embodiment, the plant is tomato.

[0051] On the other hand, the present invention also provides a method for preparing trait-improved plants or a method for improving the traits of plants, wherein the trait-improved plant is a plant obtained by hybridizing the plant prepared by the above method with other plants. In a preferred embodiment, the trait improvement is an increase in serotonin content; in a preferred embodiment, the trait improvement is an increase in serotonin content in the plant fruit.

[0052] Unless otherwise defined, the technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0053] As used herein, the term “operable link” is intended to mean that the nucleotide sequence of interest is linked to one or more regulatory elements in a manner that allows the expression of that nucleotide sequence (e.g., in an in vitro transcription / translation system or in the host cell when the vector is introduced into the host cell).

[0054] The term "promoter" has a meaning well-known to those skilled in the art, referring to a non-coding nucleotide sequence located upstream of a gene that initiates the expression of a downstream gene. As illustrated herein, when a promoter and a target nucleic acid are operatively linked, the promoter can initiate the expression of the target nucleic acid.

[0055] The term "vector" refers to an element that allows the vector to integrate into the host cell's genome or to replicate autonomously within the cell independently of the genome. The vector may contain any element that guarantees self-replication. It typically carries a gene that is not part of the cell's central metabolism and is usually in the form of double-stranded DNA. The choice of vector generally depends on its compatibility with the host cell to which it is to be introduced. If a vector is used, the choice of vector depends on methods well-known to those skilled in the art for transforming host cells. For example, plasmid vectors may be used.

[0056] As used herein, the term "identity" refers to the sequence matching between two polypeptides or two nucleic acids. Two compared sequences are identical at a position when the same base or amino acid monomeric subunit occupies the same location (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine). The "percentage identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared × 100. For example, if six out of ten positions in two sequences match, then the two sequences have 60% identity. For example, the DNA sequences CTGACT and CAGGTT share 50% identity (three out of six positions match). Typically, two sequences are compared to produce the maximum identity. Such comparisons can be made using methods readily available, for example, computer programs such as the Align program (DNAstar, Inc.) Needleman et al. (1970) J. Mol. Biol. 48: 443-453. The percentage identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl Biosci., 4:11-17 (1988)) integrated into the ALIGN program (version 2.0), which uses a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. Alternatively, the percentage identity between two amino acid sequences can be determined using the Needleman and Wunsch algorithm (J MoIBiol. 48:444-453 (1970)) in the GAP program integrated into the GCG software package (available at www.gcg.com), which uses a Blossum 62 matrix or a PAM250 matrix, along with gap weights of 16, 14, 12, 10, 8, 6, or 4, and length weights of 1, 2, 3, 4, 5, or 6.

[0057] Homology or identity can be calculated using known methods including, but not limited to, the following: Computational Molecular Biology (edited by Lesk, AM), Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (edited by Smith, DW), Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (edited by Griffin, AM and Griffin, HG), Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (edited by von Heinje, G.), Academic Press (1987); and Sequence Analysis Primer (edited by Gribskov, M. and Devereux, J.), Stockton. Stockton Press, New York (1991).

[0058] The specific nucleotide (base) positions (numbers) of the promoter described in this invention are determined by aligning the target nucleotides using standard sequence alignment tools, such as the Smith-Waterman algorithm or the CLUSTALW2 algorithm. The sequence is considered aligned when the alignment score is the highest. The alignment score can be calculated according to the method described in Wilbur, WJ and Lipman, DJ (1983) Rapid similarity searches of nucleic acid and protein data banks. Proc. Natl. Acad. Sci. USA, 80:726-730. In the ClustalW2 (1.82) algorithm, the default parameters are preferably used: protein nick opening penalty = 10.0; protein nick extension penalty = 0.2; protein matrix = Gonnet; protein / DNA end gap = -1; protein / DNA GAPDIST = 4. The AlignX program (part of the vectorNTI group) is preferred, with default parameters suitable for multiple alignments (gap opening penalty: 10og gap extension penalty 0.05).

[0059] The term "plant tissue" or "plant part" includes plant cells, protoplasts, plant tissue cultures, plant callus, plant masses, as well as plant embryos, pollen, ovules, seeds, leaves, stems, flowers, branches, seedlings, fruits, kernels, spikes, roots, root tips, anthers, etc.

[0060] The term “plant cell” should be understood as any cell that is derived from or found in a plant and is capable of forming, for example: undifferentiated tissues such as callus, differentiated tissues such as embryos, components of a plant, or seeds.

[0061] The term "gene editing" technology includes CRISPR, TALEN, and ZFN technologies. CRISPR technology refers to clustered, regularly interspaced short palindromic repeats derived from the microbial immune system. Gene editing tools include guide RNA and Cas proteins (such as Cas9, Cpf1, and Cas12b). The gene editing tools referred to in TALEN technology are restriction enzymes capable of cleaving specific DNA sequences, comprising a TAL effector DNA-binding domain and a DNA-cleaving domain. The gene editing tools referred to in ZFN technology are also restriction enzymes capable of cleaving specific DNA sequences, comprising a zinc finger DNA-binding domain and a DNA-cleaving domain. Those skilled in the art know that by constructing nucleotides and other regulatory elements encoding gene editing tools into suitable vectors and then transforming cells, intracellular genome editing can be achieved, including gene knockout, insertion, and base editing.

[0062] This invention provides a mutated promoter sequence. Tomatoes containing the mutated promoter sequence of this invention have significantly higher serotonin content compared to wild-type tomatoes, and have broad application prospects.

[0063] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings and examples. However, those skilled in the art will understand that the following drawings and examples are for illustrative purposes only and are not intended to limit the scope of the invention. Various objects and advantages of the present invention will become apparent to those skilled in the art from the following detailed description of the drawings and preferred embodiments.

[0064] The sequence information involved in this application is as follows:

[0065] Attached Figure Description

[0066] Figure 1 Schematic diagram of the gene editing vector;

[0067] Figure 2 A comparison of serotonin content between gene-edited plants and wild-type plants in the E0 generation;

[0068] Figure 3 A comparison of serotonin content between gene-edited plants and wild-type plants in the E1 generation;

[0069] Figure 4 A comparison of serotonin content between gene-edited plants and wild-type plants in the E2 generation. Detailed Implementation

[0070] The following examples are for illustrative purposes only and are not intended to limit the invention. Unless otherwise specified, the experiments and methods described in the examples are generally performed according to conventional methods well known in the art and described in various references. For example, conventional techniques such as immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant DNA used in this invention can be found in Sambrook, Fritsch, and Maniatis, *Molecular Cloning: A Laboratory Manual*, 2nd edition (1989); *Current Protocols in Molecular Biology* (edited by FM. Ausubel et al., (1987)); and the *Methods in Enzymology* series (academic publishing company): *PCR 2: A PRACTICAL*. APPROACH (edited by MJ MacPherson, BD Hames and GR Taylor (1995)), Harlow and Lane (1988) Antibodies, A Laboratory Manual, and Animal Cell Culture (edited by R.R. Freshney (1987)).

[0071] Furthermore, unless specific conditions are specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products. Those skilled in the art will understand that the examples are described by way of illustration and are not intended to limit the scope of protection claimed by the invention. All disclosures and other references mentioned herein are incorporated herein by reference in their entirety.

[0072] The present invention will be further described below with reference to embodiments. The following description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make equivalent modifications to the disclosed technical content to create equivalent embodiments. Any simple modifications or equivalent changes made to the following embodiments based on the technical essence of the present invention without departing from the scope of the invention are all within the protection scope of the present invention.

[0073] Example 1. Target design and vector construction

[0074] The genome sequence of the tomato SlTDC1 (Solyc07g054860) gene was obtained from the NCBI website (https: / / www.ncbi.nlm.nih.gov). Targets were selected and designed for the promoter region. The nucleotide sequence of the parent promoter of the tomato SlTDC1 gene is shown in SEQ ID No. 1.

[0075] In this embodiment, the promoter region of the SlTDC1 gene in tomato is edited using Cas9 and sgRNA targeting the SlTDC1 promoter region. The specific operation method can be performed according to conventional methods in the art. A schematic diagram of the constructed gene editing vector in this embodiment is shown below. Figure 1 As shown, AtU6 is the U6 promoter, CaMV 35s is the Cas9 protein promoter, NOS and PolyA are terminators, SV40NLS and NLS are nuclear localization signals, 2x35s is the HygR protein promoter, and HygR is the resistance selection gene. The vector construction can also refer to the reference ("High-efficiency CRISPR / Cas9 multiplex geneediting using the glycine tRNA-processing system-based strategy in maize", Weiwei Qi et al., BMC Biotechnology, 2016). In this embodiment, Cas9 is plant codon-optimized Cas9. In other embodiments, Cas9 optimized in other ways can also be used.

[0076] Specifically, in this embodiment, sgRNAs are designed using target design (http: / / skl.scau.edu.cn / targetdesign / ), and the gRNAs (gRNA1 and gRNA2) targeting the promoter region are as follows:

[0077] gRNA1; AACTCCATCTGATTAGCACC (corresponding to positions 250-269 of the sequence shown in SEQ ID No. 1);

[0078] gRNA2: TTCTAAAATTCTTTTCTCTA (corresponding to positions 451-470 of the sequence shown in SEQ ID No. 1);

[0079] Two target gRNAs, gRNA1 and gRNA2, were combined and incorporated into a vector. The two gRNAs were separated by glycine-containing tRNA. The constructed final vector P3636 was transformed into competent E. coli Trans-T1 cells, plated on Kans plates, and 8 colonies were cultured in liquid for 2 hours. PCR was performed to detect the bacterial culture, and 2 correct single clones were selected for further analysis.

[0080] Select the correctly sequenced single clones for propagation, preservation, and plasmid extraction. Transform them into Agrobacterium EHA105, select 5 single colonies for culture, and preserve them for later use after PCR testing confirms their correctness.

[0081] In other embodiments, other Cas enzymes can be used to edit the promoter region described above. For example, the mutant protein BC26312 of Cas12is (also known as Cas-SF01) disclosed in Chinese Patent CN116004573B can be used to design the following gRNAs (gRNA-a and gRNA-b):

[0082] gRNA-a: TTT(PAM)AACTCCATCTGATTAGCACC;

[0083] gRNA-b: TTA(PAM)GAGAAAAGAATTTTAGAAAG.

[0084] Example 2. Genetic transformation and identification of positive seedlings

[0085] The Agrobacterium containing the target vector obtained in Example 1 was activated, cultured, and used to infect and transform tomato cotyledons. Molecular detection was performed on the differentiated E0 generation tomatoes, and the serotonin content of the tomato fruits was detected. Based on the sequencing results, the editing types of the E0 generation promoters are shown in the table below:

[0086]

[0087] The serotonin content of E0 generation gene-edited plants is as follows: Figure 2 As shown, wild-type plants with unedited promoters served as a control. Figure 1 (As shown in CK), the experimental results were normalized (with the serotonin content of the wild type as 1, and the serotonin content of the edited plants relative to the wild type plants). Five fruits were taken from each plant to determine the serotonin content. The average serotonin content of the edited lines SL03 and SL06 was significantly higher than that of the wild type plants. The average serotonin content of the edited line SL03 was about 3.6 times that of the wild type plants, and the average serotonin content of the edited line SL06 was about 5 times that of the wild type plants. The average serotonin content of the edited line SL07 was significantly lower than that of the wild type plants.

[0088] Edited lines SL03 and SL06 were selected for E1 generation planting, and the editing type of the E1 generation and the serotonin content in tomato fruits were detected. The editing types of the E1 generation are shown in the table below.

[0089]

[0090] The E0 generation editing type was largely preserved in the E1 generation, with the serotonin content of E1 generation gene-edited plants as follows: Figure 3 As shown, wild-type plants with unedited promoters served as a control. Figure 3 (as shown in CK), the experimental results were homogenized (with the serotonin content of the wild type as 1, and the serotonin content of the edited plants relative to the wild type plants). Five fruits from each line were taken for serotonin content determination. The average serotonin content of the edited lines SL03-3 and SL06-1 was significantly higher than that of the wild type control group. The average serotonin content of the edited line SL03-1 was basically the same as that of the wild type control group. The edited lines SL03-3 and SL06-1 were planted in the E2 generation.

[0091] Edited lines SL03-3 and SL06-1 were selected for E2 generation cultivation. The editing type of the E2 generation and the serotonin content in tomato fruits were measured. The editing types of the E2 generation are shown in the table below.

[0092]

[0093] The serotonin content of E2 generation gene-edited plants is as follows: Figure 4 As shown, wild-type plants with unedited promoters served as a control. Figure 4The experimental results were normalized (with the wild-type serotonin content as 1, and the serotonin content of the edited plants relative to the wild-type plants). Five fruits from each line were taken for serotonin content determination. The average serotonin content of the edited lines SL03-3-25 (the promoter sequence of the SlTDC1 gene is shown in SEQ ID No. 2) and SL06-1-23 (the promoter sequence of the SlTDC1 gene is shown in SEQ ID No. 3) was significantly higher than that of the wild-type control group. The average serotonin content of the edited line SL03-3-25 was about 12.8 times that of the wild-type control group, and the average serotonin content of the edited line SL06-1-23 was about 9.5 times that of the wild-type control group.

[0094] Based on the above results, it can be seen that when the promoter editing type is the same as that of the edited strain SL03-3-25 (with the deletion of bases 260-266 relative to the sequence shown in SEQ ID No. 1, and the deletion of base 454 relative to the sequence shown in SEQ ID No. 1), or when the promoter editing type is the same as that of the edited strain SL06-1-23 (with the deletion of bases 455-459 relative to the sequence shown in SEQ ID No. 1), the serotonin content in tomato fruit will be significantly increased.

[0095] Although specific embodiments of the invention have been described in detail, those skilled in the art will understand that various modifications and variations can be made to the details based on all the published teachings, and all such changes are within the scope of protection of the invention. The entire scope of the invention is given by the appended claims and any equivalents thereof.

Claims

1. A mutated promoter sequence, wherein the mutated promoter sequence has a base mutation relative to a parental promoter, wherein the parental promoter is derived from the tomato SlTDC1 gene, characterized in that, The mutated promoter sequence leads to increased tomato serotonin levels, and the mutated promoter sequence is selected from one of the following i-iii: i. Relative to the parent promoter, bases 260-266 and 454 corresponding to the sequence shown in SEQ ID No. 1 are missing; ii. Relative to the parent promoter, bases 455-459 corresponding to the sequence shown in SEQ ID No. 1 are missing; iii. Any complementary sequence of i-ii above; The sequence of the parent promoter is shown in SEQ ID No.

1.

2. A nucleic acid construct, characterized in that, The nucleic acid construct includes the mutated promoter sequence as described in claim 1.

3. A carrier, characterized in that, The vector contains the mutated promoter sequence of claim 1 or the nucleic acid construct of claim 2.

4. A host cell, characterized in that, The host cell contains the mutated promoter of claim 1, the nucleic acid construct of claim 2, or the vector of claim 3.

5. A method for increasing serotonin content in plants or a method for preparing plants with increased serotonin content, the method comprising the step of introducing the mutated promoter sequence of claim 1 into plant cells, plant seeds, plant tissues, plant parts, or plants; wherein the plant is tomato.

6. The method as described in claim 5, characterized in that, The serotonin content in the plant fruit is increased.

7. The method as described in any one of claims 5-6, characterized in that, The introduction of the mutated promoter sequence according to claim 1 includes the step of mutating a plant endogenous promoter sequence to introduce the mutated promoter sequence.

8. The method as described in claim 7, characterized in that, The mutated promoter sequence is introduced into the plant through gene editing.

9. The method as described in claim 7, characterized in that, The mutated promoter sequence of claim 1 further includes the step of expressing the mutated promoter sequence in plant cells, plant seeds, plant tissues, plant parts, or plants.

10. The use of the mutated promoter sequence of claim 1, the nucleic acid construct of claim 2, the vector of claim 3, or the host cell of claim 4 in the preparation of plants with increased serotonin content; or, in the preparation of a reagent or kit for preparing plants with increased serotonin content; wherein the plant is tomato.

11. A method for preparing plants with improved traits or for improving the traits of plants, characterized in that, The improved plant is a plant obtained by hybridizing the plant prepared by the method of claim 5 with other plants; the improved trait is an increase in serotonin content; the plant is tomato.

12. The method as described in claim 11, characterized in that, The improved trait is achieved by increasing the serotonin content in the plant fruit.

Images