A molecular marker related to the seventh sternum length of honeybee and its application in the improvement of honeybee germplasm resources

Abstract

The present application relates to the field of animal breeding technology, and particularly relates to a molecular marker related to the length of the seventh sternum of honeybees and application thereof in improvement of the germplasm resources of honeybees. The molecular marker comprises a nucleotide sequence shown as SEQ ID NO. 1, wherein the 170th nucleotide is a polymorphic site, and the polymorphism is A or G. Based on the results of whole genome association analysis of sequencing data of honeybees, the present application screens a SNP site related to the length of the seventh sternum of honeybees, and develops a corresponding molecular marker based on the SNP site. The polymorphism of the molecular marker detected in honeybees can reflect the length of the seventh sternum of honeybees, and thus the molecular marker can be used for breeding high-quality honeybee varieties.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of animal breeding technology, and particularly relates to a molecular marker related to the length of the seventh sternum of honeybees and application thereof in improvement of the germplasm resources of honeybees. BACKGROUND

[0002] The Chinese honeybee (Apis cerana cerana Fabricius) Apis cerana has the advantages of strong disease resistance, strong adaptability, cold and heat tolerance, etc. At the same time, it also forms rich local resource types in various regional environments, and shows different morphological characteristics, biological characteristics and production performance. Effective evaluation of the morphological traits of the Chinese honeybee is an important means for mining, protecting, identifying and utilizing the bee species resources, and is also a necessary method for evaluating the performance of the bee species in the bee industry production.

[0003] Morphological markers are currently commonly used for identification and performance evaluation of bee species, and have the advantages of low cost and simple operation, etc. However, due to the influence of external interference factors such as nutritional conditions during development, it is difficult to apply them to the Chinese honeybee. At the same time, morphological markers also have the defects of poor operability and non-uniform standards. The seventh sternum is located in the abdomen of the honeybee, and two wax mirrors are distributed on it for secreting beeswax. The length of the seventh sternum indirectly reflects the ability of the honeybee to secrete beeswax, and indirectly reflects the nesting ability of the honeybee. Developing a molecular marker related to the length of the seventh sternum is conducive to the cultivation of high-quality honeybee species. SUMMARY

[0004] In order to solve the problems in the prior art, the present application provides a molecular marker related to the length of the seventh sternum of honeybees and application thereof in improvement of the germplasm resources of honeybees.

[0005] In a first aspect, the present application provides a molecular marker related to the length of the seventh sternum of honeybees, wherein the molecular marker comprises a nucleotide sequence as shown in SEQ ID NO. 1, and the 170th nucleotide of the nucleotide sequence is a polymorphic site, and the polymorphism is A or G.

[0006] The nucleotide sequence as shown in SEQ ID NO. 1 is as follows:

[0007] CATCACGTCAAATTGCCAACCCCTCTCCCCGCCTCTTCCCCTATTAGTGGCGCAAAGAAAATCGCCTCGGGCTGTGTAATTAATTTCGAATCGGGGCTTGCTTTCCCACACGCTTGCGCGCCCTTGTTGATAAATTGTTAATACATTTGTTTAGTTTTTTCCATCCTCTAATTTGTCTCTTCACCAATCGCTTGGGACGAGGATCGAAAGTTTTCACTATTTTATTATTCATTATTATATTAGGATGTCGAAATAATATTCCGTGACTGTTTTAGAAATCACGGTTGTATTAATTTTTGCGACGATTTCTATTCACTGTTTCCATTAGGAATTTTTATATTGAAAACTTCGTTTTCGACAAACGAATATCTCGTCGTGCTGAAGGGCGATAATCAAACGA.

[0008] In a second aspect, the present application provides a primer pair for amplifying the molecular marker, comprising the following nucleotide sequences:

[0009] F1: 5'-CAAGCGATTGGTGAAGAGACAAATT-3',

[0010] F2: 5'-CAAGCGATTGGTGAAGAGACAAATC-3',

[0011] R: 5'-GCTTGCTTTCCCACACGCTT-3'.

[0012] Further, the F1 and F2 respectively carry different fluorescent markers (also called fluorescent labels), which include one or more of FAM, TET, HEX, ROX, Cy3, Cy5, Alexa Fluor, SYBR Green, DAPI, FITC or Texas Red.

[0013] For example, F1 is connected with GAAGGTGACCAAGTTCATGCT (FAM) at 5', and F2 is connected with GAAGGTCGGAGTCAACGGATT (HEX) at 5'.

[0014] In a third aspect, the present application provides a kit comprising the molecular marker or the primer pair.

[0015] In a fourth aspect, the present application provides use of the molecular marker, or the primer pair, or the kit in identifying the seventh tergite length trait of the honeybee.

[0016] The present application further provides use of the molecular marker, or the primer pair, or the kit in breeding honeybees with high nectar collecting ability, improvement of the germplasm resource of the honeybee, or molecular marker assisted breeding of the honeybee.

[0017] Further, the use comprises:

[0018] For a honeybee to be tested, detecting polymorphism of the aforementioned molecular marker, and judging the seventh tergite length trait of the honeybee to be tested according to the detection result.

[0019] Further, the detection comprises one or more of gene sequencing, PCR, or probe detection.

[0020] Further, the PCR uses the aforementioned primer pair, and the PCR amplification procedure comprises:

[0021] 95℃ pre-denaturation for 5-10 min;

[0022] 92-96℃ denaturation for 30-60 s, 62-65℃ annealing for 30-60 s, 70-74℃ extension for 30-60 s, 10-15 cycles, and the annealing temperature decreases by 0.4-0.6℃ each time;

[0023] 93-96℃ denaturation for 30-60 s, 56-60℃ annealing for 30-60 s, 70-74℃ extension for 30-60 s, 25-35 cycles;

[0024] 70-74℃ repair extension for 10-15 min.

[0025] Further, the PCR amplification system comprises, with a total system of 25 μL:

[0026] 1-2 μL of template DNA, 1-2 μL of upstream primer, 1-2 μL of downstream primer, 1-2 μL of Dntp mix, 2-4 μL of 10×TaqBuffer, 0.2-0.4 μL of Taq enzyme, and the rest is water.

[0027] Further, the judging the seventh tergite length trait of the honeybee to be tested according to the detection result comprises:

[0028] The honeybee with the detection result of A / A has a shorter seventh tergite length than the honeybee with the detection result of G / G in terms of polymorphism of the aforementioned molecular marker.

[0029] The seventh sternum is located on the abdomen of the honeybee, is the smallest sternum of the abdomen of the honeybee, and is distributed with two wax mirrors for secreting beeswax. The length of the seventh sternum reflects the lower limit of the ability of the honeybee to secrete beeswax and indirectly reflects the ability of the honeybee to build nests.

[0030] The present application has the following beneficial effects:

[0031] Based on the whole genome correlation analysis result of Apis cerana, the present application screens a SNP site (Chr9_10812095) related to the length of the seventh sternum of the honeybee, develops a corresponding molecular marker based on the SNP site, and realizes the identification of the length of the seventh sternum of the honeybee through the detection result of the molecular marker. The molecular marker can be further used for the detection of the honey collecting ability of the honeybee, and then used for the cultivation of high-quality honeybee varieties. BRIEF DESCRIPTION OF DRAWINGS

[0032] In order to more clearly illustrate the technical solutions in the present application or prior art, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, the drawings in the following description are some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0033] Figure 1 is the comparison result of the length of the seventh sternum of the honeybee with different genotypes of the SNP site Chr9_10812095 provided in embodiment 2 of the present application.

[0034] Figure 2 is the amplification result of the primer pair provided in embodiment 3 of the present application; the left band is Marker, and the right three bands are amplification products. DETAILED DESCRIPTION

[0035] In order to make the purpose, technical scheme and advantages of the present application more clear, the technical scheme in the present application will be described clearly and completely in the following combined with the drawings in the present application. Obviously, the described embodiments are some embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor belong to the protection scope of the present application.

[0036] The experimental methods involved in the following embodiments can be realized by using conventional experimental methods in the art if not particularly limited, for example, can refer to the experimental manual in the art or refer to the instruction manual of the manufacturer.

[0037] The experimental materials and reagents involved in the following embodiments can be commercially available if not particularly limited.

[0038] Embodiment 1

[0039] The application provides a screened SNP site (Chr9_10812095), and a screening process of the SNP site is as follows:

[0040] 1. The application is based on 110 Chinese honeybee samples, and the length of the seventh tergum is detected. The thoracic tissue genomic DNA of the worker bees after dissection is extracted, and then a library construction is carried out by using a Truseq Nano DNA HT kit (Illumina, USA). The DNA is randomly broken into 350 bp fragments, and the DNA library is obtained through the steps of end repair, poly A tail addition, sequencing adapter addition, amplification, purification and the like. The insert size of the library is detected by using an Agilent 2100, and the effective concentration of the library is accurately quantified by using a qPCR method. The DNA library construction is completed after the quality meets the standard.

[0041] 2. Genomic sequencing, alignment and SNP identification: after the sample library construction is successful, the sample library is subjected to genomic sequencing based on an Illumina Hiseq PE150 platform (Illumina, USA). During the sequencing process, low-quality reads are deleted to ensure the result quality [quality control standard: deleting reads containing more than 10% unknown nucleotides, deleting reads containing adapter sequences, and deleting reads containing more than 50% low-quality (phred quality < 5) base numbers in the sequencing process]. Finally, more than 4.5G high-quality paired-end reads clean reads of a single honeybee sample are generated, and Q20 and Q30 are more than 90% and 85%, respectively.

[0042] 3. The obtained high-quality paired-end reads clean reads are aligned to a reference genome Apis cerana (Genbank accession number: PRJNA738447) by using BWA 0.7.8 software. The alignment results are removed by using SAMTOOLS 1.15 software, the average alignment rate of the population sample is ensured to be more than 95%, and the average sequencing depth of the genome is more than 20X.

[0043] 4. A Bayesian model in SAMTOOLS 1.15 software is used for detecting population SNPs, high-quality SNPs are screened out according to the quality control standard [deleting SNPs with a sequencing error rate of more than 1% (Q20 quality control), deleting SNPs with a base number interval of less than 5 between adjacent SNPs, and deleting SNPs with a coverage depth exceeding 1 / 3-5 times of the average depth], and the detected SNPs are annotated by using ANNOVAR 20130520 software, so as to identify exonic regions, intronic regions, variable splicing sites, upstream and downstream regions of genes, intergenic regions, and distinguish synonymous SNPs and non-synonymous SNPs.

[0044] 5. Genome-wide association analysis: genome-wide association studies (GWAS) were carried out based on mrMLM 1.3 software to determine the association between the seventh sternum length trait and SNP sites, and the SNP quality control standard refers to MAF>5%, and the model selection is a multi-site random mixed linear model.

[0045] 6. The analysis results are as follows:

[0046] Table 1 Association between the seventh sternum length phenotype of the honeybee and SNPs

[0047]

[0048] The present application screens a plurality of SNP sites associated with the seventh sternum length trait, wherein the site Chr9_10812095 (located at position 10812095 of chromosome 9 of the honeybee, and the polymorphism is A / G) is more significant. Based on the site, a molecular marker is developed, which is located at position 170 of the nucleotide sequence shown in SEQ ID NO. 1, and the polymorphism is A / G.

[0049] Example 2

[0050] The present application selects 107 Apis cerana samples to carry out verification work, verifies the association between the SNP site involved in example 1 and the seventh sternum length of the honeybee, and specifically sequences the 107 Apis cerana, and measures the seventh sternum length of the 107 honeybees by using a microscopic measurement system to obtain the seventh sternum length data and SNP data of the 107 honeybees.

[0051] The present application further groups according to the genotype type of the SNP site, and uses SPSS 16.0 software to analyze the difference significance of the seventh sternum length data of different groups, so as to compare whether there is a difference in the seventh sternum length of different genotypes.

[0052] Finally, 57 Apis cerana show A / A genotype, 39 Apis cerana show A / G genotype, and 11 Apis cerana show G / G genotype, and through Student-Newman-Keuls, Tukey HSD, LSD, Duncan data analysis, A / A genotype and G / G genotype show significant difference (P<0.05), as shown in Figure 1 and Tables 2 and 3, the seventh sternum length of the Apis cerana with A / A genotype is significantly shorter than that of the Apis cerana with G / G genotype.

[0053] Table 2 Comparison of the seventh sternum length of individuals with different genotypes at the Chr9_10812095 site of Apis cerana

[0054]

[0055] * express P <0.05, the difference is significant.

[0056] Table 3. Comparison of seventh abdominal plate length among individuals with different genotypes at the Ch9_10812095 locus in Honeybee.

[0057]

[0058] Example 3

[0059] This invention develops primer pairs and KASP primer pairs for the above-mentioned SNP sites, as detailed below:

[0060] 1. Primer pairs are as follows:

[0061] Upstream primer: 5'-CATCACGTCAAATTGCCAAC-3',

[0062] Downstream primer: 5'-TCGTTTGATTATCGCCCTTC-3'.

[0063] 2. The PCR system is as follows:

[0064] Table 4 PCR System

[0065]

[0066] The PCR procedure is as follows:

[0067] Table 5 PCR Procedure

[0068]

[0069] 3. Test Results

[0070] The results are as follows Figure 2 Apis cerana Figure 1 Figure 2 Figure As shown in the results, the electrophoretic bands of the amplified DNA fragments are clear, bright, and free of impurities, indicating that the primers, amplification system, and program are highly specific and can achieve the purpose of detecting the target SNP site.

[0071] For the amplified product above, gene sequencing can be used to detect the genotype of the 170-nucleotide sequence, thereby determining whether the bee's genotype at that locus is A / A, A / G, or G / G. Based on the identification results, it can be determined whether the bee's seventh abdominal plate is long or short. Based on this characteristic, in actual bee breeding, bees with a specific length of the seventh abdominal plate can be selected to cultivate bees with high honey-collecting efficiency.

[0072] 4. The present invention further provides KASP primer pairs, including:

[0073] F1: 5'-CAAGCGATTGGTGAAGAGACAAATT-3',

[0074] F2: 5'-CAAGCGATTGGTGAAGAGACAAATC-3',

[0075] R: 5'-GCTTGCTTTCCCACACGCTT-3'.

[0076] F1 is connected with GAAGGTGACCAAGTTCATGCT (FAM) at 5', and F2 is connected with GAAGGTCGGAGTCAACGGATT (HEX) at 5'.

[0077] Before actual detection, the primer pair is labeled with fluorescent dye, and then after PCR amplification and fluorescence detection, the polymorphism of the SNP site can be judged according to the fluorescence level detection results of FAM and HEX fluorescence channels.

[0078] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application, and not to limit it; although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that: it can still modify the technical solutions recorded in the foregoing examples, or make equivalent replacement for part of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application.

Claims

1. The use of molecular markers, or primer pairs for detecting said molecular markers, or kits for identifying the length of the seventh abdominal plate in honeybees; The molecular marker is a nucleotide sequence as shown in SEQ ID NO.1, where position 170 is a polymorphic site with a polymorphism of A or G. The nucleotide sequence shown in SEQ ID NO.1 is as follows: CATCACGTCAAATTGCCAACCCCTCTCCCCGCCTCTTCCCCTATTAGTGGCGCAAAGAAAATCGCCTCGGGCTGTGTAATTAATTTCGAATCGGGGCTTGCTTTCCCACACGCTTGCGCGCCCTTGTTGATAAATTGTTAATACATTTGTTTAGTTTTTTCCATCCTCTAATTTGTCTCTTCACCAATCGCTTGGGACGA GGATCGAAAGTTTTCACTATTTTATTATTCATTATTATATTAGGATGTCGAAATAATATTCCGTGACTGTTTTAGAAATCACGGTTGTATTAATTTTTGCGACGATTTCTATTCACTGTTTCCATTAGGAATTTTTATATTGAAAACTTCGTTTTCGACAAACGAATATCTCGTCGTGCTGAAGGGCGATAATCAAACGA; The primer pair comprises the following nucleotide sequences: F1: 5'-CAAGCGATTGGTGAAGAGACAAATT-3', F2: 5'-CAAGCGATTGGTGAAGAGACAAATC-3', R: 5'-GCTTGCTTTCCCACACGCTT-3'; The kit includes the primer pair.

2. The application according to claim 1, characterized in that, The applications include: For the Chinese honeybee to be tested, the polymorphism of its molecular markers as described above was detected, and the length of the seventh abdominal plate of the Chinese honeybee to be tested was determined based on the detection results.

3. The application according to claim 2, characterized in that, The detection includes one or more of the following: gene sequencing, PCR, or probe detection.

4. The application according to claim 3, characterized in that, The PCR uses the primer pair, and the PCR amplification procedure includes: Pre-denaturation at 95℃ for 5-10 minutes; The process involves denaturation at 92-96℃ for 30-60 seconds, annealing at 62-65℃ for 30-60 seconds, and extension at 70-74℃ for 30-60 seconds, repeated 10-15 times, with the annealing temperature decreasing by 0.4-0.6℃ each time. Denaturation at 93~96℃ for 30~60s, annealing at 56~60℃ for 30~60s, extension at 70~74℃ for 30~60s, cycle 25~35 times; Repair and extend the treatment at 70~74℃ for 10~15 minutes.

5. The application according to any one of claims 2-4, characterized in that, The determination of the length of the seventh abdominal plate of the Chinese honeybee under test based on the test results includes: As described in the molecular marker polymorphism, bees with a test result of A / A have a shorter seventh abdominal plate length compared to bees with a test result of G / G.

Images