A snp molecular marker related to pig teat number and backfat thickness and application thereof

Abstract

The application provides a SNP molecular marker related to pig teat number and backfat thickness and application thereof. The marker is obtained through whole genome association analysis of total teat number of large white pigs. The marker is from the 97377902th site of pig chromosome 7. Large white pigs are selected as test materials, whole genome DNA is extracted from pig blood, and primers are designed according to the pig genome sequence (NC_010449.5) published in the NCBI database. There is a base substitution of C or T at the 376th site, resulting in polymorphism. The SNP site is typed, and association analysis shows that, compared with other gene individuals, the TT genotype individuals have more total teat number, left and right teat number, and thinner backfat thickness. The application provides a new marker for pig molecular marker assisted selection, and the marker is applied to genetic improvement of pig teat number and backfat thickness, and the breeding improvement process of high-quality pigs is accelerated.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biotechnology and molecular marker technology, specifically relating to an SNP molecular marker related to the number of pig nipples and backfat thickness and its application. Individuals with the homozygous mutant TT genotype of this SNP molecular marker have a significantly higher number of nipples than those with the CC genotype, and individuals with the TT genotype have a thinner backfat. Background Technology

[0002] In the breeding system of pigs, the total number of teats is a key indicator determining production efficiency. The total number of teats directly determines the sow's lactation efficiency and the survival rate of piglets. Insufficient number of effective teats leads to fierce competition among piglets during the lactation period, resulting in increased piglet mortality. [1] In the future, improving the total number of teats will receive greater attention and become one of the important directions of breeding work. By breeding pig breeds with a higher total number of teats, the survival rate of weaned piglets can be effectively improved, thereby providing higher production and economic benefits for pig farming enterprises and promoting a healthier and more sustainable development of the pig industry. Genetic improvement of breeding pigs, with molecular breeding as its core, will become a rigid demand in the pig farming industry.

[0003] Currently, genetic improvement of breeding pigs still faces multiple bottlenecks. Traditional phenotypic selection relies on manual measurement of nipple count, which suffers from low efficiency, large errors, and long breeding cycles. As a trait with moderate heritability, the genetic progress of phenotypic selection for nipple count is slow. [2]Similar problems exist in the breeding of other important economic traits. For example, backfat thickness in live animals, a key indicator of fat deposition capacity in breeding pigs, relies on ultrasound or probe puncture for phenotypic determination. While easier to implement than nipple count measurement, it still has significant limitations. In actual production, the measured backfat thickness is easily affected by operator skill, equipment precision, and the restraint status of the pigs. With the rapid development of molecular biology techniques, marker-assisted selection (MAS) has become an important supplement to traditional breeding methods. This technology, by identifying individual genotypic differences at the nucleotide level, can overcome the limitations of traditional breeding, especially showing unique advantages in improving traits with low heritability or those difficult to observe directly in live animals. Currently, MAS technology has been applied on a large scale in the field of animal genetic improvement, propelling the breeding system into an era of precision. Looking at the history of animal breeding development, its technological iteration can be divided into three major stages: early empirical selection based on phenotypic observation, mid-term breeding value evaluation combined with statistical models, and the current molecular design breeding centered on genomic information. In this process, the breakthrough in Single Nucleotide Polymorphism (SNP) marker technology is of milestone significance. This is a DNA sequence polymorphism caused by a single base variation, including four types: transition, transversion, insertion, and deletion. It provides a completely new perspective for elucidating the genetic mechanisms of complex traits at the molecular level. [3] As an important source of genomic genetic diversity, SNPs are widely distributed in both coding and non-coding regions: SNPs located in coding regions may affect protein function by altering amino acid sequences; while SNPs in regulatory regions can regulate gene expression by modifying transcription factor binding sites, interfering with the function of non-coding RNA, or inducing epigenetic changes. [4] This multi-layered mechanism of action makes SNP markers a core tool for accelerating the genetic improvement of important economic traits in pigs.

[0004] Genome-wide association study (GWAS) is an important modern breeding technique that analyzes single nucleotide polymorphisms in animal genomes to screen for candidate genes associated with economically important traits. [5] Genome-wide association studies (GWAS), with its high-density marker coverage at the population level and efficient algorithmic models, can accurately capture functional variants significantly associated with nipple number traits across the entire genome. The advent of GWAS technology allows for the precise marking of specific loci affecting important economic traits on the animal genome, improving breeding efficiency.

[0005] Improving the number of teats in the core group of Large White pig breeds can increase the total number of teats, thereby improving the survival rate of weaned piglets and enhancing the production competitiveness of the pig farming industry. Improving the backfat thickness trait of the core group of Large White pig breeds can improve the meat production efficiency of commercial pigs, enhance the competitiveness of commercial pig production, and improve the economic benefits of commercial pig farming. Summary of the Invention

[0006] The purpose of this invention is to provide a SNP molecular marker associated with the number of teats and backfat thickness in pigs. Through GWAS association analysis of whole-genome completion data from a population of 4110 Danish Large White pigs, the SNP molecular marker with the largest effect size significantly associated with the total number of teats was identified. By cloning the gene sequence of the 97377527-97378335 segment of pig chromosome 7, and using direct sequencing to find SNP sites and genotyping methods, the association between this SNP and the traits of teat number and backfat thickness in pigs was analyzed, thereby establishing a new marker-assisted selection site for these traits.

[0007] Another objective of this invention is to provide the application of the aforementioned SNP molecular marker associated with the number of pig teats and backfat thickness in increasing the number of pig teats and decreasing backfat thickness. In this SNP molecular marker, the R at position 376 represents an allelic substitution, which leads to polymorphism at this position: changes are observed in the total number of teats, the number of left teats, the number of right teats, and the in vivo backfat thickness trait. The TT genotype at this SNP locus is a favorable genotype for both the number of pig teats and backfat thickness. This invention aims to discover and identify SNP loci associated with the traits of the number of pig teats and backfat thickness, thereby providing important guidance for pig genetic breeding.

[0008] This invention is achieved through the following technical solution:

[0009] A SNP molecular marker associated with the number of pig teats and backfat thickness was discovered. The SNP site corresponds to the gene sequence of chromosome 7, segment 97377527-97378335, with a fragment length of 809 bp. Its nucleotide sequence is shown in the attached sequence listing SEQ ID NO.1. BLAST alignment on the NCBI website revealed a single nucleotide polymorphism (SNP) site within this amplified fragment, specifically as follows... Figure 3 As shown. The mutation at this SNP site is specifically located at base 97377902 on chromosome 7, where the base changes from C to T. According to the Ensembl database, the rs number of this mutation site is rs337505376; this SNP molecular marker is significantly correlated with the total number of papillae.

[0010] The experimental materials included American Large White, Danish Large White, and French Large White pigs. Whole-genome DNA was extracted from the blood of these pigs, and primer pairs were designed based on the pig genome sequence (NC_010449.5) published in the NCBI database. The primer pair sequences are as follows:

[0011] Forward primer (SEQ ID NO.2): 5'-CCAATAGCAAGGGTTCTC-3',

[0012] Reverse primer (SEQ ID NO.3): 5'-GGATTTAGGTGTTTTAGGC-3'.

[0013] The primer pairs described above can be used to detect and genotype SNP sites in the gene region of chromosome 7 of pigs, specifically the segment from 97377527 to 97378335.

[0014] After PCR amplification, purification of PCR products, cloning and sequencing, and sequence alignment analysis using the above primer pairs, a genetic marker associated with the total number of pig nipples was screened. The nucleotide sequence of this genetic marker is shown in SEQ ID NO.1 below: The mutation site is located at position 376 of the sequence, CCAATAGCAAGGGTTCTCTTTACTAATTATCTTTATTTCCTCATCTCCCACGAACTCGTCCATCAGCTGCAGCCTTTAAGACTTCAAACCATGTGCTCTCCCCAGTCTTTCTTATACTTGACCTCTCAGCAGAGGTGAGTTAATTATGCCCTGTCCTGAATAGTCTGTGTATTTTCTATTTCTTCGGCCATTTTTCTTTGCCTTTTTGGCAGGGACGGGAGGGGGGCACACCTGTGGCAAGTGGAAGTTCCCAGGCCAGGGATCAGACCTGCACCACAGCAGTCACAATGCTGGATCCTTAACCCACTGAGCAAGGCCAGGGATTAAACCCCAACCTCATGGTTCCTGGTCGGATTCGTTTCCGCTGTGCCATGAR(C / T)GGGAACTCCAAGACTCAACTTGATATTGTTTAT AAGACTCTACATAGTACCTTTACTTCTCTAGTTTCCTAGCTTGTGGCTTTCCTCCTTGCTCTCTACGCTCCGGCTGTTCAGAACATGTTTCGTGCTCACACTGCCCTTGCACACGCTGCTCCCTCTTGCCTGGAATTATTTCATCCCATTTCCTTGGCTCACATTGATTCTTTAGCTCTCTTAACACTTTGAGTATAG GTGCAGGTTAGTTCTGTAGGCTTGCCAGCAAGAACTTGAAGATATACTCATCTGATGGTTTTTATTTCCTCTGAAGGAGGGAAAAAAAAAAAGGTTAACTCCTGAGAATGAGAGGGGAAGTAGCAGTTGGAAATTGTTAAGTCTCAACCTCAGGTCTAGGTTAAGTACCTGATTATGGAGTGCCTAAAACACCTAAATCC.

[0015] This invention provides a method for screening genetic markers associated with the total number of teats in pigs, the method comprising the following steps:

[0016] Genomic DNA was extracted from the blood of American Large White, Danish Large White, and French Large White pigs. Primers were designed based on the genomic sequence from -375° upstream to 433° downstream of this locus. The porcine genomic DNA was amplified by PCR using these primers, and the nucleotide sequence from -375° upstream to 433° downstream of this locus was obtained by direct sequencing (sequence details are shown in SEQ ID NO. 1). This sequence contains one SNP site. This mutation site can be used as a genetic marker for association analysis of the number of teats and backfat thickness traits in American Large White, Danish Large White, and French Large White pigs.

[0017] This invention provides a genotyping method for detecting SNP sites in the above sequence.

[0018] This invention further provides an application of direct sequencing to determine the association between different genotypes and nipple number and backfat thickness traits, including the following steps:

[0019] To determine the correlation between SNPs in the 97377527-97378335 region of porcine chromosome 7 and phenotypic differences in pigs, American Large White, Danish Large White, and French Large White pigs were selected as experimental materials. Polymorphisms were detected using direct sequencing, and the correlation between polymorphic sites and the number of teats and backfat thickness was analyzed. A mixed linear model in SAS statistical software was used to analyze the association between genotype and phenotypic values.

[0020] Compared with the prior art, the present invention has the following advantages and effects:

[0021] A SNP marker located at nucleotide 97377902 on chromosome 7 of pigs was identified through genome-wide association analysis and Bayesian fine mapping. The R at position 376 of this nucleotide sequence represents an allelic substitution, which leads to polymorphism at this location. Based on genome-wide autologous data from 4110 Danish Large White pigs, this SNP locus showed a significant genome-wide association with the total number of teats trait, with a p-value of 4.65 × 10⁻⁶. -27Furthermore, Bayesian fine mapping showed that this locus had the largest effect value, 0.22. Specifically, the R at position 376 of the SNP molecular marker's nucleotide sequence represents an allelic substitution, leading to polymorphism at this position: in the total number of teats trait, individuals with the TT genotype at this SNP locus have a higher number of teats; in the left teat number trait, individuals with the TT genotype at this SNP locus have a higher number of teats; in the right teat number trait, individuals with the TT genotype at this SNP locus have a higher number of teats; and in the live backfat thickness trait, individuals with the TT genotype at this SNP locus have a thinner live backfat thickness. The TT genotype at this SNP locus is a favorable genotype for both teat number and backfat thickness in pigs. This invention reveals for the first time the genetic regulatory role of this SNP locus in the traits of teat number and backfat thickness in pigs, providing a high-precision and highly stable target for marker-assisted breeding of pigs, and has significant practical breeding value. The present invention aims to discover and identify SNP loci associated with the number of pig nipples and backfat thickness, thereby providing important guidance for pig genetic breeding. Attached Figure Description

[0022] Sequence listing SEQ ID NO.1 is the nucleotide sequence of region 97377527-97378335 of pig chromosome 7, which serves as the nucleotide sequence for the genetic marker of this invention. A mutation site for an allele exists at the 376th base of this sequence, specifically a mutation from "C" to "T". The base at the mutation site in the sequence is the original base; the mutation mode is described in this specification and... Figure 3 .

[0023] Sequence listings SEQ ID NO.2 and SEQ ID NO.3 are primer pair sequences for amplifying the segment 97377527-97378335 of pig chromosome 7, which are used to detect the genetic markers of the present invention.

[0024] Figure 1 SNP information of this invention;

[0025] Figure 2 This invention presents the cloning detection results of the segment 97377527-97378335 of porcine chromosome 7; the agarose gel concentration is 1.5%; the figure labels are as follows: lanes 1-3: PCR amplification product samples of American Large White pigs, Danish Large White pigs and French Large White pigs respectively in Example 2; lane M: DL2000 Maker.

[0026] Figure 3 The nucleotide sequence of chromosome 7 of pig, segment 97377527-97378335. There is one mutation site R (C / T) in the sequence shown, which is the specific site causing the polymorphism in this segment.

[0027] Figure 4: Sequencing results of the SNP molecular marker sequences of this invention. (The sequences are listed below.) Figure 4A Genotyping results of Danish Large White pigs Figure 4B Genotyping results of American Large White pigs and Figure 4C The genotype sequencing results of French Large White pigs all showed bimodal patterns, indicating a mutation from the base "C" to "T". Detailed Implementation

[0028] Example 1: Identification of the genetic markers of the present invention

[0029] Genome-wide association analysis (GWA) was performed using the fastGWA-mlm model in GCTA software (version 1.94.1) based on genome-wide imputation data of a Danish Large White pig population. The first five principal components were corrected to control for population structure, and sex and batch number were included as fixed effects. Bonferroni multiple test corrections were applied (significance threshold P = 2.77 × 10⁻⁶). -7 A genome-wide screening identified 1187 SNP loci significantly associated with total nipple count. Further Bayesian fine mapping was used to infer causal relationships among SNPs within these significantly associated regions, prioritizing effect size and posterior causal probability. Ultimately, the SNP locus at nucleotide 97377902 on porcine chromosome 7 was identified, with a p-value of 4.65 × 10⁻⁶. -27 With an effect size of 0.220534 and a posterior causal probability of 0.013, it is the causal candidate site with the largest effect size in the region.

[0030] Example 2: Obtaining the DNA fragment from region 97377527-97378335 of porcine chromosome 7 and establishing a method for SNP detection.

[0031] Primer pairs were designed based on the genome sequence of the 97377527-97378335 segment of pig chromosome 7. The specific sequences are as follows:

[0032] Forward primer (SEQ ID NO.2): 5'-CCAATAGCAAGGGTTCTC-3',

[0033] Reverse primer (SEQ ID NO.3): 5'-GGATTTAGGTGTTTTAGGC-3'.

[0034] The above primer pairs were used to perform PCR amplification on the genomic DNA of different experimental pig groups.

[0035] The PCR reaction system is shown in Table 1.

[0036] Table 1 PCR reaction system

[0037]

[0038] The PCR reaction conditions are shown in Table 2.

[0039] Table 2 PCR reaction conditions

[0040]

[0041] After purification and cloning, the obtained PCR product was sent to Wuhan Hece Gene Technology Co., Ltd. for sequencing. BLAST comparison analysis revealed a C / T base mutation at position 376 of the sequence, and this site was polymorphic in American Large White, Danish Large White, and French Large White pig populations.

[0042] Example 3: Association analysis and application of the genetic markers of the present invention with the nipple number trait of different breeds of pigs.

[0043] To determine the correlation between SNPs in the region 97377527-97378335 of pig chromosome 7 and phenotypic differences in pigs, this example selected American Large White (262 pigs), Danish Large White (218 pigs), and French Large White (270 pigs) as experimental materials. Polymorphism was detected by direct sequencing, and the correlation between polymorphic sites and the number of teats and backfat thickness was analyzed; the results are shown in Figure 4. A mixed linear model in SAS statistical software was used to analyze the association between genotype and phenotypic values. The analysis model is as follows: Y ijkl =u+G i +F j +S k +B l +ε ijklm In the formula, Y ijkl G represents the observed trait value; u represents the overall trait mean; G represents the observed trait value. i This is a genotype effect; F j S k B l For fixed effects, ε represents pedigree, sex, and batch effects. ijklm The error is random, assumed to follow the order N ~ (0, σ). 2 )distributed.

[0044] Polymorphism detection was performed on the rs337505376 locus in the 97377527-97378335 region of pig chromosome 7, and three genotypes were detected in all of the above populations. The genotype frequencies and their distribution are shown in Table 3.

[0045] Table 3 Genotype and allele frequencies of polymorphic site rs337505376

[0046]

[0047] Table 3 shows that the C allele frequency of the polymorphic site rs337505376 is higher than the T allele frequency in American and Danish Large White pig populations, while the C allele frequency is lower than the T allele frequency in French Large White pig populations. The Hardy-Weinberg equilibrium test results indicate that in American Large White (χ²) pigs... 2 =2.836, P=0.96>0.05), Danish-type large white (χ²) 2 =0.002, P=0.06>0.05) and French Big White (χ 2 In the range of rs337505376 (P=0.065, P=0.80>0.05), the genotype distribution of the polymorphic site rs337505376 conforms to the state of genetic equilibrium.

[0048] Table 4. Association analysis of the rs337505376 locus in American Large White pigs with teat number and live backfat thickness traits.

[0049]

[0050] Table 5. Association analysis of the rs337505376 locus in Danish Large White pigs with teat number and live backfat thickness traits.

[0051]

[0052] Table 6. Association analysis of the rs337505376 locus in French Large White pigs with teat number and live backfat thickness traits.

[0053]

[0054] Note: The above values ​​are the least squares mean ± standard error; within each pig breed, the same letter in the same column indicates no significant difference (P>0.05), different letters indicate significant difference (P<0.05), and no label indicates no significant difference (P>0.05). The number in parentheses indicates the number of pigs.

[0055] Analysis of Tables 4, 5, and 6 revealed that the polymorphic locus rs337505376 was significantly correlated with teat number and live backfat thickness in American Large White, Danish Large White, and French Large White pigs (P<0.05). Specifically, individuals with the TT genotype showed significantly higher total teat number, left teat number, and right teat number than those with the CC genotype (P<0.05). Regarding live backfat thickness, individuals with the TT genotype also showed significantly higher live backfat thickness than those with the CC genotype (P<0.05). From the perspectives of genetic stability and genetic progression, the TT genotype exhibits a clear advantage in increasing teat number and decreasing live backfat thickness. Based on these results, we hypothesize that the polymorphic locus rs337505376 could serve as a potential genetic marker for increasing teat number and decreasing backfat thickness in pigs.

[0056] Main References

[0057] [1]Speckman EC,Howard JT,Wiegert J G.The Relationship Between Litter Size and Functional Teat Number at Farrowing on Litter Size at Weaning[J].Journal of Animal Science,2021,99.

[0058] [2] Luo Ke, Fei Junwen, Ke Juan, et al. Research progress on the genetic mechanism of variation in the number of pig teats [J]. Heilongjiang Journal of Animal Husbandry and Veterinary Medicine, 2024, (17): 18-25+31+111.

[0059] [3] Ramos AM, Crooijmans RPMA, Affara NA, et al. Design of a highdensity SNP genotype assay in the pig using SNPs identified and characterized by next generation sequencing technology [J]. PloS one, 2009, 4(8):e6524.

[0060] [4] Tak YG, Farnham PJ. Making sense of GWAS relevance: using epigenomics and genome engineering to understand the functional of SNPs in non-coding regions of the human genome. Epigenetics Chromatin. 207,8:57.

[0061] [5] Wang Jiying, Wang Haixia, Chi Ruibin, et al. Research progress of genome-wide association analysis in livestock and poultry [J]. Chinese Agricultural Science, 2013, 46(04): 819-829.

Claims

1. The application of a SNP molecular marker associated with the number of pig teats and backfat thickness in increasing the number of pig teats and decreasing backfat thickness, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein R in the sequence is C or T; the pig is a Danish Large White, American Large White, or French Large White pig; the primer pair sequences used to detect the SNP molecular marker are shown in SEQ ID NO.2 and SEQ ID NO.3; the R at position 376 in the nucleotide sequence of the SNP molecular marker is the SNP site, and allele substitution at the SNP site produces polymorphism.

2. The application according to claim 1, characterized in that, The total number of nipples, the number of left nipples, and the number of right nipples in individuals with the TT genotype of the SNP molecular marker were significantly higher than those in individuals with the CC genotype; the live backfat thickness of individuals with the TT genotype of the SNP molecular marker was significantly thinner than that of individuals with the CC genotype.

Images