Method for cultivating gray leaf spot resistant corn inbred line by polymerizing two disease-resistant genes and application of gray leaf spot resistant corn inbred line

Abstract

The invention provides a method for cultivating a gray leaf spot resistant maize inbred line, which comprises the following steps: introducing disease-resistant genes of two gray leaf spot resistant sites qRgls1 and qRgls2 into a susceptible maize plant to obtain a new maize germplasm which simultaneously contains homozygous disease-resistant genes at the two disease-resistant sites and has obviously enhanced disease resistance. The invention also provides a plant or a part of the plant of the gray speck disease resistant maize inbred line obtained by the method, and the plant or the part of the plant simultaneously carries the homozygous disease-resistant gene at the two sites qRgls1 and qRgls2.

Description

Technical Field

[0001] The present invention belongs to the technical field of agriculture, and particularly relates to a method for breeding disease-resistant maize inbred lines in the field of crop disease-resistant breeding, specifically to a method for breeding maize inbred lines that aggregate two gray leaf spot-resistant genes and its application. Background Art

[0002] Maize is the most important food, feed, industrial raw material and energy crop in the world today. Maize gray leaf spot is a worldwide fungal leaf disease of maize, caused by Cercospora zeae-maydis and Cercospora zeina, which seriously affects the yield and quality of maize. Gray leaf spot was first discovered in Dandong City, Liaoning Province, China in 1991, and has since been reported in Jilin, Hebei, Gansu, Hubei and Yunnan. In recent years, gray leaf spot has become one of the main leaf diseases in maize production in China, especially severe in the spring maize production areas in the Northeast and the maize production areas in the Southwest.

[0003] Gray leaf spot lesions first appear on the lower leaves of the plant and then gradually infect the upper leaves. In the initial stage of the disease, the lesions are water-soaked chlorotic spots, which then expand into grayish-brown. Typical gray leaf spot lesions are approximately rectangular with parallel sides and parallel to the leaf veins. When the disease is severe, the lesions will expand into patches, causing the leaves to wither and even the whole maize plant to die. The occurrence of maize gray leaf spot generally results in a 10-30% reduction in maize yield, and when the disease is severe, the yield reduction can reach 60% or even result in a complete crop failure, posing a serious threat to maize production in China.

[0004] According to existing reports, the resistance of maize to gray leaf spot belongs to quantitative genetic resistance, which is controlled by multiple minor or medium-effect loci and is mainly additive. Up to now, only a few gray leaf spot-resistant genes have been cloned: one gray leaf spot-resistant gene is ZmCCoAOMT2, which participates in phenylpropanoid metabolism and lignin synthesis and mediates the resistance of maize to gray leaf spot; another gray leaf spot-resistant gene is ZmMM1 derived from teosinte, which controls the formation of mimic lesions and regulates cell death, thus showing resistance to gray leaf spot; genes related to gray leaf spot resistance also include ZmPK (see Chinese invention patent number ZL201910160206.3, corresponding authorized publication number CN109705202B), ZmDi19 (see CN114262369A), ZmHRL (see CN114410651A) and ZmPMT1 (see CN114907461A). In addition, a large number of studies on gray leaf spot-resistant loci are basically in the initial mapping stage, and only a few have been finely mapped.

[0005] Current means for controlling maize diseases in production include sowing at different times, strengthening field management, chemical control (e.g., spraying fungicides), and cultivating disease-resistant varieties. Among them, sowing at different times easily leads to the land being unavailable for other crops within a certain period, resulting in waste of land resources; field management and the use of fungicides not only increase the input costs of agricultural production, but may also endanger the safety of the ecological environment, and the effect of chemical control means is not obvious. Therefore, cultivating disease-resistant varieties is the most economical and effective way to control gray leaf spot. However, there are still relatively few successfully cultivated maize varieties resistant to gray leaf spot, and the cultivation of highly resistant varieties to gray leaf spot largely depends on in-depth research on the pathogenic mechanism and resistance inheritance, and it is necessary to further identify genes resistant to gray leaf spot and analyze the genetic basis of resistance to gray leaf spot. Developing molecular markers tightly linked to disease-resistant loci and using molecular marker-assisted improvement can quickly and purposefully introduce disease-resistant loci into elite inbred lines, thereby improving the resistance of improved lines to diseases. Zhao et al. (Marker-assisted introgression of qHSR1 to improve maize resistance to head smut. Mol Breeding (2012) 30:1077-1088; doi:10.1007 / s11032-011-9694-3, https: / / link.springer.com / article / 10.1007 / s11032-011-9694-3) introduced the head smut-resistant locus qHSR1 into 10 inbred lines through molecular marker backcross improvement, which could significantly enhance the resistance of maize to head smut. Li et al. (Evaluation of ZmCCT haplotypes for genetic improvement of maize hybrids. Theor Appl Genet (2017) 130:2587-2600; doi:10.1007 / s00122-017-2978-1, https: / / link.springer.com / article / 10.1007 / s00122-017-2978-1) used molecular marker-assisted selection to introduce 9 different haplotypes of disease-resistant ZmCCT genes into 7 elite inbred lines, and the 63 improved maize materials obtained all had good resistance to stalk rot. However, currently in this field, it is not known whether two or more disease-resistant loci can be pyramided by molecular markers to enhance the resistance of maize to the same disease, and there is no report on such a technique. Therefore, there is a continuous need in this field for methods for cultivating maize varieties resistant to gray leaf spot. SUMMARY OF THE INVENTION

[0006] One object of the present invention is to provide a method for cultivating a maize inbred line resistant to diseases (e.g., gray leaf spot), which is a safe hybridization method aiming to enhance the resistance of maize to the same disease (e.g., gray leaf spot) by aggregating two or more disease-resistant loci through molecular markers.

[0007] Another object of the present invention is to provide a maize inbred line resistant to gray leaf spot, which has good resistance to gray leaf spot. Planting this maize inbred line can reduce the probability of maize plants being infected with gray leaf spot and improve the yield and quality of maize.

[0008] The present invention adopts molecular marker-assisted selection technology to rapidly achieve the aggregation of two gray leaf spot-resistant loci, qRgls1 (the functional gene is ZmWAK-RLK, see Chinese Patent Application No. 201910140479.1, corresponding Publication No. CN109705200A) and qRgls2 (the functional gene is ZmPK, see Chinese Patent No. ZL201910160206.3, corresponding Authorization No. CN109705202B), and creates a new maize germplasm with significantly enhanced and stably inherited resistance to gray leaf spot, providing an important germplasm resource for maize disease-resistant breeding.

[0009] A major QTL (Quantitative Trait Loci) locus qRgls1 related to resistance to gray leaf spot in maize is located on chromosome 8 of maize. The disease-resistant gene sequence thereof is derived from the maize disease-resistant material Y32 (hereinafter also referred to as "tropical gray leaf spot-resistant material Y32" or "tropical disease-resistant material Y32"). For information on the maize disease-resistant material Y32 carrying qRgls1, see Zhang, Y., Xu, L., Fan, X., Tan, J., Chen, W., & Xu, M. (2012) QTL mapping of resistance to gray leaf spot in maize. Theoretical and applied genetics, 125(8), 1797-1808. Another major QTL locus qRgls2 related to resistance to gray leaf spot in maize is located on chromosome 5 of maize. The disease-resistant gene sequence thereof is also derived from the disease-resistant material Y32. For information on the maize disease-resistant material Y32 carrying qRgls2, see Xu, L., Zhang, Y., Shao, S., Chen, W., Tan, J., Zhu, M., & Xu, M., (2014) High-resolution mapping and characterization of qRgls2, a major quantitative trait locus involved in maize resistance to gray leaf spot. BMC plant biology, 14(1), 230.

[0010] Specifically, the maize disease-resistant material Y32 (also referred to as "tropical gray leaf spot-resistant material Y32" or "tropical disease-resistant material Y32") refers to the maize tropical inbred line Y32, which is a gray leaf spot-resistant maize material selected from the tropical maize Suwan1 population in Thailand. Research has determined that the maize disease-resistant material Y32 simultaneously carries two major QTL loci related to resistance to gray leaf spot in maize: qRgls1 and qRgls2. However, the maize disease-resistant material Y32 is adapted to the tropical climate and is generally not suitable for large-scale planting (especially not suitable for planting in temperate regions). Currently, it is mainly used as an important germplasm resource for maize breeding.

[0011] Compared with the maize gray leaf spot resistant material Y32, the temperate susceptible material Q11 of maize carries susceptible gene sequences at both the qRgls1 and qRgls2 loci. For details, please refer to the above two references. The temperate susceptible material Q11 and the tropical resistant material Y32 have different origins and are highly susceptible to gray leaf spot, which is conducive to the assembly of segregating populations to mine gray leaf spot resistance loci. By crossing with the tropical resistant material to form a segregating population for disease resistance traits, it can be used for QTL mapping and disease resistance mechanism analysis.

[0012] The temperate susceptible material Q11 is a maize material sensitive to gray leaf spot of maize and is easily invaded by gray leaf spot. Compared with the maize gray leaf spot resistant material Y32, the functional genes corresponding to the gray leaf spot resistance equivalent loci qRgls1 and qRgls2 in the temperate susceptible material Q11 are called "susceptible genes".

[0013] In the first aspect, the present invention provides a method for cultivating a maize inbred line resistant to gray leaf spot, the method comprising:

[0014] (1) Using the tropical gray leaf spot resistant material Y32 as the donor parent (male parent) to cross and backcross with the temperate susceptible material Q11 (female parent) as the recipient parent, and making the following two selections:

[0015] (i) Selecting the plants heterozygous at the qRgls1 locus from the backcross progeny as male parents to cross with Q11 to continue the next round of backcrossing. Backcrossing is carried out 6 times until the BC7F1 generation. The genetic background of the BC7F1 generation material is basically restored to the recurrent parent Q11. Selecting the plants heterozygous at the qRgls1 locus for selfing to obtain the improved material Q11 carrying the homozygous resistant gene at the qRgls1 locus qRgls1 and the control material Q11 carrying the susceptible gene CK-1 ;

[0016] (ii) Selecting the plants heterozygous at the qRgls2 locus from the backcross progeny as male parents to cross with Q11 to continue the next round of backcrossing. Backcrossing is carried out 6 times until the BC7F1 generation. The genetic background of the BC7F1 generation material is basically restored to the recurrent parent Q11. Selecting the plants heterozygous at the qRgls2 locus for selfing to obtain the improved material Q11 carrying the homozygous resistant gene at the qRgls2 locus qRgls2 and the control material Q11 carrying the susceptible gene CK-2 ;

[0017] (2) Crossing the obtained improved material Q11 qRgls1 with the obtained improved material Q11 qRgls2 and then selfing the hybrid progeny to obtain the improved material Q11 carrying the homozygous resistant genes at both the qRgls1 and qRgls2 loci qRgls1 / 2 and the control material Q11 containing two susceptible genes CK ,

[0018] Among them, the improved material Q11 that carries homozygous disease-resistant genes at both the qRgls1 and qRgls2 loci qRgls1 / 2 is a maize inbred line material resistant to gray leaf spot, and the disease-resistant genes are ZmWAK-RLK and ZmPK.

[0019] Among them, for the initial cross, the tropical gray leaf spot-resistant material Y32 is used as the male parent, the temperate susceptible material Q11 is used as the female parent, and the temperate susceptible material Q11 is used as the recurrent parent. Backcrossing is carried out until the BC7F1 generation, aiming to basically restore the genetic background to the recurrent parent Q11. The background recovery rate can theoretically reach more than 98%, which is basically the same as the recurrent parent Q11.

[0020] In one embodiment, the method further includes collecting the seeds of the inbred line Q11 that carries homozygous disease-resistant genes at both the qRgls1 and qRgls2 loci qRgls1 / 2 of.

[0021] In one embodiment, molecular markers linked to the qRgls1 locus (such as, but not limited to, 35-5-3F / R and GI90F / R) are used to detect and select maize materials carrying heterozygous or homozygous qRgls1 locus.

[0022] In one embodiment, molecular markers linked to the qRgls2 locus (such as, but not limited to, IDP36F / R and Q22F / R) are used to detect and select maize materials carrying heterozygous or homozygous qRgls2 locus.

[0023] In one embodiment, molecular markers linked to the qRgls1 locus (such as 35-5-3F / R and GI90F / R, GZ204, IDP2, IDP11, M2, 18-5, SNP2, IDP5, etc.) and molecular markers linked to the qRgls2 locus (such as IDP36F / R and Q22F / R, G346, DD3, M23, DD11, etc.) are used to detect and select maize materials carrying homozygous qRgls1 locus and homozygous qRgls2 locus (that is, maize materials carrying homozygous disease-resistant genes at both the qRgls1 and qRgls2 loci).

[0024] In some embodiments, the method of using molecular markers linked to the qRgls1 locus or molecular markers linked to the qRgls2 locus for detection is a conventional method in the art. For example, polyacrylamide gel electrophoresis or agarose gel electrophoresis is carried out after PCR amplification, or direct sequencing of the PCR product, etc.

[0025] Those skilled in the art should understand that for the selection of maize gray leaf spot susceptible materials as the initial parents for hybridization, it is not limited to the above-mentioned temperate susceptible material Q11. Selecting maize susceptible materials that also carry susceptible genes at the qRgls1 and qRgls2 loci can also be hybridized with the tropical gray leaf spot resistant material Y32, enabling the breeding method described in the present invention, thereby obtaining maize inbred lines with gray leaf spot resistance traits; for the selection of maize materials resistant to gray leaf spot, it should be limited to maize materials that carry resistance genes at both the qRgls1 and qRgls2 loci, such as the tropical gray leaf spot resistant material Y32, or inbred lines cultivated by the method of the present invention that carry homozygous resistance genes at both the qRgls1 and qRgls2 loci.

[0026] In another embodiment, the inbred line Q11 of the present invention that carries homozygous resistance genes at both the qRgls1 and qRgls2 loci qRgls1 / 2 can replace the tropical gray leaf spot resistant material Y32 as the male parent, and use maize susceptible materials (such as, but not limited to, the temperate susceptible material Q11) that carry susceptible genes at the qRgls1 and qRgls2 loci as the female parent to perform the above-mentioned method steps for cultivating maize inbred lines resistant to gray leaf spot, thereby obtaining maize inbred lines resistant to gray leaf spot.

[0027] In a second aspect, the present invention provides a method for cultivating maize inbred lines resistant to gray leaf spot, the method comprising:

[0028] (1) Using a maize gray leaf spot resistant material that simultaneously carries qRgls1 and qRgls2 as the donor parent (male parent) to hybridize and backcross with a susceptible maize material (female parent) as the recipient parent, and perform the following two selections:

[0029] (i) Selecting single plants heterozygous at the qRgls1 locus from the backcross progeny as the male parent to hybridize with the susceptible maize material and continue the next round of backcrossing. Backcross six times until the BC7F1 generation, where the genetic background of the BC7F1 generation material is basically restored to the susceptible maize material (as the recurrent parent). Selecting single plants heterozygous at the qRgls1 locus for self-crossing to obtain improved material 1 carrying homozygous resistance genes at the qRgls1 locus and control material 1 carrying susceptible genes;

[0030] (ii) Selecting single plants heterozygous at the qRgls2 locus from the backcross progeny as the male parent to hybridize with the susceptible maize material and continue the next round of backcrossing. Backcross six times until the BC7F1 generation, where the genetic background of the BC7F1 generation material is basically restored to the susceptible maize material (as the recurrent parent). Selecting single plants heterozygous at the qRgls2 locus for self-crossing to obtain improved material 2 carrying homozygous resistance genes at the qRgls2 locus and control material 2 carrying susceptible genes;

[0031] (2) Hybridize the obtained improved material 1 with the obtained improved material 2, and then self-cross the hybrid offspring to obtain improved material 3 that carries homozygous disease-resistant genes at the qRgls1 and qRgls2 loci and control material 3 that contains two susceptible genes.

[0032] Among them, the improved material 3 that carries homozygous disease-resistant genes at the qRgls1 and qRgls2 loci is a gray leaf spot-resistant maize inbred line material, and the disease-resistant genes are ZmWAK-RLK and ZmPK.

[0033] In one embodiment, the gray leaf spot-resistant maize material that simultaneously carries qRgls1 and qRgls2 is tropical gray leaf spot-resistant material Y32, and the gray leaf spot-resistant maize inbred line material cultivated by the method of the present invention (that is, the improved material 3 that carries homozygous disease-resistant genes at the qRgls1 and qRgls2 loci cultivated by the method of the second aspect of the present invention, or the improved material Q11 that carries homozygous disease-resistant genes at the qRgls1 and qRgls2 loci cultivated by the method of the first aspect of the present invention qRgls1 / 2 ) can also be used in the method for cultivating gray leaf spot-resistant maize inbred lines described in the first or second aspect of the present invention.

[0034] In one embodiment, the susceptible maize material is not particularly limited. Compared with the gray leaf spot-resistant maize material that simultaneously carries qRgls1 and qRgls2, the functional genes corresponding to the gray leaf spot-resistant equivalent loci qRgls1 and qRgls2 do not have gray leaf spot resistance activity and are easily infected with gray leaf spot. In one embodiment, the susceptible maize material can be Q11, and other susceptible maize materials can also be used in the method for cultivating gray leaf spot-resistant maize inbred lines described in the first or second aspect of the present invention.

[0035] In the third aspect, the present invention provides a gray leaf spot-resistant maize inbred line, which is obtained by the method of the first aspect and carries homozygous disease-resistant genes at the qRgls1 and qRgls2 loci.

[0036] Specifically, the disease-resistant genes carried at the qRgls1 and qRgls2 loci are ZmWAK-RLK and ZmPK respectively. And the disease-resistant genes exist homozygously at the corresponding loci.

[0037] In some embodiments, the present invention provides seeds of the gray leaf spot-resistant maize inbred line, and the seeds carry homozygous disease-resistant genes at the qRgls1 and qRgls2 loci.

[0038] In some embodiments, the present invention provides plants of the gray leaf spot-resistant maize inbred line, including progeny plants, and the plants carry homozygous disease-resistant genes at the qRgls1 and qRgls2 loci.

[0039] In some embodiments, the present invention provides a plant part of a gray leaf spot-resistant maize inbred line, wherein the plant part carries homozygous disease-resistant genes at both the qRgls1 and qRgls2 loci.

[0040] The plant part represents a part of a complete plant, including single cells and cell tissues (such as intact plant cells in a plant), cell clusters, and tissue cultures. Examples of plant parts include, but are not limited to, single cells and tissues from pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, seedlings, and seeds; and pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, seedlings, scions, rootstocks, seeds, protoplasts, callus, and the like.

[0041] In a fourth aspect, the present invention provides the use of a maize inbred line carrying homozygous disease-resistant genes at both the qRgls1 and qRgls2 loci in maize breeding.

[0042] For example, a maize inbred line carrying homozygous disease-resistant genes at both the qRgls1 and qRgls2 loci can be used for breeding, such as Q11 qRgls1 / 2 It can be hybridized with maize materials having other desired traits, or nucleotides encoding proteins conferring other desired traits can be introduced by transgenic methods, thereby obtaining maize with both gray leaf spot resistance and other desired traits.

[0043] For example, a maize inbred line carrying homozygous disease-resistant genes at both the qRgls1 and qRgls2 loci can be used to cultivate maize materials having other desired traits in addition to gray leaf spot resistance in maize. The other desired traits are one or more of the following: herbicide tolerance, drought tolerance, heat tolerance, tolerance to low or high soil pH levels, salt tolerance, bacterial disease resistance, viral disease resistance, fungal disease resistance, pest resistance (e.g., nematode resistance or insect resistance), male sterility, site-specific recombination; abiotic stress tolerance, improved phosphorus characteristics, improved antioxidant characteristics; improved essential amino acid characteristics in seeds, reduced phytic acid, improved fatty acid metabolism, and improved carbohydrate metabolism.

[0044] In some embodiments, the acquisition of other desired traits can be obtained by hybridization.

[0045] In one embodiment, the present invention provides a method for cultivating a maize inbred line having resistance to gray leaf spot and one or more other desired traits, the method comprising: using a maize material homozygous for the disease-resistant genes at the qRgls1 and qRgls2 loci as the male parent, and a maize material having other desired traits as the female parent, and performing hybridization, backcrossing, selection, and selfing according to the method step process for cultivating a gray leaf spot-resistant maize inbred line described in the first aspect of the present invention, and finally obtaining a maize inbred line having resistance to gray leaf spot and one or more other desired traits.

[0046] In some embodiments, the acquisition of other desired traits can be achieved by introducing one or more exogenous nucleic acids encoding a protein conferring the desired trait into a maize material homozygous for the disease-resistant genes at the qRgls1 and qRgls2 loci, for example, by means of transgenic technology.

[0047] In one embodiment, the present invention provides a method for cultivating a maize inbred line having resistance to gray leaf spot and one or more other desired traits, the method comprising introducing one or more exogenous nucleic acids encoding a protein conferring the desired trait into a maize material homozygous for the disease-resistant genes at the qRgls1 and qRgls2 loci, for example, by means of transgenic technology.

[0048] In a fifth aspect, the present invention relates to a method for increasing maize yield, the method comprising planting a maize material or its seeds homozygous for the disease-resistant genes at the qRgls1 and qRgls2 loci, or planting a maize material or its seeds homozygous for the disease-resistant genes at the qRgls1 and qRgls2 loci and having other desired traits.

[0049] In some embodiments, the other desired traits may be one or more of the following, but are not limited thereto: herbicide tolerance, drought tolerance, heat tolerance, tolerance to low or high soil pH levels, salt tolerance, bacterial disease resistance, viral disease resistance, fungal disease resistance, pest resistance (e.g., nematode resistance or insect resistance), male sterility, site-specific recombination; abiotic stress tolerance, improved phosphorus characteristics, improved antioxidant characteristics; improved essential amino acid characteristics of seeds, reduced phytate, improved fatty acid metabolism, and improved carbohydrate metabolism.

[0050] In some embodiments, maize materials that simultaneously carry homozygous disease-resistant genes at the qRgls1 and qRgls2 loci and have other desired traits can be obtained by introducing one or more exogenous nucleic acids encoding proteins conferring the desired traits into maize materials that simultaneously carry homozygous disease-resistant genes at the qRgls1 and qRgls2 loci, for example, by transgenic means; or can be obtained by hybridization. For example, using a maize material that simultaneously carries homozygous disease-resistant genes at the qRgls1 and qRgls2 loci as the male parent, and a maize material with other desired traits as the female parent, and performing hybridization, backcrossing, selection, and self-crossing according to the method step process for cultivating a gray leaf spot-resistant maize inbred line described in the first aspect of the present invention, finally obtaining a maize inbred line with gray leaf spot resistance and one or more other desired traits.

[0051] In a sixth aspect, the present invention provides an isolated genome of a gray leaf spot-resistant maize material, wherein the genome carries homozygous disease-resistant genes at both the qRgls1 and qRgls2 loci, and wherein the disease-resistant genes are ZmWAK-RLK and ZmPK.

[0052] In some embodiments, the isolated genome further comprises one or more other exogenous nucleic acids, and the one or more other exogenous nucleic acids encode proteins conferring the desired traits to the maize material, wherein the desired traits are one or more of the following: herbicide tolerance, drought tolerance, heat tolerance, tolerance to low or high soil pH levels, salt tolerance, bacterial disease resistance, viral disease resistance, fungal disease resistance, pest resistance (e.g., nematode resistance or insect resistance), male sterility, site-specific recombination; abiotic stress tolerance, improved phosphorus characteristics, improved antioxidant characteristics; improved seed essential amino acid characteristics, reduced phytic acid, improved fatty acid metabolism, and improved carbohydrate metabolism.

[0053] In a seventh aspect, the present invention provides a method for cultivating a plant with enhanced disease resistance, the method comprising: using a disease-resistant plant material as the male parent, the corresponding disease-susceptible plant material as the hybridization female parent and the recurrent parent, and making two or more disease-resistant loci simultaneously carry homozygous disease-resistant genes through hybridization and a series of backcrosses, thereby obtaining a plant or its seeds that simultaneously carry homozygous disease-resistant genes at two or more disease-resistant loci. Wherein the plant that simultaneously carries homozygous disease-resistant genes at two or more disease-resistant loci has enhanced disease resistance. Wherein the hybridization and a series of backcrosses are carried out for hybridization, backcrossing, selection, and self-crossing according to the method step process for cultivating a gray leaf spot-resistant maize inbred line described in the first aspect of the present invention, and finally obtaining a plant that simultaneously carries homozygous disease-resistant genes at two or more disease-resistant loci.

[0054] In one embodiment, the disease resistance may be bacterial disease resistance, viral disease resistance, fungal disease resistance, or pest resistance. Among them, the pest resistance may be nematode resistance or insect resistance.

[0055] In one embodiment, the disease-resistant gene may be a gene involved in bacterial disease resistance, viral disease resistance, fungal disease resistance, nematode resistance, or pest resistance. In a preferred embodiment, the disease-resistant gene is a gray leaf spot resistance gene.

[0056] In one embodiment, the plant is a dicotyledon or a monocotyledon. Examples of dicotyledons include, but are not limited to: tobacco, Arabidopsis thaliana, tomato, potato, sweet potato, beet, broccoli, rapeseed, kidney bean, soybean, carrot, strawberry, lettuce, cotton, etc.; examples of monocotyledons include, but are not limited to: corn / maize, rice, oat, rye, wheat, barley, sorghum, millet, etc.

[0057] In an eighth aspect, the present invention provides a method for cultivating a plant with enhanced excellent traits, the method comprising: using a plant material with excellent traits as the male parent, a plant material without the excellent trait as the hybrid female parent and the recurrent parent, and through hybridization and a series of backcrosses, making two or more loci related to excellent traits simultaneously carry homozygous excellent trait-related genes, so as to obtain a plant or its seeds that simultaneously carry homozygous excellent trait-related genes at two or more loci related to the resistance to the excellent traits. Among them, the plant that simultaneously carries homozygous excellent trait-related genes at two or more loci related to the resistance to the excellent traits has enhanced excellent traits. Among them, the hybridization and a series of backcrosses are carried out according to the method steps and processes of cultivating a gray leaf spot-resistant maize inbred line described in the first aspect of the present invention for hybridization, backcrossing, selection, and self-crossing, and finally obtaining a plant that simultaneously carries homozygous excellent trait-related genes at two or more loci related to the resistance to the excellent traits.

[0058] In one embodiment, the excellent traits may be one or more selected from the following, but not limited thereto: herbicide tolerance, drought tolerance, heat tolerance, tolerance to low or high soil pH levels, salt tolerance, bacterial disease resistance, viral disease resistance, fungal disease resistance, pest resistance (e.g., nematode resistance or insect resistance), male sterility, site-specific recombination; abiotic stress tolerance, improved phosphorus characteristics, improved antioxidant characteristics; improved essential amino acid characteristics of seeds, reduced phytate, improved fatty acid metabolism, and improved carbohydrate metabolism.

[0059] In one embodiment, the plant is a dicotyledon or a monocotyledon. Examples of dicotyledons include, but are not limited to: tobacco, Arabidopsis thaliana, tomato, potato, sweet potato, beet, broccoli, rapeseed, kidney bean, soybean, carrot, strawberry, lettuce, cotton, etc.; examples of monocotyledons include, but are not limited to: maize / corn, rice, oat, rye, wheat, barley, sorghum, millet, etc.

[0060] Advantages of the present invention

[0061] The present invention combines biotechnological means and conventional breeding methods to introduce gray leaf spot resistance loci into susceptible maize materials, obtaining new maize germplasms that simultaneously contain homozygous resistance genes at two resistance loci and have significantly enhanced disease resistance. The disease-resistant maize inbred lines obtained by this method are beneficial to reducing the yield loss caused by gray leaf spot, increasing the durable disease resistance of maize to gray leaf spot and the regional adaptability, and have important breeding value. The breeding method of the present invention is a safe breeding method, with profound theoretical and practical significance. Moreover, the breeding method of the present invention can be extended to other excellent traits other than gray leaf spot resistance and other plants (such as crops) other than maize. By hybridization and a series of backcrosses, loci related to two or more excellent traits simultaneously carry homozygous genes related to excellent traits, thereby obtaining plants or their seeds that simultaneously carry homozygous genes related to excellent traits at two or more loci resistant to the said excellent traits. The plants that simultaneously carry homozygous genes related to excellent traits at two or more loci resistant to the said excellent traits have enhanced excellent traits. Brief description of the drawings

[0062] Those skilled in the art will more easily understand the technical solutions of the present invention by referring to the following drawings. These drawings form a part of the present invention.

[0063] Figure 1 It is the result of the disease resistance identification of the qRgls1 improved line in Example 1.

[0064] Figure 2 It is the result of the disease resistance identification of the qRgls2 improved line in Example 2.

[0065] Figure 3 It is the result of the disease resistance identification of the pyramided qRgls1 and qRgls2 improved lines in Example 3. Detailed description of the invention

[0066] Definitions

[0067] For a better understanding of the present invention, the definitions and explanations of related terms are provided as follows. Unless otherwise defined herein, scientific and technical terms used in conjunction with the present invention will have the meanings commonly understood by those of ordinary skill in the art.

[0068] As used herein, crossbreeding is the process of crossing a male parent with a female parent to form different genetic diversities. Through the screening of the hybrid offspring, a new variety with the excellent traits of the male and female parents and without the undesirable traits of the male and female parents is obtained.

[0069] As used herein, the terms "cross", "cross-pollination" or "crossbreeding" refer to the process of applying the pollen (either artificially or naturally) from a flower on one plant to the ovule (stigma) of a flower on another plant.

[0070] As used herein, "selfing" refers to the production of seeds by self-fertilization or self-pollination, i.e., the pollen and ovules come from the same plant. The terms "selfing", "self-pollination" or "self-fertilization" are used interchangeably and refer to the process of applying the pollen (either artificially or naturally) from a flower on one plant to the ovule (stigma) of the same or a different flower on the same plant.

[0071] Under the condition of artificial control of self-pollination, after several generations, the poor ear rows are continuously eliminated, and the individual plants with better agronomic traits are selected for selfing, so as to obtain a line with relatively uniform agronomic traits and a relatively simple genetic basis, which is called an inbred line. Cultivating inbred lines is the material basis for maize crossbreeding, and excellent inbred lines can effectively promote the birth of breakthrough new varieties.

[0072] As used herein, the terms "inbreeding" or "inbred line" refer to relatively purebred lines.

[0073] As used herein, "backcrossing" refers to the process of repeatedly crossing the hybrid offspring produced by the hybridization of two parents with one of the parents. For example, the hybrid offspring, such as the first-generation hybrid (F1), can be crossed with one of its parents once or multiple times. Backcrossing can be used to transfer one or more single loci (such as one or more desired traits) from one genetic background to another. The purpose of backcrossing is to gradually strengthen the excellent characteristics of the parent in the hybrid offspring and transfer a certain advantage of the non-recurrent parent to the hybrid.

[0074] The "recurrent parent" is the parent used in backcrossing. Generally, a variety with excellent characteristics is selected as the female parent in the first hybridization, and as the male parent in subsequent backcrossings. Such a parent is called the recurrent parent in backcrossing.

[0075] As used herein, the term "progeny" refers to the offspring of a specific cross, usually the F1 generation. Generally speaking, progeny come from the mating of two individuals (i.e., the male parent and the female parent), although some species (especially some plants and hermaphrodite animals) can self (i.e., the same plant acts as the donor of both male and female gametes). "Offspring" can be F1, F2 or any subsequent generation, including any generation of plants produced by vegetative or sexual reproduction.

[0076] "Plant" generally refers to any plant at any stage of development, and particularly refers to maize plants in this article.

[0077] As used herein, the term "plant part" refers to and denotes a part of a plant, including individual cells and cell tissues (such as intact plant cells in a plant), cell aggregates, and tissue cultures, from which a plant can generally be regenerated. Examples of plant parts include, but are not limited to, individual cells and tissues from pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, seedlings, and seeds; and pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, seedlings, scions, rootstocks, seeds, protoplasts, callus, and the like.

[0078] "Dicot" refers to a flowering plant whose embryo has two seed halves or cotyledons, and dicots have branched leaf veins and flower parts that are multiples of four or five. "Monocot" is defined as a flowering plant whose embryo has one cotyledon or seed leaf, and monocots have parallel leaf veins and flower parts that are multiples of three.

[0079] As used herein, the term "variety" refers to a group of similar plants that can be distinguished from other varieties within the same species by their structural characteristics and performance. Developing inbred lines is the material basis for maize hybrid breeding, and excellent inbred lines can effectively promote the birth of breakthrough new varieties.

[0080] "Line" or "strain" is a group of individuals of the same parentage, which are usually inbred to some extent and are usually homozygous and isogenic (or nearly isogenic) at most loci. "Sub-line" refers to an inbred subgroup of offspring that is genetically different from other similar inbred subgroups descended from the same ancestor. The term "line" is also widely used to include, but not be limited to, a group of plants asexually reproduced from a single-parent plant by tissue culture techniques or a group of inbred plants that are genetically very similar due to being descendants of a common parent.

[0081] "Superior line" is an agronomically superior line that is obtained through many cycles of breeding and selection to achieve excellent agronomic performance. Many superior lines are available. "Superior population" is a class of superior individuals or lines that can be used to represent the state of the art with respect to agronomically superior genotypes of a given plant species.

[0082] "Genotype" refers to the genetic constitution of a cell or organism. "Germplasm" refers to the genetic material that includes the physical basis of the genetic quality of an organism. As used herein, germplasm includes seeds and living tissues from which new plants can grow; alternatively, another plant part, such as a leaf, stem, pollen, or cell, can be cultured into a whole plant. Germplasm resources provide a source of genetic traits that plant breeders use to improve commercial cultivars.

[0083] The term "homozygous" as used in the field of plant breeding refers to an organism having two identical alleles at a particular locus, and "heterozygous" refers to an organism having two different alleles at a particular locus.

[0084] "Linkage" refers to the phenomenon in which alleles on the same chromosome tend to segregate together more frequently than expected by chance if the transmission of alleles on the chromosome is independent. Genetic recombination occurs at a presumably random frequency throughout the genome. Genetic maps are constructed by measuring the recombination frequency between traits or markers. The closer the traits or markers are to each other on a chromosome, the lower the recombination frequency and the greater the degree of linkage. Two or more traits or markers are considered to be linked herein if they are usually co-segregated.

[0085] The functional gene corresponding to the gray leaf spot resistance locus qRgls1 is ZmWAK-RLK (see Chinese Patent Application No. 201910140479.1, corresponding Publication No. CN109705200A), and the nucleotide sequence of the functional gene ZmWAK-RLK is shown in SEQ ID NO:1:

[0086] SEQ ID NO:1:

[0087]

[0088] The protein sequence encoded by the functional gene ZmWAK-RLK is shown in SEQ ID NO:2:

[0089] SEQ ID NO:2 (* indicates the terminator):

[0090] MATMSAASHRCCASSLRALTVLFVLAALVSDVGGRHHHHVCPPYFSCGGFSNISYPFRRQGDPSGCGVQSYELVCTDTDATIRIGSGTYTVLSINSTYSYFWVVDADLDIQSSCPLPWWDHHGETSTANSYRRRTEFRPYFLYPNSMSIIFVNCSKPIENNDIYEPVPCLSNSSFIYLLTHYSYGYALAEILEPSCGYLAMIYLGGPGIPVPKNTSYPDVVKLMRNGFGLRFPSSIGDRGIRECFAESVRNFLKEPRKYQIVDILMVEELWSCFLDQHGSTNNVVTSVIIDIIKTIPICMWLLKSTHVFCRLVLMPLAVFVFLAHKYWKARITIDAVEKFLRMQQMLVPMRYAYTNIIAITGHFREKLGQGGYGSVYKGVLQPGEVHVAVKMLGNSNCNGEEFISEVATIGKIHHFNVVRLIGFCSEENRRALIYEFMPHGSLDKYIFSSEKSFSWDKLNEIALGIARGLNYLHHGCDMQIVHFDIKPHNILLDSNFVPKVADFGLAKLFPRDDSFVPLSATRGTIGYIAPEMVSRSFGVISSKSDVYSFGMLLLEMTGGRRNADPYAGSSSQAYYPSLVYSQLSQGDLGEISDGVDMHELEKKLCIIGLWCIQMKPQDRPTMSDVIEMLEVGVDGIQMPPRPFFCDDEGDSSYSAISESDTIEE*

[0091] Those skilled in the art should understand that when referring to the protein encoded by the functional gene ZmWAK-RLK, the present invention encompasses derivative sequences of SEQ ID NO:2 that retain the activity against gray leaf spot, for example, amino acid sequences having at least 80% sequence identity with SEQ ID NO:2 while retaining the activity against gray leaf spot, such as amino acid sequences having at least 85%, 90%, 95% or 99% sequence identity while retaining the activity against gray leaf spot; or amino acid sequences having one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30 or more) amino acid substitutions, deletions or insertions compared with SEQ ID NO:2 while retaining the activity against gray leaf spot. Preferably, the amino acid substitutions are conservative substitutions. Correspondingly, when referring to the functional gene ZmWAK-RLK, the present invention encompasses nucleotide sequences encoding SEQ ID NO:2 and its derivatives that retain the activity against gray leaf spot.

[0092] The functional gene corresponding to the gray leaf spot resistance locus qRgls2 is ZmPK (see Chinese Patent Application No. ZL201910160206.3, corresponding authorized publication number CN109705202B). The nucleotide sequence of this functional gene as ZmPK is shown in SEQ ID NO:3:

[0093] SEQ ID NO:3:

[0094] ATGGGCGCTTGCTTCTCCTCCGCCTCTGCCGCCCCCGCCGGCGCCGCCGTCGACGAGCGCCGCCCGTCCAAGGAGGGCGACGGCAAGAAGAGGCGCCGCGCCGCCGGGG

[0095] CATCGCCGGATGCCGCGGCGCCCGTGCGCGTGGAGTTCGGCTACGAGAGGGACTTC

[0096] GAGGCGCGCTACGAGGTCGGCCGCCTGCTCGGCCACGGCCAGTTCGGCTACACCTT

[0097] CGCCGCCACCGACCGCGGCTCTGGGGACCGCGTTGCCGTCAAGCGCATCGACAAGG

[0098] CCAAGGTGAGCTGCCGCCTGCCCCCCCGCACCCCAAGCCGCCGCGCTGTCCCTGTCT

[0099] CTGTCTCTCCTACTAGTAGTAGTAGCTGGTGGTGATTCCGAGCGCGTCTTTGGTCTG

[0100] GTGCATCGAACCACTTGTGCTTGGTGCATTTCGAGGGGATTCGGTGTAATTCCGTGC

[0101] AAATTGGGGATTTCTCTCCTGTTGCTTTCCGAGGTTTAGGTGTTTCGATTGGGACGC

[0102] GATTGGAGCCGTTCATTTTAGGACATTTCCGGTGCCTTTTGGGAGGCGTTTAGCTCA

[0103] ACGAGTAGCTCACTCACATTTCTAGCTGTTTGGCCGCTTCATTTCTCCCAAGCTTTCG

[0104] TTGTTTGCCGGTGGTTCTGAGCTGCGGGATCTTGACGTTGGCCAGAGAGGTGGTTTC

[0105] GACATTCAGGCATCTCGGATGACCTCTTAGTTTGGCACTACAGCTCTATTATTTCGG

[0106] GAACGACGTGTTGCTCAGTGCGCACCTCATTCATGGAAGTGGCAAGGTCGCTTGTCT

[0107] GCAGAACGGGGAAGGTGCTTTTCATCTGGCTATTCATGGAAAACGACTTGTTCAGTT

[0108] GCCCTACTAATAATTTCAATAAGATTGCCTGCCTCCTTGAATGGTTGGGGCTTGGAA

[0109] GGTTCCTGTCGAAGAAAAAGTCAGGAAAGATAACAATTGCGCACTTGCAGTGGACA

[0110] ACGCTTCCCTGTCTTCTATGCTATAGGTGGACAGCATTTTTCTAGGTATAATTAATTT

[0111] GACCTTCAAACATATGTATACTAACCAACGCGGTTTTGATTCCATCAAATGTTTTGG

[0112] ACTCTCTCTGCTGAACTGTCAAAGTTACTTCATGGGGCAAAATGTCAAATTTTCTGG

[0113] AACCTTCCGTAGTATATTTTGGAAATGAGTGTTTATTGTGTCATTGGAAATACCGTT

[0114] CATGTGTCTGTGACAGAATGTGTCACTAGAAAGCTGAATTGGTGTTGTCCTTGTCAA

[0115] AAAGGCACTAAACACGAGTCTGAAAATTAGGCCTGTTCTTGGTAAGGGAAGGAATC

[0116] TGAGCATCAATGCTGATAGGAATAGACTCTGTCTGTCAATATTGTTAACTTGTTTAT

[0117] AGGGCTTCGAGTTTTCAACTTTTGAGGCAGATAAGTAGGATACCTCTTTTGATCATG

[0118] ATATATAACATATTCTTATATACCTCAAGCCTTGCACTGTTAAGTTAATGTGGCATC

[0119] CTTTCTAGAGATCATGACCTCAAGTTGCATATGGATGCCAATAATATCGACACCAA

[0120] GTGAACATCAGTGTCTGTGGAATATGCCGAAAGCAGCCAACGTGCCATTACTGAAT

[0121] TTTCATATGATTATTATATTCTGTTTAGATTTATTTACGTCGGAACACAGTGAGATG

[0122] GTAACGTAATGAATCAAAATAGGCTATAAACATGCAATTCAACATATCATTATCAT

[0123] GCCCAAGTGTTTTGTCATTCTATCTTTATTCGTCCAAGAAGGACAAGCCTGGTGCAT

[0124] TGTTGAGGGAACCAGTTCTTCTGCAGTACTTCTAGGGAGGTAAAAATTCAACACCG

[0125] TTGGATGCAGATCTATCGAACCCAGGGACTTTGTGCTTCCAGTGAAAAGTTATATGG

[0126] ACCCATAGGCCAGAGGATGTGAGAGTTTTACCTCTCTGGAAGTTATATGCGCTAGC

[0127] ATTAGTGTGGTCATCAATGGGATCAAAGATGAGCTCCACCTTTGGTGTAGAGCTGG

[0128] AGCTAGGGGACTCTAGCATCCTGGCGCTCCAATCTTCCATCCAGTGAACTCTGTTTT

[0129] TTGGGTCTAGTAGGTCAAGGGTCCAGTTATTTTTTCTTTCTGCTGTAAAGTCTCTAGT

[0130] TAAGGTGTGAGTTTTGTATGGTGTTTTTTCGAGGTTTCCCCAAACCTCACCTTTTTTC

[0131] CTTCTTAATATAATGATATGCAGCTTTCCTGCGTATTCGAGAAAAGAAAGTTTTATC

[0132] TCTCTGGAAGTTAACTGCAGAGGAACTTGTTACATTGTTGAGAGTTGTCTCACCGAG

[0133] TCACCAGGTCGCTGGTTCAAAGCAGTCTCTCCACATTTATGTGGAAGGCTTGCCTCG

[0134] GTTTATCCCTTCCCAAGACTCTACTTGTGGGAGACTCTGGCATTGGGTCTGTCCTAT

[0135] GCCGTTGAAGCGCTAGGTTCGTTTATCCCTTCCCTATACCCACTTGTCAGAGCCTCC

[0136] AACACTGAGTCTGCCCTAAGCTTCCAAGTTCCAACACTGGGTCTGCCCTAGGCCGTC

[0137] GAAGCGTTATATGATTGCCATGTACTGTTATGCTTTGTTGCCTTCACATATTTTCCGT

[0138] TCGAAATCATCTCCTTGTTGCCTTCACATATTGCCTTGTTGCTTTCACATATTTTCTG

[0139] TTCCACGTCATACTTAGAAGTTAGAACACGTGATTTATGCCAATTAAGATTATTATT

[0140] TTATATAACAGATGACCCGCCCTGTTGCTGTGGAGGATGTGAAAAGAGAAGTGAAG

[0141] ATTCTTAAAGCACTTAAAGGACATCAGAATATTGTTCACTTCTACAATGCATTTGAG

[0142] GATGATTCATACGTGTACATTGTGATGGAGTAAGTAGGCCCATACACCTGTTCCTGC

[0143] TAATAGAGCATATCGATTTTGCTATGACTTTTTTCCCTAAAGTTTTAACATGAACAA

[0144] TATCTATCCTGTTTACAGAATCCTAGACACTAAAATGTCATTTCTAATTATCAATTAT

[0145] TCTATAGCTAAACCAGATGCAATCCTGATTTATTTTTCTTAACGTATGGATATATTG

[0146] GACTTTTCTTTCAAACCTGCATTTTGAATTTGATTACAGGGAACTATAACACTAATT

[0147] CAGAACTCTATCATGTTTAACATTTTTCTTGCATTGTTCTATGTTTGTCAACTTGACG

[0148] CACTTCTTAGATAATATAACATCATCTTCCACAGTCACCATTAGTTAGGACCTTGGA

[0149] CCTTCATGGTTCCGAAATTTAGCTAAGAATGGTATACATGGTCATGTGATTTCAAAT

[0150] AGATGTTCCTATATGCCAGAACCAACTCATAAGTCATAAGTTTTACCTTGTGTTTTT

[0151] GCAGGCTATGTGAGGGCGGTGAACTATTAGATCGGATTTTGGCAAAGTAAGTAGAT

[0152] AAGATCCCCATCTCTTTGTTTCCCGTACCTCATTCTTCGCCATTAAATTTATAGATTT

[0153] TTGTGCTGTAAAATCAGATTGCTTTATGTTGTTTGTCTGCTTTGTTTGATTTCTAGTT

[0154] GCTCGTTCAAGATCCTTTACTTAATGGTGTGCGTGTTTTGACAGAAAGAATAGCCGC

[0155] TATAGTGAGAAAGATGCTGCAGTGGTAGTCCGCCAAATGCTCAAAGTAGCTGCTGA

[0156] ATGCCATCTGCGTGGGTTAGTTCACCGAGATATGAAGCCTGAGGTAGAAATCAAAT

[0157] ACTTCAATCTCTTTGCACACAGTAAGCATTTGGTGATATTTCACTACTTCCTCAGGTC

[0158] ATGTAAGACTGTACCTATTTTCCTTCCCAGAACTTCCTTTTCAAATCGAACAAGGAG

[0159] GATTCACCACTAAAGGCGACAGATTTTGGTTTGTCAGATTTCATTAAGCCAGGTATC

[0160] TACTTGGGGCCATCTGAATCTGTCGGGAATCTGATAGGGGCAAGTCTGCAGTTTAG

[0161] CTGACCATTTTGTTGTCTAATGCATGCTTTAGGGAAGAAGTTCCATGACATTGTTGG

[0162] AAGTGCTTACTATGTCGCACCAGAAGTACTAAAACGACGGTCTGGTCCTGAGTCAG

[0163] ATGTTTGGAGCATAGGAGTCATAACCTACATTTTGCTCTGTGGGAGGCGCCCTTTTT

[0164] GGGATAAGACCGAAGACGGTATATTCAAGGAGGTAAGTGGATGGATTTTGCATACC

[0165] ATGTGCTTACATGTAAAATATGCTTGGTTAGAGTGCTGTACCAGGGATCAGCGTTTT

[0166] CAGCGTGCTGATACTGTTTTGTACAATGTGTTTCTACTTTCTACGTCATATAGCAGTG

[0167] TTTCTTTGTTAACTATTTCAGTGTCAAACTATTTGTCGTGTCACAACTCAGCAGTATA

[0168] ATTTTACTATTTTGAACACTGTAAACCTGCCTGGTCAGGTTATCCTTCAGTAATTTCT

[0169] CTACTAGCTACCAGAAACCCACTTTATGCAGGTGTTCAGTTTAATAACACCCACCAT

[0170] CTTTCAGATTTCTAATGTTCAGTGTTAGACAGACTTCATTAAGATGCACCTTAAGAT

[0171] GATTGTAAGTAGTAAAAGTGCTTTGCACTTTTGTTAACTTTTGAGTCTGAAGATGAC

[0172] TTGTGGTACCTATGACCTCAAGAAACCAAGGCATTGCCATTGGAATAGCTAATTCG

[0173] AATGAGCTTCAGATATGGCTATCTGTTTTAGTTTTGGACATCTGACTCAACTTTATA

[0174] GGATAATACTATATTAGCAATCTTTGAGGTCATTGTCTCAGCCAAAATAAGTTGCGG

[0175] TCTCTTTTTTACTGTCCTAAGCAGCAATATGGTTTCCATTTTCATTATACCAGCAACT

[0176] TCCACCTTTTTCTTGCTATTTAAATATCTTTATGCATTTTATCAGCAAGGACATGATA

[0177] CGATCGTATATGTGATATTCTACATCTTTTCACTTCTCATAATTAGGTTCTAAGGAAC

[0178] AAGCCTGATTTTCGTAAGAGGCCTTGGTCAAGCATCAGCCCAGGTGCTAAAGATTTT

[0179] GTTAAAAGGTTACTAGTGAAGAATCCAAGGGCCAGGCTAACAGCTGCTCAAGCTCT

[0180] CTGTAAGTTTTGGTATTTTTCATTAATTTACTAGCCTAGTCATGATGATCAGATTCAC

[0181] CTTCTCTATGTGAGAACAGAGAACACATATACATCTGGCAGTATGCCTTTCAATCAG

[0182] TTATGACAATGTAAATATGCAAAGACCGATGTTTTTTCTATCCTGCACCATTTTAGA

[0183] ACATTAATGGGGAAAAACCACAATATATTAGGAAAAATGTTTAATTATGTCCTGGT

[0184] CACTTGAAATGAACATATACCACTGAGGTTTTCTAGTTCTCATGCGTTCTTATAATG

[0185] ATCTAATAAGTCAGTGGAGGTTTGCTGCCCACCACCCCTACATTTGTATTGTGAATT

[0186] ACTATCATCTTTACTGATCCTGATTGTTCTTGATATGTTAAGCACATCCGTGGGTAA

[0187] GAGAAGGAGGGGAAGCATCCGATATCCCCGTCGACATATCTGTGTTATCAAACATG

[0188] CGTCAGTTTGTCAAGTACAGCCGTTTCAAGCAATTCGCGCTTCGGGTAATTACAGTG

[0189] ATTACAAAAAACAACACTGCATCGTTTATTTTTTCCTCACAATATTTCCTCGTGGCA

[0190] TGGTCAGGCTCTGGCGAGCACCCTTAACGAGGAAGAGCTATCAGATCTGAAGGATC

[0191] AGTTTGATGCAATTGATATCGATAAAAGTGGATCGATTAGTATCGAGGAAATGCGT

[0192] CATGTAGGTTCTGTTAGTGTTTGCTGATGAAAATGCCTTAGATCCTGAACTACTCTG

[0193] CGGTGCTGATTAATCTGTGCATGTTTCGGTAGGCCCTTGCAAAGGATCTTCCCTGGA

[0194] GATTGAAGGGTCCCCGTGTGCTGGAGATTATTCAAGCAGTAAGTTTGAGCCTTCTTC

[0195] TGGATCCAGCCCTTTCTTTGTTACCCCCCTTGTTTCCAAGAAAATAGCTGGCCTTGTT

[0196] CTGAGGGTATAACCAAAACTGCATCTTATTTTGTGGTAGATTGACAGCAACACTGAT

[0197] GGGCTCGTGGACTTCAAGGAGTTTGTTGCGGCAACTCTCCATATCCACCAGATGGC

[0198] GGAGCTCGACTCAGAAAGGTGGGGCATACGCTGCCAAGCTGCTTTCAGTAAGTTTG

[0199] ATCTTGACGGTGATGGATATATCACGCCGGAGGAACTCAGAATGGTAATTTTCTACT

[0200] CCTGTCTTGTTTCCATGTTGCTTCACCAACGAATGCACAGTTCACATAACCCTTATTA

[0201] TCATCACTGCTTCCCATGAATAACTAGCTGGCTCGACCATCATGAGATTCAGTACTT

[0202] GCGCCCTGTGCACTTGGTTTTGGTCCCGCTTGTTAGAATGAAGTAATTTATCAATGG

[0203] AAGCGCTGTAATATTTTAATCAGCGTTTAGATTTGATAAAGATAAAACATGTTCATT

[0204] GTTTGTGCCAAGAAATCCACTTACACAGATACTGAGAGTTGCACCGTAGATAACGC

[0205] TAATCGGCAGTATCCTAATCGAGATTTTCTTTCAAGGTGCAGCACCCTGGGTTGAAG

[0206] GGATCTATCGAGCCGCTGCTGGAGGAGGCCGACATCGACAAAGACGGCAAGATAA

[0207] GCCTGTCCGAGTTCCGCAAGCTCCTACGGACAGCGAGCATGAGCAACGTACCCAGC

[0208] CCAAGGGGGCCCCCAAACCCTCAGGCTCTGTGA

[0209] The protein sequence encoded by the functional gene ZmPK is shown in SEQ ID NO:4:

[0210] SEQ ID NO:4 (* indicates the terminator):

[0211] MGACFSSASAAPAGAAVDERRPSKEGDGKKRRRAAGASPDAAAPVRVEFGYERDFEARYEVGRLLGHGQFGYTFAATDRGSGDRVAVKRIDKAKMTRPVAVEDVKREVKILKALKGHQNIVHFYNAFEDDSYVYIVMELCEGGELLDRILAKKNSRYSEKDAAVVVRQMLKVAAECHLRGLVHRDMKPENFLFKSNKEDSPLKATDFGLSDFIKPGKKFHDIVGSAYYVAPEVLKRRSGPESDVWSIGVITYILLCGRRPFWDKTEDGIFKEVLRNKPDFRKRPWSSISPGAKDFVKRLLVKNPRARLTAAQALSHPWVREGGEASDIPVDISVLSNMRQFVKYSRFKQFALRALASTLNEEELSDLKDQFDAIDIDKSGSISIEEMRHALAKDLPWRLKGPRVLEIIQAIDSNTDGLVDFKEFVAATLHIHQMAELDSERWGIRCQAAFSKFDLDGDGYITPEELRMVQHPGLKGSIEPLLEEADIDKDGKISLSEFRKLLRTASMSNVPSPRGPPNPQAL*

[0212] Those skilled in the art should understand that when referring to the protein encoded by the functional gene ZmPK, the present invention encompasses derivative sequences of SEQ ID NO: 4 that retain the activity against gray leaf spot, for example, amino acid sequences having at least 80% sequence identity with SEQ ID NO: 4 while retaining the activity against gray leaf spot, such as amino acid sequences having at least 85%, 90%, 95% or 99% sequence identity while retaining the activity against gray leaf spot; or amino acid sequences having one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30 or more) amino acid substitutions, deletions or insertions compared with SEQ ID NO: 4 while retaining the activity against gray leaf spot. Preferably, the amino acid substitutions are conservative substitutions. Correspondingly, when referring to the functional gene ZmPK, the present invention encompasses nucleotide sequences encoding SEQ ID NO: 4 and its derivatives that retain the activity against gray leaf spot.

[0213] Example

[0214] Those skilled in the art will be clearer about the technical solutions and technical effects of the present invention by referring to the following examples. Those skilled in the art should understand that the following examples are only for illustrative purposes and are not construed as limiting the protection scope of the present invention in any way. The protection scope of the present invention is defined by the claims. Without departing from the spirit and scope of the present invention, those skilled in the art can make corresponding modifications to the embodiments of the present invention, and these modifications are also within the scope of the present invention.

[0215] Example 1: Breeding of Maize with Improved Gray Leaf Spot Resistance Locus qRgls1 and Identification of Disease Resistance

[0216] I. Obtaining of Maize with Improved qRgls1 Locus

[0217] 1. Using the tropical disease-resistant material Y32 as the male parent and the temperate disease-susceptible material Q11 as the female parent for hybridization to obtain hybrid F1 generation plants;

[0218] 2. Using the F1 generation plants as the male parent and Q11 as the female parent for hybridization (i.e., backcrossing) to obtain BC1F1 generation plants;

[0219] 3. Detecting the genotypes of BC1F1 generation plants using the molecular markers 35-5-3F / R and GI90F / R linked to the qRgls1 locus;

[0220] 35-5-3F: 5’-AAGCACAGAGATGAGACGCT-3’ (SEQ ID NO: 5)

[0221] 35-5-3R: 5’-ACGTGTTCCAGCTTCCAGTT-3’ (SEQ ID NO: 6)

[0222] GI90F: 5’-GGTTGCTTTGCCATGAAGTT-3’ (SEQ ID NO:7)

[0223] GI90R: 5’-CCCATGGACGGTGAAAGTAT-3’ (SEQ ID NO:8)

[0224] 4. Select the plants heterozygous at the qRgls1 locus in each generation of plants as male parents, Q11 as female parent, and conduct 6 consecutive crosses (i.e., backcrosses) to obtain BC7F1 generation plants; at this time, the genetic background has basically reverted to the recurrent parent Q11;

[0225] 5. Detect the genotypes of BC7F1 generation plants using the molecular markers 35-5-3F / R and GI90F / R linked to the qRgls1 locus, select the heterozygous individuals at this locus for self-crossing to obtain BC7F2 generation plants;

[0226] 6. Detect the genotypes of BC7F2 generation plants using the molecular markers 35-5-3F / R and GI90F / R, respectively select the plants carrying homozygous resistant genes and homozygous susceptible genes at the qRgls1 locus, and self-cross them respectively to finally obtain BC7F3 generation plants: including the plants Q11 carrying homozygous resistant genes at the qRgls1 locus qRgls1 and the control plants Q11 carrying homozygous susceptible genes CK -1 .

[0227] II. Identification of disease resistance of plants

[0228] 1. Test plants:

[0229] After detecting the genotypes in BC7F3 generation plants, select the homozygous plants for self-crossing and harvest the seeds, and then plant the seeds to obtain BC7F4 generation plants for disease resistance identification.

[0230] Use Q11 qRgls1 carrying homozygous resistant genes at the qRgls1 locus in BC7F4 generation CK-1 and the control material Q11 carrying homozygous susceptible genes as test plants.

[0231] 2. Disease resistance identification

[0232] The disease resistance identification was carried out in Baoshan City, Yunnan Province. Under natural conditions, it was infected by *Cecrosporazeae-maydis* Tehon & Daniels, and gray leaf spot occurred. Phenotypic investigation was carried out two weeks after pollination. Using a five-level grading standard, each maize plant was graded according to the proportion of the lesion area. The disease incidence degree of the population composed of the same genotype was expressed by the disease severity index (DSI).

[0233] Among them, the disease severity index (DSI) was calculated according to formula I

[0234]

[0235] The grading standard of the disease level was based on the percentage of the lesion area in the maize leaf area (denoted as X). The grading standard and the corresponding assignment are shown in Table 1.

[0236] Table 1. Grading standard and assignment of maize gray leaf spot disease level

[0237] Grading criteria and assignment Percentage (X) of the lesion area in the maize leaf area Grade 1 (assigned value 0) 0％＜X≤5％ Grade 3 (assigned value 0.25) 5％＜X≤10％ Grade 5 (assigned value 0.5) 10％＜X≤30％ Grade 7 (assigned value 0.75) 30％＜X≤70％ Grade 9 (assigned value 1) 70％＜X≤100％

[0238] The results are shown in Figure 1 , and the results showed that compared with the control plants with homozygous susceptible genes at the qRgls1 locus, the resistance of the plants carrying homozygous resistant genes at the qRgls1 locus was significantly improved, and the disease severity index decreased by 17.6%.

[0239] Example 2: Breeding and disease resistance identification of maize improved at the gray leaf spot resistance locus qRgls2

[0240] I. Obtaining of maize improved at the qRgls2 locus

[0241] 1. Using the tropical disease-resistant material Y32 as the male parent and the temperate susceptible material Q11 as the female parent for hybridization to obtain the hybrid F1 generation plants;

[0242] 2. Using the F1 generation plants as the male parent and Q11 as the female parent for hybridization (i.e., backcrossing) to obtain the BC1F1 generation plants;

[0243] 3. Detecting the genotypes of the BC1F1 generation plants using the molecular markers IDP36F / R and Q22F / R linked to the qRgls2 locus;

[0244] IDP36F: 5’-TCCTCCTGGCAGTCTAGGAA-3’ (SEQ ID NO:9)

[0245] IDP36R: 5’-TCCGTTTTGTTCTGTTGTGC-3’ (SEQ ID NO:10)

[0246] Q22F: 5’-GGTGCTCCATTGATTGACCT-3’ (SEQ ID NO:11)

[0247] Q22R: 5’-CGCCCTGTTCTTATTTGCTC-3’ (SEQ ID NO:12)

[0248] 4. Select the plants heterozygous at the qRgls2 locus in each generation of plants as male parents and Q11 as female parents, and perform 6 consecutive crosses (i.e., backcrosses) to obtain BC7F1 generation plants; at this time, the genetic background has basically reverted to the recurrent parent Q11;

[0249] 5. Detect the genotypes of BC7F1 generation plants using the molecular markers IDP36F / R and Q22F / R linked to the qRgls2 locus, and select the plants heterozygous at the qRgls2 locus for self-crossing to obtain BC7F2 generation plants;

[0250] 6. Detect the genotypes of BC7F2 generation plants using the molecular markers IDP36F / R and Q22F / R, and separately select the individuals carrying the homozygous resistant gene and the susceptible gene at the qRgls2 locus, and perform self-crossing on each of them. Finally, obtain BC7F3 generation plants: including plants Q11 carrying the homozygous resistant gene at the qRgls2 locus qRgls2 and the control plants Q11 carrying the homozygous susceptible gene CK -2 .

[0251] II. Identification of plant disease resistance

[0252] 1. Test plants:

[0253] After detecting the genotypes in the BC7F3 generation plants, select the homozygous plants for self-crossing and harvest the seeds, and then plant the seeds to obtain the BC7F4 generation plants for disease resistance identification.

[0254] Use the plants Q11 carrying the homozygous resistant gene at the qRgls2 locus in the BC7F4 generation qRgls2 and the control plants Q11 carrying the homozygous susceptible gene CK-2 as test plants.

[0255] 2. Disease resistance identification

[0256] In Baoshan City, Yunnan Province, identify the disease resistance of the plants Q11 carrying the homozygous resistant gene at the qRgls2 locus qRgls2 and the control plants Q11 carrying the homozygous susceptible gene CK-2 in the same method as in Example 1.

[0257] The results are shown in Figure 2, The results showed that, compared with the control plants containing the susceptible gene at the qRgls2 locus, the disease resistance of the plants carrying the homozygous resistant gene at the qRgls2 locus was significantly improved, and the disease index was reduced by 25%.

[0258] Example 3: Breeding and disease resistance identification of maize improved by pyramiding qRgls1 and qRgls2 loci

[0259] I. Obtaining maize improved by pyramiding qRgls1 and qRgls2

[0260] 1. Using the plant Q11 carrying the homozygous resistant gene at the qRgls1 locus obtained in Example 1 qRgls1 and the plant Q11 carrying the homozygous resistant gene at the qRgls2 locus obtained in Example 2 qRgls2 to perform hybridization to obtain F1 generation plants heterozygous at both the qRgls1 and qRgls2 loci;

[0261] 2. Self-crossing the F1 plants obtained in step 1 to obtain F2 generation plants;

[0262] 3. Using the molecular markers 35-5-3F / R, GI90F / R, IDP36F / R and Q22F / R to detect the genotypes of the F2 generation plants respectively, selecting the plants carrying the homozygous resistant genes at both the qRgls1 and qRgls2 loci for self-crossing to obtain the plant Q11 carrying the homozygous resistant genes at both the qRgls1 and qRgls2 loci qRgls1 / 2 ; in addition, selecting the plants carrying the homozygous susceptible genes at both loci for self-crossing to obtain the control plant Q11 CK .

[0263] II. Disease resistance identification of plants

[0264] 1. Test plants:

[0265] Using the plant Q11 carrying the homozygous resistant genes at both the qRgls1 and qRgls2 loci qRgls1 / 2 and the control plant Q11 CK as test plants.

[0266] 2. Disease resistance identification

[0267] According to the same method as in Example 1, in Baoshan City, Yunnan Province, the plant Q11 carrying the homozygous resistant genes at both the qRgls1 and qRgls2 loci qRgls1 / 2 and the control plant Q11 CK were subjected to disease resistance identification.

[0268] The results are shown in Figure 3, The results showed that, compared with the control plants containing the susceptible genes at the qRgls1 and qRgls2 loci, the disease resistance of the plants carrying the homozygous resistant genes at the qRgls1 and qRgls2 loci simultaneously increased significantly, and the corresponding disease index decreased by 55.6%. Moreover, the inventors unexpectedly found that, compared with the maize plants carrying the homozygous resistant genes at a single locus, the plants carrying the homozygous resistant genes at the qRgls1 and qRgls2 loci simultaneously showed a synergistic effect on the resistance to gray leaf spot, and the percentage of the significant decrease in the disease index was significantly higher than the sum of the percentages of the significant decrease in the disease indices of the two single homozygous loci.

[0269] Those skilled in the art will further recognize that the present invention may be embodied in other specific forms without departing from its spirit or central characteristics. Since the foregoing description of the present invention has only disclosed its exemplary embodiments, it should be understood that other variations are considered to be within the scope of the present invention. Therefore, the present invention is not limited to the specific embodiments described in detail herein. Instead, reference should be made to the appended claims to indicate the scope and content of the present invention.

Claims

1. A method for cultivating a gray leaf spot-resistant maize inbred line, the method comprising: (1) Using the tropical gray leaf spot-resistant material Y32 as the donor parent, cross and backcross it with the temperate susceptible material Q11 as the recipient parent, and perform the following two selections: (i) From the backcross progeny, a plant heterozygous for the qRgls1 locus is selected as the male parent and hybridized with Q11 to continue the next round of backcrossing. The backcrossing is repeated 6 times until the BC7F1 generation, in which the genetic background of the BC7F1 generation material is basically restored to the recurrent parent Q11. A plant heterozygous for the qRgls1 locus is selected for self-pollination to obtain the improved material Q11 carrying the homozygous disease resistance gene at the qRgls1 locus qRgls1 and the control material Q11 carrying the susceptible gene CK-1 ; (ii) Select the plants heterozygous at the qRgls2 locus from the backcross progeny as male parents and cross them with Q11 to continue the next round of backcrossing. Backcross six times until the BC7F1 generation, in which the genetic background of the BC7F1 generation material basically reverts to the recurrent parent Q11. Select the plants heterozygous at the qRgls2 locus for selfing to obtain the improved material Q11 carrying the homozygous disease-resistant gene at the qRgls2 locus qRgls2 and the control material Q11 carrying the susceptible gene CK-2 ; (2) The obtained improved material Q11 qRgls1 With the obtained improved material Q11 qRgls2 Perform hybridization and then self-cross the hybrid offspring to obtain the improved material Q11 that carries homozygous disease-resistant genes at both the qRgls1 and qRgls2 loci qRgls1 / 2 And the control material Q11 containing homozygous susceptible genes CK , Among them, the improved material Q11 that simultaneously carries homozygous disease-resistant genes at the qRgls1 and qRgls2 loci qRgls1 / 2 is a gray leaf spot-resistant maize inbred line material, and the disease-resistant genes are ZmWAK-RLK and ZmPK.

2. The method according to claim 1, wherein the method further comprises collecting seeds of inbred line Q11 that homozygously carry disease-resistant genes at both the qRgls1 and qRgls2 loci. qRgls1 / 2 of the seeds.

3. The method according to claim 1, wherein molecular markers linked to the qRgls1 locus are used to detect and select maize plants that are heterozygous or homozygous at the qRgls1 locus.

4. The method according to claim 3, wherein the molecular markers linked to the qRgls1 locus are 35-5-3F / R shown in SEQ ID NO:5-6 and GI90F / R shown in SEQ ID NO:7-8, or GZ204, IDP2, IDP11, M2, 18-5, SNP2 or IDP5.

5. The method according to claim 1 or 3, wherein molecular markers linked to the qRgls2 locus are used to detect and select maize plants that are heterozygous or homozygous at the qRgls2 locus.

6. The method according to claim 5, wherein the molecular markers linked to the qRgls2 locus are IDP36F / R shown in SEQ ID NO:9-10 and Q22F / R shown in SEQ ID NO:11-12, or G346, DD3, M23 or DD11.

7. A plant or a part thereof of a gray leaf spot-resistant maize material, wherein the plant or the part thereof homozygously carries disease-resistant genes at both the qRgls1 and qRgls2 loci.

8. The plant or the part thereof according to the claim, wherein the plant or the part thereof comprises progeny plants, seeds, single cells, cell tissues, cell clusters or tissue cultures.

9. An isolated genome of a gray leaf spot-resistant maize material, wherein the genome homozygously carries disease-resistant genes at both the qRgls1 and qRgls2 loci, and wherein the disease-resistant genes are ZmWAK-RLK and ZmPK.

10. A method for cultivating a maize variety with resistance to gray leaf spot and one or more other desired traits, which includes introducing one or more exogenous nucleic acids encoding a protein conferring the desired trait into a maize material that homozygously carries disease-resistant genes at the qRgls1 and qRgls2 loci, for example, by transgenic means or by hybridization.

11. A method for increasing maize yield, which includes planting a maize material or its seeds that homozygously carries disease-resistant genes at the qRgls1 and qRgls2 loci, or planting a maize material or its seeds that homozygously carries disease-resistant genes at the qRgls1 and qRgls2 loci and has other desired traits.

12. The method according to claim 10 or 11, wherein the other desired traits are one or more of the following: herbicide tolerance, drought tolerance, heat tolerance, tolerance to low or high soil pH levels, salt tolerance, bacterial disease resistance, viral disease resistance, fungal disease resistance, pest resistance (e.g., nematode resistance or insect resistance), male sterility, site-specific recombination; abiotic stress tolerance, improved phosphorus characteristics, improved antioxidant characteristics; improved essential amino acid characteristics of seeds, reduced phytate, improved fatty acid metabolism, and improved carbohydrate metabolism.

13. Use of a maize inbred line that homozygously carries disease-resistant genes at the qRgls1 and qRgls2 loci in cross-breeding, wherein the maize inbred line that homozygously carries disease-resistant genes at the qRgls1 and qRgls2 loci replaces the tropical gray leaf spot-resistant material Y32 as the male parent described in claim 1, and a maize susceptible material that carries susceptible genes at the qRgls1 and qRgls2 loci is used as the female parent, and cross-breeding is carried out according to the cross-breeding, backcrossing, selection, and selfing procedures described in claim 1 to obtain a gray leaf spot-resistant maize inbred line.

14. A method for cultivating a plant with enhanced disease resistance, the method including: Using the disease-resistant plant material as the male parent, the corresponding susceptible plant material as the hybrid female parent and recurrent parent, and through hybridization and a series of backcrosses, make two or more disease-resistant loci carry homozygous disease-resistant genes simultaneously, so as to obtain a plant or its seeds that carry homozygous disease-resistant genes at two or more disease-resistant loci. Among them, the plant that carries homozygous disease-resistant genes at two or more disease-resistant loci has enhanced disease resistance. Among them, the hybridization and a series of backcrosses are carried out according to the step process of the method described in claim 1 for hybridization, backcrossing, selection and selfing, and finally obtain a plant that carries homozygous disease-resistant genes at two or more disease-resistant loci.

15. A method for cultivating a plant with enhanced excellent traits, the method including: Using the plant material with excellent traits as the male parent, the plant material without this excellent trait as the hybrid female parent and recurrent parent, and through hybridization and a series of backcrosses, make two or more loci related to excellent traits carry homozygous genes related to excellent traits simultaneously, so as to obtain a plant or its seeds that carry homozygous genes related to excellent traits at two or more loci related to the excellent traits. Among them, the plant that carries homozygous genes related to excellent traits at two or more loci related to the excellent traits has enhanced excellent traits. Among them, the hybridization and a series of backcrosses are carried out according to the step process of the method described in claim 1 for hybridization, backcrossing, selection and selfing, and finally obtain a plant that carries homozygous genes related to excellent traits at two or more loci related to the excellent traits.

16. The method according to claim 14 or 15, wherein the plant is a dicotyledonous plant or a monocotyledonous plant.

17. A method for cultivating a gray leaf spot-resistant maize inbred line, the method including: (1) Using the gray leaf spot-resistant maize material that simultaneously carries qRgls1 and qRgls2 as the donor parent, cross and backcross it with the susceptible maize material as the recipient parent, and perform the following two selections: (i) Select a single plant heterozygous at the qRgls1 locus from the backcross progeny as the male parent and cross it with the susceptible maize material to continue the next round of backcrossing. Backcross six times until the BC7F1 generation. Among them, the genetic background of the BC7F1 generation material basically reverts to the susceptible maize material (as the recurrent parent). Select a single plant heterozygous at the qRgls1 locus for selfing to obtain improved material 1 carrying homozygous disease-resistant genes at the qRgls1 locus and control material 1 carrying susceptible genes. (ii) Select a single plant heterozygous at the qRgls2 locus from the backcross progeny as the male parent and cross it with the susceptible maize material to continue the next round of backcrossing. Backcross six times until the BC7F1 generation. Among them, the genetic background of the BC7F1 generation material basically reverts to the susceptible maize material (as the recurrent parent). Select a single plant heterozygous at the qRgls2 locus for selfing to obtain improved material 2 carrying homozygous disease-resistant genes at the qRgls2 locus and control material 2 carrying susceptible genes. (2) Hybridize the obtained improved material 1 with the obtained improved material 2, and then self-cross the hybrid offspring to obtain improved material 3 that simultaneously carries homozygous disease-resistant genes at the qRgls1 and qRgls2 loci and control material 3 that contains two susceptible genes. Among them, the improved material 3 that simultaneously carries homozygous disease-resistant genes at the qRgls1 and qRgls2 loci is a gray leaf spot-resistant maize inbred line material, and the disease-resistant genes are ZmWAK-RLK and ZmPK.

Images