High-yield urolithin A recombinant bacterium and application thereof

Abstract

The invention relates to a high-yield urolithin A recombinant bacterium and application thereof, and belongs to the technical field of gene engineering. Escherichia coli Nissle 1917 is used as a starting strain, UcdCFO synthase, mocA enzyme and xdhC enzyme are overexpressed in the escherichia coli Nissle 1917, expression of the mocA enzyme and the xdhC enzyme is jointly regulated and controlled through a promoter and RBS, the synthesis capacity of recombinant bacteria on urolithin A is enhanced, the finally obtained recombinant bacteria can synthesize urolithin A with the concentration of 40 micromol / L or above through fermentation culture, and a new direction is pointed out for biosynthesis of urolithin A.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a recombinant bacterium with high yield of urolithin A and its application. Background Art

[0002] Urolithin A (Uro-A) is a metabolite of ellagitannin (ET), and was first officially discovered and named in 2005. Its molecular formula is C 13 H8O4, and its relative molecular mass is 228.2. In recent years, a number of studies have revealed that urolithin A has significant anti-tumor activity. It shows certain inhibitory effects on various tumors including endometrium, breast, and prostate, as well as cardiovascular and cerebrovascular diseases, and also shows inhibitory potential for various malignant tumors such as liver cancer, gastric cancer, and colon cancer. Among the known mammalian intestinal metabolites, urolithin A has the strongest antioxidant activity, second only to compounds such as proanthocyanidin oligomers, catechin, epicatechin, and 3,4-dihydroxyphenylacetic acid.

[0003] Currently, the industrial production of urolithin A mainly relies on chemical synthesis methods. However, this process not only takes a long time, has a high cost, and consumes a large amount of energy, making the price of the final product unaffordable for the general public. However, urolithin A can also be obtained by converting ellagitannin into the required product by intestinal microorganisms in the body or in vitro. It should be noted that not everyone can produce urolithin substances. According to the research results, people can be divided into three metabolic types: type A, type B, and type 0. Type A people can completely convert ellagitannin into urolithin A, accounting for about 67.1% of the total population; type B people can produce not only urolithin A, but also urolithin B or iso-urolithin A; while type 0 people cannot produce any urolithin metabolites. Therefore, there is an urgent need for a method for biosynthesis of urolithin A with short time consumption, low cost, and high yield to meet the demand of type 0 people for urolithin A. Summary of the Invention

[0004] To this end, the technical problem to be solved by the present invention is to overcome the problem in the prior art that there is a lack of a method for biosynthesis of urolithin A with short time consumption, low cost, and high yield.

[0005] To solve the above technical problems, the present invention provides a recombinant bacterium with high yield of urolithin A and its application. The present invention uses Escherichia coli Nissle 1917 as the starting strain, overexpresses UcdCFO synthase, mocA enzyme and xdhC enzyme in Escherichia coli Nissle 1917, and co-regulates the expression of mocA enzyme and xdhC enzyme through a promoter and RBS, strengthening the synthesis ability of the recombinant bacterium for urolithin A. Finally, the obtained recombinant bacterium can synthesize more than 40 μmol / L of urolithin A through fermentation culture, indicating a new direction for the biosynthesis of urolithin A.

[0006] The first object of the present invention is to provide a recombinant bacterium with high yield of urolithin A, which is obtained by modifying Escherichia coli as the host, and the modification includes: overexpressing UcdCFO synthase, molybdenum cofactor cytidyltransferase and xdhC enzyme;

[0007] Among them, the expression of the molybdenum cofactor cytidyltransferase and xdhC enzyme is co-regulated by one of the promoters shown in SEQ ID NOs. 1-8 and one of the RBS sequences shown in SEQ ID NOs. 9-16.

[0008] Furthermore, the gene sequence of promoter J23100 is as shown in SEQ ID NO. 1, the gene sequence of promoter J23104 is as shown in SEQ ID NO. 2, the gene sequence of promoter J23108 is as shown in SEQ ID NO. 3, the gene sequence of promoter Ptrc is as shown in SEQ ID NO. 4, the gene sequence of promoter Plac is as shown in SEQ ID NO. 5, the gene sequence of promoter Ptac is as shown in SEQ ID NO. 6, the gene sequence of promoter Ptuf is as shown in SEQ ID NO. 7, and the gene sequence of promoter Psod is as shown in SEQ ID NO. 8.

[0009] Furthermore, the gene sequence of B0029 is as shown in SEQ ID NO. 9, the gene sequence of B0030 is as shown in SEQ ID NO. 10, the gene sequence of B0031 is as shown in SEQ ID NO. 11, the gene sequence of B0032 is as shown in SEQ ID NO. 12, the gene sequence of B0033 is as shown in SEQ ID NO. 13, the gene sequence of B0034 is as shown in SEQ ID NO. 14, the gene sequence of B0035 is as shown in SEQ ID NO. 15, and the gene sequence of B0064 is as shown in SEQ ID NO. 16.

[0010] Furthermore, the gene sequence of the UcdCFO synthase is as shown in SEQ ID NO. 17.

[0011] Further, the gene sequence of the molybdenum cofactor cytidine transferase is as shown in SEQ ID NO.18.

[0012] Further, the gene sequence of the xdhC enzyme is as shown in SEQ ID NO.19.

[0013] Further, the Escherichia coli includes Escherichia coli Nissle 1917.

[0014] The second object of the present invention is to provide a method for producing urolithin A, which is to inoculate the above recombinant bacteria into a culture medium for fermentation culture to obtain the urolithin A, wherein the fermentation culture is in an anaerobic environment.

[0015] Further, the fermentation step includes: inoculating the recombinant Escherichia coli Nissle1917 into a fermentation medium for culture, and taking the supernatant of the fermentation broth after fermentation to obtain the crude extract of urolithin A.

[0016] Further, the temperature of the fermentation culture is 20 - 60°C. Temperature affects the growth of Escherichia coli Nissle1917. Escherichia coli Nissle1917 can grow at 30 - 42°C, and the optimum growth temperature of Escherichia coli Nissle1917 is 37°C. Preferably, the temperature of the fermentation culture is 37°C.

[0017] Further, the pH of the fermentation culture is 4 - 9. pH also affects the growth of Escherichia coli Nissle1917. Escherichia coli Nissle1917 can grow at a pH of 4 - 9, and the optimum pH of Escherichia coli Nissle1917 is 7. Preferably, the pH of the fermentation process is 6.5 - 7.5.

[0018] Further, the culture medium includes a carbon source, a nitrogen source, inorganic salts and metal ions.

[0019] The third object of the present invention is to provide an application of the above recombinant bacteria in the preparation of urolithin A.

[0020] Advantages of the present invention:

[0021] The recombinant bacteria of the present invention use Escherichia coli as the starting strain, overexpress UcdCFO synthase, mocA enzyme and xdhC enzyme in Escherichia coli, and co-regulate the expression of mocA enzyme and xdhC enzyme through a promoter and an RBS, strengthening the synthesis ability of the recombinant bacteria for urolithin A. Finally, the obtained recombinant bacteria can synthesize more than 40 μmol / L of urolithin A after fermentation culture, which is much higher than the biological synthesis yield of urolithin A in the prior art, indicating a new direction for the biological synthesis of urolithin A. Description of the drawings

[0022] To make the content of the present invention easier to be clearly understood, the following further elaborates on the present invention in detail according to specific embodiments of the present invention in combination with the accompanying drawings, where

[0023] Figure 1 is the metabolic schematic diagram of urolithin A synthesis from urolithin C by Escherichia coli Nissle 1917;

[0024] Figure 2 is the influence of overexpression of mocA and xdhC genes on the yield of urolithin A;

[0025] Figure 3 is the influence of promoters with different strengths on the yield of urolithin A;

[0026] Figure 4 is the influence of ribosome binding sites (RBS) with different strengths on the yield of urolithin A;

[0027] Figure 5 is the mass spectrum of urolithin A;

[0028] Figure 6 is the mass spectrum of the strain. Detailed Embodiments

[0029] The following further illustrates the present invention in combination with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the examples given are not intended to limit the present invention.

[0030] Strain: Escherichia coli Nissle 1917 (Escherichia coli Nissle 1917);

[0031] Plasmid: pMUT1;

[0032] LB medium: Yeast extract 5 g / L, Tryptone 10 g / L, Sodium chloride 10 g / L;

[0033] TB medium: Tryptone: 24 g / L, Yeast extract: 24 g / L, Glycerol: 4 mL / L, Potassium phosphate (K2HPO4): 9.4 g / L, Potassium dihydrogen phosphate (KH2PO4): 2.2 g / L;

[0034] Preparation of Escherichia coli competent cells: First, pick a single colony from a fresh plate and inoculate it into 5 mL of LB medium, and culture it overnight with shaking at 37 °C. The next day, take 1 mL of the overnight cultured bacterial solution and add it to 100 mL of fresh LB medium, and culture it with shaking at 37 °C until OD 600It is about 0.4 - 0.6. Transfer the culture medium to a centrifuge tube, centrifuge at 4°C and 4000 rpm for 10 minutes, and discard the supernatant. Resuspend the bacterial cells with ice-cold 0.1M CaCl2 solution to make the final volume about 1 / 10 of the original culture medium volume, and then place the bacterial suspension on ice for 30 minutes. Centrifuge again at 4°C and 4000 rpm for 10 minutes, discard the supernatant, and resuspend the bacterial cells with ice-cold 0.1M CaCl2 solution to make the final volume about 1 / 100 of the original culture medium volume. Finally, aliquot the resuspended bacterial suspension into sterile 1.5 mL centrifuge tubes, about 100 μL per tube, and quickly store them in an -80°C refrigerator for subsequent transformation experiments.

[0035] Transformation of E. coli competent cells: Add the liquid to be transformed containing the DNA fragment or plasmid to the competent cells and mix well, place on ice for 30 min, perform heat shock at 42°C for 90 s, then add antibiotic-free medium, and culture for 45 min. After centrifugation, retain 100 μL of the bacterial suspension and spread it on a screening plate with the corresponding antibiotic.

[0036] Sample collection of urolithin A: Centrifuge the fermentation broth at 10000×g and 4°C for 10 min, and the obtained supernatant is the crude extract of urolithin A. Take 5.0 mL of the crude extract of urolithin A, extract it with an equal volume of ethyl acetate acidified with 1.5% formic acid, and let it stand for 6 h. Separate the organic phase, rotary evaporate it using a vacuum concentration centrifuge for about 4 h, then redissolve it with 1 mL of organic solvent CH3CN:H2O:H-COOH (80:19.9:0.1, V:V:V), mix well, filter it through a 0.22 μm filter membrane, and add it to an HPLC sample vial and make a mark.

[0037] HPLC and UPLC-MS detection and analysis of urolithin A:

[0038] HPLC analysis conditions: Perform chromatographic separation and analysis of the sample on a Hypersil GOLD aQ-C18 column (Thermo, USA) with a size of 250×4.6 mm and a particle size of 5 μm. Use acetonitrile and 0.5% formic acid as the mobile phase, with an injection volume of 100 μL and a flow rate of 0.8 mL / min. Record under the condition of 305 nm. The elution gradient is: 0 - 15 minutes, 0 - 20% acetonitrile; 15 - 20 minutes, 20 - 70% acetonitrile; 20 - 21 minutes, 70 - 95% acetonitrile; 21 - 24 minutes, 95 - 100% acetonitrile; 24 - 25 minutes, 100 - 20% acetonitrile. Analysis results ( Figure 4 )。

[0039] UPLC-MS analysis conditions: Chromatographic separation and analysis of samples were performed using a Poroshell 120 HILIC-Z chromatographic column (100 mm × 2.1 mm, 2.7 μm, Agilent, California, USA). Injection volume: 10 μL. Mobile phase composition (flow rate 0.4 mL / min): Solvent A (10 mM ammonium formate and 0.1% formic acid aqueous solution) and B (0.1% formic acid acetonitrile solution). Isocratic elution: 0 - 3 min, 50% A. The ESI source was operated in positive and negative ion modes to obtain dynamic multiple reaction monitoring (MRM) data. Temperature: 350 °C, drying gas flow: 10 L·min -1 .

[0040] Example 1: Construction of highly active strains

[0041] (1) Construction of UcdCFO synthase

[0042] According to the gene sequence of the UcdCFO synthase gene cluster of Enterobacter bolteae, the nucleotide sequence of gene pmUcdCFO was synthesized by GENEWIZ (Suzhou) as shown in SEQ ID NO.17.

[0043] A primer pair was designed to ligate the pmUcdCFO gene sequence to plasmid pMUT1, and the recombinant expression plasmid pMUT1-pmUcdCFO was constructed and transferred into Escherichia coli to obtain the recombinant strain UcdCFO.

[0044] (2) Overexpression of mocA and xdhC genes and construction of plasmids

[0045] According to the gene sequences of mocA and xdhC genes of Escherichia coli K12, the nucleotide sequences of the genes were synthesized by GENEWIZ (Suzhou) as shown in SEQ ID NO.18 and SEQ ID NO.19.

[0046] Primer pairs were designed for the overexpression of mocA and xdhC genes. Using pMUT1-pmUcdCFO as a template, primers pMUT1-pmUcdCFO-mocA-F and pMUT1-pmUcdCFO-mocA-R, pMUT1-pmUcdCFO-xdhC-F and pMUT1-pmUcdCFO-xdhC-R were designed for PCR amplification to obtain the recombinant plasmids pMUT1-pmUcdCFO-mocA, pMUT1-pmUcdCFO-xdhC, pMUT1-pmUcdCFO-mocA-xdhC, which were then transferred into Escherichia coli to obtain the recombinant strains UcdCFO-mocA, UcdCFO-xdhC, UcdCFO-mocA-xdhC. The recombinant strains were cultured in shake flasks, and the results of urolithin A are as Figure 2 shown.

[0047] Table 1 Primers involved in Example 1 and their sequences

[0048] Primer Name Sequence SEQ ID pMUT1-pmUcdCFO-F CTTTCTATGAATAAAGAAGAAAAAGTCAATGTTTGC SEQ ID NO.58 pMUT1-pmUcdCFO-R TCTTTATTCATAGAAAGATGTGCTGAATTAACAG SEQ ID NO.59 pMUT1-pmUcdCFO-mocA-F TCACATTAGCCTGTTTAGTAAACC SEQ ID NO.20 pMUT1-pmUcdCFO-mocA-R ACAGGCTAATGTAATCGATAA SEQ ID NO.21 pMUT1-pmUcdCFO-xdhC-F AGTTGAACTGTCTTTAAAAGAATT SEQ ID NO.22 pMUT1-pmUcdCFO-xdhC-R TTCTTTTAAACAGAGTTCAACTG SEQ ID NO.23 pMUT1-pmUcdCFO-mocA-xdhC-F ATGGTTATATTTAAGGTACCAAGGAGGCATTTACATGCGGATGACAGTGATTGG SEQ ID NO.24 pMUT1-pmUcdCFO-mocA-xdhC-F CAAAACAGCCAAGCTGAATTCCTAAAGGTTGCGGCCGAGCG SEQ ID NO.25

[0049] Example 2: Enhancement of the biosynthetic pathway

[0050] (1) Optimization of promoters with different strengths

[0051] Design primer pairs to construct eight promoters with different strengths. Respectively, using pMUT1-pmUcdCFOUcdCFO-mocA-xdhC as a template, design primers J23100-F and J23100-R, J23104-F and J23104-R, J23108-F and J23108-R, Ptrc-F and Ptrc-R, Plac-F and Plac-R, Ptac-F and Ptac-R, Ptuf-F and Ptuf-R, Psod-F and Psod-R for PCR amplification to obtain recombinant plasmids, and transfer them into Escherichia coli to obtain recombinant strains UcdCFO-mocA-xdhC-J23100, UcdCFO-mocA-xdhC-J23104, UcdCFO-mocA-xdhC-J23108, UcdCFO-mocA-xdhC-Ptrc, UcdCFO-mocA-xdhC-Plac, UcdCFO-mocA-xdhC-Ptac, UcdCFO-mocA-xdhC-Ptuf, UcdCFO-mocA-xdhC-Psod. Shake-flask fermentation culture the recombinant strains, and the results of urolithin A are as Figure 3 shown. Among them, the strength of the promoters is J23100 > J23104 > Ptac > Ptuf > Ptrc > Psod > Plac > J23108.

[0052] Table 2 Primers used for promoter optimization and their sequences

[0053]

[0054]

[0055] (2) Optimization of RBSs with different strengths

[0056] Design primer pairs to construct eight different strengths of RBS. Respectively, using pMUT1-pmUcdCFO-mocA-xdhC-J23104 as a template, design primers B0029-F and B0029-R, B0030-F and B0030-R, B0031-F and B0031-R, B0032-F and B0032-R, B0033-F and B0033-R, B0034-F and B0034-R, B0035-F and B0035-R, B0064-F and B0064-R for PCR amplification to obtain recombinant plasmids, and transfer them into Escherichia coli to obtain recombinant strains UcdCFO-mocA-xdhC-J23104-B0029, UcdCFO-mocA-xdhC-J23104-B0030, UcdCFO-mocA-xdhC-J23104-B0031, UcdCFO-mocA-xdhC-J23104-B0032, UcdCFO-mocA-xdhC-J23104-B0033, UcdCFO-mocA-xdhC-J23104-B0034, UcdCFO-mocA-xdhC-J23104-B0035, UcdCFO-mocA-xdhC-J23104-B0064. The recombinant strains were cultured in shake flasks, and the urolithin A results were as Figure 4 shown. Among them, the strength of RBS is B0035 > B0034 > B0029 > B0032 > B0064 > B0030 > B0031 > B0033.

[0057] Table 3 Primers and Their Sequences Used for RBS Optimization

[0058] Name Sequence SEQ ID B0029-F TTCACACAGGAAACCTACTAGATGAAGCACAGCCA SEQ ID NO.42 B0029-R GGTTTCCTGTGTGAAAATCTCTAGAAGATCTGCCA SEQ ID NO.43 B0030-F AAAGAGGAGAAATACTAGATGAAGCACAGCCA SEQ ID NO.44 B0030-R TTTCTCCTCTTTAATCTCTAGAAGATCTGCCA SEQ ID NO.45 B0031-F TCACACAGGAAACCTACTAGATGAAGCACAGCCA SEQ ID NO.46 B0031-R GGTTTCCTGTGTGAAATCTCTAGAAGATCTGCCA SEQ ID NO.47 B0032-F TCACACAGGAAAGTACTAGATGAAGCACAGCCA SEQ ID NO.48 B0032-R CTTTCCTGTGTGAAATCTCTAGAAGATCTGCCA SEQ ID NO.49 B0033-F TCACACAGGACTACTAGATGAAGCACAGCCA SEQ ID NO.50 B0033-R GTCCTGTGTGAAATCTCTAGAAGATCTGCCA SEQ ID NO.51 B0034-F AAAGAGGAGAAATACTAGATGAAGCACAGCCA SEQ ID NO.52 B0034-R TTTCTCCTCTTTAATCTCTAGAAGATCTGCCA SEQ ID NO.53 B0035-F ATTAAAGAGGAGAATACTAGATGAAGCACAGCCA SEQ ID NO.54 B0035-R TTCTCCTCTTTAATAATCTCTAGAAGATCTGCCA SEQ ID NO.55 B0064-F AAAAGAGGGGGAAATACTAGATGAAGCACAGCCA SEQ ID NO.56 B0064-R TTTCCCCCTCTTTTAATCTCTAGAAGATCTGCCA SEQ ID NO.57

[0059] Obviously, the above embodiments are merely examples for clear illustration and are not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to enumerate all the implementation manners here. And the obvious changes or modifications derived therefrom are still within the protection scope of the present invention.

Claims

1. A recombinant bacterium that produces high levels of urolithin A, characterized in that: The recombinant bacteria are transformed by using Escherichia coli as a host, and the transformation includes: overexpressing UcdCFO synthase, molybdenum cofactor cytidine transferase and xdhC enzyme; Among them, the molybdenum cofactor cytidine transferase and xdhC enzyme are co-regulated by the promoter shown in one of SEQ ID NO.1-8 and the RBS sequence shown in one of SEQ ID NO.9-16.

2. The recombinant bacterium according to claim 1, characterized in that The gene sequence of the UcdCFO synthase is shown in SEQ ID NO.

17.

3. The recombinant bacterium according to claim 1, characterized in that The gene sequence of the molybdenum cofactor cytidine transferase is shown in SEQ ID NO.

18.

4. The recombinant bacterium according to claim 1, characterized in that The gene sequence of the xdhC enzyme is shown in SEQ ID NO.

19.

5. The recombinant bacterium according to claim 1, characterized in that The Escherichia coli includes Escherichia coli Nissle1917.

6. A method for producing urolithin A, characterized in that: The method comprises inoculating the recombinant bacteria according to any one of claims 1 to 5 into a culture medium for fermentation to obtain the urolithin A, wherein the fermentation is carried out in an anaerobic environment.

7. The method according to claim 6, characterized in that The fermentation temperature is 20-60°C.

8. The method according to claim 6, characterized in that The pH of the fermentation culture is 4-9.

9. The method according to claim 6, characterized in that The culture medium includes a carbon source, a carbon source, an inorganic salt and metal ions.

10. Use of the recombinant bacteria according to any one of claims 1 to 5 in the preparation of urolithin A.

Images