Gene polymorphic site detection kit for predicting onset risk of drug-induced liver injury of children

Abstract

The invention discloses a gene polymorphic site detection kit for predicting the onset risk of drug-induced liver injury of children. The gene polymorphic site combination comprises an rs186666026 site of a ZNF648 gene, an rs375747246 site of a TSPYL6 gene, and an rs559022552 site of an NFRKB gene, and is characterized in that the rs375747246 site of the TSPYL6 gene and the rs559022552 site of the NFRKB gene are respectively The kit comprises a MassARRAY chip and primers, wherein the primers are used for detecting a gene ZNF 648rs186666026 site, a gene TSPYL6rs375747246 site and a gene NFRKB rs559022552 site, and the primers are used for detecting a gene ZNF 648rs186666026 site and a gene TSPYL6rs375747246 site. The kit disclosed by the invention can be used for carrying out high-throughput detection on the three sites, and has the advantages of high sensitivity, high specificity, stable detection result, high reliability and the like; meanwhile, the method is suitable for gene analysis fields such as clinical disease mutation detection, pharmacogenomics analysis and forensic medicine identification.

Description

Technical Field

[0001] The present invention belongs to the field of gene technology and relates to a kit for detecting gene polymorphism sites for predicting the onset risk of drug-induced liver injury in children. Background Art

[0002] Drug-induced liver injury is an adverse liver reaction that is harmful rather than desired and causally related to drug use during the normal use of drugs at the prescribed dose, mainly manifested as hepatocyte necrosis, intrahepatic cholestasis, or a mixture of the above two symptoms. According to biochemical test indicators, it is generally considered that when alanine aminotransferase in the blood exceeds 5 times the upper limit of the normal value, or alkaline phosphatase exceeds 3 times the upper limit of the normal value, or alanine aminotransferase exceeds 3 times the upper limit of the normal value and total bilirubin exceeds 2 times the upper limit of the normal value, it is diagnosed as having severe drug-induced liver injury. However, blood indicators are often indicators after liver injury occurs and cannot be used as early risk prediction indicators.

[0003] At the same time, the incidence of drug-induced liver injury in children in China is high. Compared with adults, it progresses faster, has a greater degree of harm, and there are significant differences in the effective treatment window of drugs between children and adults. Currently, there is no specific method for predicting drug-induced liver injury in children, and the available and effective clinical treatment strategies are very limited, and prevention is the main approach. However, there are also significant individual differences in drug-induced liver injury in children, which are affected by genetic factors. Therefore, it is very necessary to develop a detection kit related to the prediction of the onset risk of drug-induced liver injury in children to achieve individualized treatment for patients. Summary of the Invention

[0004] Aiming at the defects in the prior art, the purpose of the present invention is to provide a kit for detecting gene polymorphism sites (SNP) for predicting the onset risk of drug-induced liver injury in children. More specifically, it provides a gene polymorphism site for predicting the onset risk of drug-induced liver injury in children, primers for detecting this gene polymorphism site, a detection method, and a kit for evaluating the risk of drug-induced liver injury by using the same. The kit provided by the present invention can effectively predict the high-risk population of drug-induced liver injury in children, assist in drug selection, and promote the realization of individualized medication.

[0005] Based on the genetic analysis of rare variants in population samples, the present invention has discovered multiple gene variants that are significantly enriched in drug-induced liver injury in children, that is, the variants of these sites indicate a high risk of drug-induced liver injury. These sites are the G>C variant at the rs186666026 site of the ZNF648 gene, the C>G variant at the rs375747246 site of the TSPYL6 gene, and the G>C variant at the rs559022552 site of the NFRKB gene.

[0006] The purpose of the present invention can be achieved by the following solutions:

[0007] In a first aspect, the present invention provides an application of a gene polymorphism locus combination in the preparation of a product for detecting the risk of drug-induced liver injury in children. The gene polymorphism locus combination includes the rs186666026 locus of the ZNF648 gene, the rs375747246 locus of the TSPYL6 gene, and the rs559022552 locus of the NFRKB gene. The mutation type of the rs186666026 locus of the ZNF648 gene is G>C, the mutation type of the rs375747246 locus of the TSPYL6 gene is C>G, and the mutation type of the rs559022552 locus of the NFRKB gene is G>C.

[0008] In a second aspect, the present invention provides a primer combination for detecting the gene polymorphism locus combination, including the following sequences:

[0009] The first primer pair for amplifying the rs186666026 locus of the ZNF648 gene, and its sequences are respectively shown as SEQ ID NO.1-2;

[0010] The second primer pair for amplifying the rs375747246 locus of the TSPYL6 gene, and its sequences are respectively shown as SEQ ID NO.4-5;

[0011] The third primer pair for amplifying the rs559022552 locus of the NFRKB gene, and its sequences are respectively shown as SEQ ID NO.7-8.

[0012] As an embodiment of the present invention, the first primer pair further includes an extension primer for MassARRAY mass spectrometry typing, and its sequence is shown as SEQ ID NO.3; the second primer pair further includes an extension primer for MassARRAY mass spectrometry typing, and its sequence is shown as SEQ ID NO.6; the third primer pair further includes an extension primer for MassARRAY mass spectrometry typing, and its sequence is shown as SEQ ID NO.9.

[0013] The primer combination in the present invention is used to detect the G>C variation at the rs186666026 locus of the DNA ZNF648 gene, the C>G variation at the rs375747246 locus of the TSPYL6 gene, and the G>C variation at the rs559022552 locus of the NFRKB gene.

[0014] In a third aspect, the present invention provides an application of the primer combination in the preparation of a kit for detecting gene polymorphism loci related to the risk of drug-induced liver injury in children.

[0015] Fourthly, the present invention provides a kit for detecting gene polymorphism sites related to the risk of drug-induced liver injury in children, and the kit includes the primer combination and detection reagents.

[0016] As an embodiment of the present invention, in the primer combination, the concentration of the forward primer or the reverse primer is 0.2 - 0.8 μM, and the concentration of the extension primer is 5.58 - 9.62 μM.

[0017] As an embodiment of the present invention, the detection reagents include a PCR amplification reaction system, a SAP digestion reaction system, and a UEP extension reaction system.

[0018] Further, the PCR amplification reaction system includes: ultrapure water, PCR Buffer, MgCl2, dNTPs, and Taq DNA polymerase. In some embodiments, the volume ratio of ultrapure water, PCR Buffer, MgCl2, dNTPs, and Taq DNA polymerase is 17 - 19:4 - 6:3 - 5:0.5 - 1:1 - 3.

[0019] Further, the SAP digestion reaction system includes: ultrapure water, SAP buffer, and SAP alkaline phosphatase. In some embodiments, the volume ratio of ultrapure water, SAP Buffer, and SAP alkaline phosphatase is 150 - 160:15 - 20:25 - 35.

[0020] Further, the UEP extension reaction system includes: ultrapure water, Gold Buffer, Termination mix, and a heat-resistant UEP extension enzyme. In some embodiments, the volume ratio of ultrapure water, Gold Buffer, Termination mix, and the heat-resistant UEP extension enzyme is 600 - 650:100 - 200:150 - 250:35 - 45.

[0021] As an embodiment of the present invention, the kit further includes human genomic DNA extraction reagents, purification resin, detection chips, detection carriers, spotting, and mass spectrometry detection target chips. In some embodiments, the detection chips are selected as MassARRAY chips.

[0022] Fifthly, the present invention provides a method for detecting gene polymorphism sites related to the risk of drug-induced liver injury in children by using the kit for non-diagnostic purposes, including the following steps:

[0023] Step S1, extracting a DNA sample from the detection sample;

[0024] Step S2: In the PCR amplification reaction system, use the forward primer and reverse primer in the primer combination to perform PCR amplification on the DNA sample;

[0025] Step S3: Digest the PCR amplification product in the SAP digestion reaction system;

[0026] Step S4: In the UEP extension reaction system, use the extension primer in the primer combination to extend the digestion product;

[0027] Step S5: After resin purification of the extension product, perform on-machine detection.

[0028] As an embodiment of the present invention, in step S1, the test sample includes peripheral blood or human non-tumor tissue.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] 1. Based on the study of rare variant genetic analysis of population samples, the present invention has innovatively discovered multiple gene mutations that are significantly enriched in children with drug-induced liver injury. The provided gene polymorphism locus combinations can be used to detect the high incidence risk of drug-induced liver injury, which are the G>C mutation at the rs186666026 locus of the ZNF648 gene, the C>G mutation at the rs375747246 locus of the TSPYL6 gene, and the G>C mutation at the rs559022552 locus of the NFRKB gene, respectively.

[0031] 2. The kit of the present invention can perform high-throughput detection on the above three loci, and has the advantages of high sensitivity, high specificity, stable detection results, high reliability, etc.; at the same time, it is applicable to gene analysis fields such as clinical disease mutation detection, pharmacogenomics analysis, and forensic identification.

[0032] 3. The kit of the present invention combines technologies such as multiplex PCR, single-base extension, and mass spectrometry detection. While amplifying the detection template, it can also detect trace samples, so the detection sensitivity is very high; at the same time, the single-base extension adopted is also called microsequencing, which uses specific probes to identify DNA, has good specificity and low false positives.

[0033] 4. The kit of the present invention uses high-throughput sequencing technology, which enables fast detection speed and high efficiency. It can complete the detection of hundreds of samples in 3-4 hours; and the operation is relatively simple. At the same time, under automated operation, the occurrence of contamination is reduced. In addition, multiple patients can be detected, and different gene locus information can be obtained simultaneously, overcoming the high-cost defect of detecting a small number of SNP loci at a time in the prior art. Specific embodiments

[0034] The present invention will be described in detail below in conjunction with specific embodiments. The following examples are implemented on the premise of the technical solution of the present invention, providing detailed implementation manners and specific operation processes, which will help those skilled in the art to further understand the present invention. It should be noted that the protection scope of the present invention is not limited to the following embodiments. Several adjustments and improvements made on the premise of the concept of the present invention all fall within the protection scope of the present invention.

[0035] For the experimental methods without specific conditions noted in the following examples, they are generally carried out under conventional conditions, such as the conditions described in Molecular Cloning: A Laboratory Manual by Sambrook et al. (New York: Cold Spring Harbor Laboratory Press, 1989), or the conditions recommended by the manufacturer.

[0036] Example 1

[0037] Genotyping and detection were performed in 18 cases of drug-induced liver injury (DILI) in children and 128 controls that had been collected, and the results are shown in Table 1.

[0038] Table 1

[0039]

[0040] It can be seen that the G>C variation at the rs186666026 locus of the DNA ZNF648 gene, the C>G variation at the rs375747246 locus of the TSPYL6 gene, and the G>C variation at the rs559022552 locus of the NFRKB gene are high-risk loci for drug-induced liver injury in children. Compared with the control population, this high-frequency variation is significantly enriched in children with drug-induced liver injury.

[0041] Example 2: Primer design and synthesis.

[0042] For the three polymorphic loci combinations related to the high risk of drug-induced liver injury, namely the G>C variation at the rs186666026 locus (GRCh38 1:182057451) of the ZNF648 gene, the C>G variation at the rs375747246 locus (GRCh38 2:54255578) of the TSPYL6 gene, and the G>C variation at the rs559022552 locus (GRCh38 11:129869909) of the NFRKB gene, specific PCR primer sequences (SEQ ID No:1, SEQ ID No:2, SEQ ID No:4, SEQ ID No:5, SEQ ID No:7, SEQ ID No:8) and specific extension primer sequences (SEQ ID No:3, SEQ ID No:6, SEQ ID No:9) were designed, as shown in Table 2 specifically.

[0043] The primers were synthesized by Shanghai Jierui Biotechnology Co., Ltd.

[0044] Table 2

[0045] Number Target Site Sequence (5'-3') Use SEQ ID NO:1 rs186666026 TCTCTTGCGTGGGAAGGTCC PCR Forward Primer SEQ ID NO:2 rs186666026 CGACTACCTGCGGGTGATG PCR Reverse Primer SEQ ID NO:3 rs186666026 GGGAAACACAACAGAGAA Extension Primer SEQ ID NO:4 rs375747246 AGCCCGGGATATTGCGAATG PCR Forward Primer SEQ ID NO:5 rs375747246 AGGAGGCGAAGAAATGGACG PCR Reverse Primer SEQ ID NO:6 rs375747246 CACGTTCAGG GGCCCGGGCC Extension Primer SEQ ID NO:7 rs559022552 GATCGTGGCAGCTGGTTTTG PCR Forward Primer SEQ ID NO:8 rs559022552 GGGACAGGAGGCAACACTAC PCR Reverse Primer SEQ ID NO:9 rs559022552 ACTTT GACCACAGT Extension Primer

[0046] Among them, the upstream and downstream sequences of the rs186666026 locus of the ZNF648 gene are shown in SEQ ID NO:10-11 respectively, the upstream and downstream sequences of the rs375747246 locus of the TSPYL6 gene are shown in SEQ ID NO:12-13 respectively, and the upstream and downstream sequences of the rs559022552 locus of the NFRKB gene are shown in SEQ ID NO:14-15 respectively.

[0047] Example 3, Sample DNA Extraction

[0048] Collect 2 mL of peripheral blood extracted and mix it thoroughly by inverting the vacuum blood collection tube containing 0.5% EDTA to ensure sufficient mixing of blood and anticoagulant. Use Mini Kit(250) kit for DNA extraction; measure the DNA concentration on Thermo Fisher NanoDrop 2000 ultra-micro ultraviolet spectrophotometer; when performing sample measurement, record three values: concentration, 260 / 280, and 260 / 230, so as to find possible contamination reasons if the concentration does not meet the requirements. At the same time, it is required that the experimenters must aliquot the DNA samples to reduce the number of sample freeze-thaw cycles during the experiment and ensure the high quality of DNA. Then dilute the concentration of the extracted sample to 10-20 ng / μL with deionized water to meet the basic requirements for subsequent genotyping sample quality control.

[0049] Example 4, Biological Experiment

[0050] Using an ABI 9700 PCR instrument, PCR amplification, amplicon digestion, and single-site genotyping detection were performed on the rs186666026, rs375747246, and rs559022552 regions according to the instructions; the PCR amplification system is shown in Table 3, the SAP digestion system is shown in Table 4, and the UEP extension system is shown in Table 5. The following reaction systems and steps are carried out as follows:

[0051] 1. PCR amplification reaction conditions: 95°C, 2 min; 45 cycles (95°C, 30 s; 56°C, 30 s; 72°C, 60 s); 72°C, 5 min.

[0052] 2. SAP digestion reaction conditions: 37°C, 40 min; 85°C, 5 min.

[0053] 3. UEP extension reaction conditions: 94°C, 30 s; 40 external cycles (94°C, 5 s; 5 internal cycles (52°C, 5 s; 80°C, 5 s)); 72°C, 3 min.

[0054] 4. Purification: Add 16 μL of deionized water to each tube of the extension product, add resin until evenly mixed, and centrifuge.

[0055] 5. Spotting: Using a micropipette, spot 1 μL of the purified product onto the target chip.

[0056] 6. Machine detection: Clean the 24 needles of the spotting robotic arm with NaOH; spot; use the MassARRAY time-of-flight mass spectrometry platform for detection.

[0057] Table 3 PCR amplification reaction system

[0058]

[0059] Table 4 SAP digestion reaction system

[0060]

[0061] Table 5 UEP extension reaction system

[0062]

[0063]

[0064] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art can make various deformations or modifications within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. The application of a combination of gene polymorphism sites in the preparation of a product for detecting the risk of drug-induced liver injury in children, characterized in that: The combination of gene polymorphism sites includes the rs186666026 site of the ZNF648 gene, the rs375747246 site of the TSPYL6 gene, and the rs559022552 site of the NFRKB gene; the mutation type of the rs186666026 site of the ZNF648 gene is G>C, the mutation type of the rs375747246 site of the TSPYL6 gene is C>G, and the mutation type of the rs559022552 site of the NFRKB gene is G>C.

2. A primer combination for detecting a combination of gene polymorphic sites, characterized in that: The following sequences are included: The first primer pair used to amplify the rs186666026 site of the ZNF648 gene, whose sequences are shown in SEQ ID NO.1-2 respectively; The second primer pair used to amplify the rs375747246 site of the TSPYL6 gene, whose sequences are shown in SEQ ID NOs. 4-5 respectively; The third primer pair used to amplify the rs559022552 site of the NFRKB gene has sequences shown in SEQ ID NOs. 7-8 respectively.

3. The primer combination according to claim 2, characterized in that: The first primer pair also includes an extension primer for MassARRAY mass spectrometry typing, whose sequence is shown in SEQ ID NO.3; the second primer pair also includes an extension primer for MassARRAY mass spectrometry typing, whose sequence is shown in SEQ ID NO.6; the third primer pair also includes an extension primer for MassARRAY mass spectrometry typing, whose sequence is shown in SEQ ID NO.

9.

4. Use of the primer combination as claimed in claim 2 or 3 in the preparation of a kit for detecting gene polymorphism sites associated with the risk of drug-induced liver injury in children.

5. A kit for detecting gene polymorphism sites associated with the risk of drug-induced liver injury in children, characterized in that: The kit comprises the primer combination as claimed in claim 2 or 3, and a detection reagent; in the primer combination, the concentration of the forward primer or the reverse primer is 0.2-0.8 μM, and the concentration of the extension primer is 5.58-9.62 μM.

6. The kit according to claim 5, characterized in that The extension reaction solution includes deionized water, GoldBuffer, Termination mix, and thermostable UEP extension enzyme.

7. The kit according to claim 5, characterized in that The detection reagent comprises a PCR amplification reaction system, a SAP digestion reaction system and a UEP extension reaction system.

8. The detection kit according to claim 7, characterized in that The PCR amplification reaction system includes ultrapure water, PCR Buffer, MgCl2, dNTPs, and Taq DNA polymerase; the SAP digestion reaction system includes ultrapure water, SAP buffer, and SAP alkaline phosphatase; and the UEP extension reaction system includes ultrapure water, Gold Buffer, Termination mix, and high temperature resistant UEP extension enzyme.

9. A method for detecting gene polymorphism sites associated with the risk of drug-induced liver injury in children using the kit according to any one of claims 5 to 8 for non-diagnostic purposes, characterized in that: The following steps are involved: Step S1, extracting a DNA sample from a test sample; Step S2, in a PCR amplification reaction system, using the forward primer and the reverse primer in the primer combination to perform PCR amplification on the DNA sample; Step S3, digesting the PCR amplification product in a SAP digestion reaction system; Step S4, in a UEP extension reaction system, extending the digestion product using the extension primer in the primer combination; Step S5: After the extension product is purified by resin, it is tested on a machine.

10. The method according to claim 9, characterized in that In step S1, the test sample includes peripheral blood or human non-tumor tissue.

Images