SYK gene SNP (Single Nucleotide Polymorphism) primer related to content of isovaleric acid in forest musk and application of SYK gene SNP primer
By using whole-genome resequencing technology to screen out SYK gene molecular markers that are significantly related to the relative content of isovaleric acid, and developing SYK gene SNP primers, it solved the problem that it is difficult to quickly and accurately identify the isovaleric acid content in muskite in the existing technology, and achieved the improvement of muskite quality.
Patent Information
- Application Number
- CN202510645758.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-20
- Publication Date
- 2025-06-20
- Estimated Expiration
- 2045-05-20
AI Technical Summary
The prior art is difficult to quickly and accurately identify the isovaleric acid content in musk, which affects the quality and efficacy of musk.
By measuring the content of isovaleric acid in musk components and using whole genome resequencing technology for SNP genotyping, SYK gene molecular markers significantly related to the relative content of isovaleric acid were screened out, and SYK gene SNP primers related to the content of isovaleric acid in musk Musk were developed to detect the genotype of SNP molecular markers in musk DNA samples.
The relevant traits of isovaleric acid content in musk are achieved quickly and accurately identified, providing scientific basis for early breeding of high-quality muskies, and improving the quality and efficacy of musk.
Smart Images

Figure CN120174112A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to an SYK gene SNP primer related to the isovaleric acid content in Moschus berezovskii musk and its application, belonging to the field of biotechnology. Background Art
[0002] Musk, as a dry secretion from the musk gland of mature male individuals of the Moschidae family. From ancient traditional Chinese medicine classics to modern high-end perfume industries, musk has been highly favored for its unique fragrance and powerful efficacy. Due to the precious value of musk, musk deer have long suffered from overhunting, and coupled with the destruction of their habitats, their numbers have decreased sharply. Nowadays, many species of musk deer are listed as first-class protected animals in China. Currently, the number of artificially farmed Moschus berezovskii is the largest, reaching more than 50,000. Traditional Chinese medicine's understanding of musk is mostly based on empirical accumulation. With the continuous development of modern technology, the specific components of musk can be clearly identified. These components work together synergistically to build a complex and powerful pharmacological basis for musk. In-depth analysis of the mechanism of action of each component in prescriptions helps to optimize traditional prescriptions, improve curative effects, and promote the inheritance and innovative development of traditional Chinese medicine. Among them, in the complex component system of musk, isovaleric acid also plays a certain role. Isovaleric acid has a special smell and participates to a certain extent in the formation of the fragrance of musk, contributing to the richness and uniqueness of the musk fragrance. As an auxiliary fragrance note, it synergistically acts with other aroma substances such as muscone, making the musk fragrance more layered and distinctive. In the perfume industry, the combination of multiple different odors is required to modulate a complex and harmonious fragrance. Isovaleric acid undergoes physical or chemical interactions with other substances in the musk components, affecting the stability, solubility, and bioavailability of other components, participating in the intermolecular complexes of other components, and changing the absorption, distribution, metabolism, and excretion processes of these components in the body, thereby indirectly affecting the overall efficacy of musk. Therefore, carrying out research on improving the relevant components in Moschus berezovskii musk has become an urgent need for the development of the traditional Chinese medicine industry and the perfume industry. It is necessary to find suitable molecular markers to quickly and accurately identify Moschus berezovskii individuals with high isovaleric acid production, which can achieve early breeding, improve the quality of natural musk, and perfect the quality evaluation system of Moschus berezovskii. Summary of the Invention
[0003] The object of the present invention is to propose an SYK gene SNP primer related to the isovaleric acid content in Moschus berezovskii musk and its application, so as to quickly and accurately identify the traits related to the isovaleric acid content in Moschus berezovskii musk, aiming at the defects existing in the prior art.
[0004] The SYK (Spleen Tyrosine Kinase) gene encodes a non-receptor tyrosine kinase that plays a role in various cells, including signal transduction, cell proliferation, differentiation, and survival of immune cells. Musk is mainly secreted by the scent gland cells as a pale yellow initial perfume liquid, which finally forms mature musk after a long fermentation process. SYK affects the proliferation and differentiation of scent gland cells, which is necessary for the normal function of the scent gland and the continuous secretion of musk. In addition, SYK can regulate the immune response and inflammatory response of organisms, affecting the health of animals. During the musk secretion period, the expression of SYK can improve the occurrence of inflammation in forest musk deer, promote the health of forest musk deer, and indirectly and positively affect the secretion and maturation of musk. The research on the component traits of natural musk in forest musk deer shows that there is a significant correlation between the SYK gene and the relative content of isovaleric acid.
[0005] In this invention, the content of isovaleric acid in musk components was measured by liquid chromatography-mass spectrometry (LC / MS), SNP genotyping was carried out using whole-genome resequencing technology, and SYK gene molecular markers significantly related to the relative content of isovaleric acid were screened through genome-wide association analysis, providing new gene and molecular marker resources for the breeding of high-yield isovaleric acid traits in the musk of forest musk deer.
[0006] This invention solves the technical problem through the following technical scheme: an SYK gene SNP primer related to the content of isovaleric acid in the musk of forest musk deer, the deoxyribonucleotide sequences of the SNP primer are shown as SEQ ID NO: 1 and SEQ ID NO: 2, the SNP is located at the 25,879,500th base of chromosome 7 of the forest musk deer reference genome, the base mutation is A or G, the 271st base of the sequence is shown as SEQ ID NO: 3 or SEQ ID NO: 4, and the genotypes are GG and AG. Among them, the forest musk deer reference genome is the only high-quality forest musk deer reference genome assembled at the chromosome level in 2022, which is published on the website http: / / muskdb.cn / .
[0007] This invention further provides the application of the SYK gene SNP primer related to the content of isovaleric acid in the musk of forest musk deer, which is used to detect the SNP molecular marker genotype of the content of isovaleric acid in the musk of forest musk deer. The detection method includes the following steps: The first step: Detect the DNA sample of forest musk deer, perform PCR amplification with the SNP primer to obtain an amplification product; The second step: Perform Sanger sequencing on the amplified product; The third step: Judge the molecular marker genotype of the target site according to the sequencing result obtained in the second step.
[0008] In the first step of the above method, the deoxyribonucleotide sequence of the specific primer pair for Moschus berezovskii is composed of the upstream primer: 5’- TAGCCACTGCCAAAGACACC-3’ (SEQ ID NO: 1) and the downstream primer: 5’- GGTTAAGGGTCCAGCCATCC-3’ (SEQ ID NO: 2). The length of the amplification product is 925 bp, which contains the base at position 25879500 on chromosome 7 of Moschus berezovskii.
[0009] The final volume of the PCR reaction system is 50 μl and consists of 50 ng of the DNA of the Moschus berezovskii to be tested, 25 μl of 2 x Accurate Taq Master Mix, 2 μl of the upstream primer, 2 μl of the downstream primer, and sterilized water to make up to 50 μl. The reaction conditions for the PCR amplification are as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 58°C for 15 sec, extension at 72°C for 15 sec, for a total of 35 cycles, and then extension at 72°C for 5 min; store at 4°C.
[0010] The nucleotide sequence of the amplification product is shown as SEQ ID NO: 3 or SEQ ID NO: 4.
[0011] In the third step, the judgment criterion is that the content of isovaleric acid in individuals with the genotype A / G at the SNP locus is higher than that in individuals with the genotype G / G.
[0012] The present invention detects the genotype of the related traits of the isovaleric acid content in the musk of Moschus berezovskii through SYK gene molecular markers, and finds that the relative content of isovaleric acid in individuals with the A / G genotype is higher than that in individuals with the G / G genotype. By using the genomic DNA of the Moschus berezovskii to be tested as a template, specific primer pairs are used for PCR amplification, and then the PCR amplification product is subjected to Sanger sequencing and SNP molecular marker genotyping. Based on the genotype of this SNP molecular marker, the relative content trait of isovaleric acid in the musk of Moschus berezovskii can be selected. In breeding, according to the breeding goal, by eliminating individuals with the G / G genotype and retaining individuals with the A / G genotype, the beneficial effect is that it can efficiently and rapidly identify the relative content trait of isovaleric acid in the musk of Moschus berezovskii, providing a scientific basis for the early selection of high-quality Moschus berezovskii. In addition, the detection method disclosed in the present invention is simple and easy to operate, can be carried out in the laboratory, and can also be applied to genomic breeding techniques. Description of the Drawings
[0013] Figure 1It is the Manhattan plot of the GWAS analysis of the relative content trait of isovaleric acid in the musk of Moschus berezovskii.
[0014] Figure 2 It is the Sanger sequencing result of the PCR amplification products of two genotypes.
[0015] Figure 3 It is the violin plot of the phenotypic distribution of individuals with three genotypes of the molecular marker chr7:25879500. Specific implementation manners
[0016] The following examples are used for the breeding of Moschus berezovskii.
[0017] Example In this example, the relative content of isovaleric acid in the musk of Moschus berezovskii was measured. SNP genotyping was performed using whole-genome resequencing technology. The molecular marker of SYK gene significantly related to the relative content of isovaleric acid was screened through genome-wide association analysis. The results are as Figure 1 shown.
[0018] In this example, the molecular marker of SYK gene related to the relative content trait of isovaleric acid in the musk of Moschus berezovskii was identified and applied through the following experiments 1. Phenotype determination and genotype detection (1) Experimental materials and determination of the relative content of isovaleric acid in Moschus berezovskii Select 132 adult male Moschus berezovskii as experimental animals, and raise them under the same feeding conditions. Free diet and drinking water are provided throughout the process. During the musk maturation season (October every year), musk is collected from the living animals harmlessly, and then the isovaleric acid in the musk components is quantitatively analyzed by LC / MS to obtain the relative content of isovaleric acid in the musk as phenotypic data.
[0019] (2) Extraction of genomic DNA 1. According to the instructions of the TianGen DP602 kit, select 20 round hairs with hair follicles, aseptically collect the hair follicles (1 cm in length) and put them into an EP tube, add 400 ul of Buffer GHA and 20 ul of Proteinase K reagent, mix well and centrifuge, and digest overnight in a water bath at 65 °C.
[0020] 2. After transient centrifugation, the digested samples are transferred to a TGuide 96 deep-well plate. Place the 96 deep-well plate on the 96 deep-well plate base of the TGuide S16 automatic nucleic acid extraction and purification instrument.
[0021] 3. Run the automatic extraction program of the TGuide S16 automatic nucleic acid extraction and purification instrument. The running program is shown in Table 1: Slot Name Mixing Time (min) Magnetic Attraction Segments Magnetic Attraction Time per Segment (sec) Magnetic Attraction Speed (mm / s) 1 Lysis 2 1 0 6 Transfer Magnetic Beads 0.5 5 3 2.5 1 Binding 10 5 4 2.5 2 Washing 1 5 5 3 2.5 3 Washing 2 5 5 3 2.5 4 Washing 3 5 5 3 2.5 5 Elution 10 5 5 2.5 6 Release Magnetic Beads 0.5 1 0 4. After the program runs to completion, collect the DNA extraction solution aseptically and store it at 4°C for later use. (3) PCR amplification Using the genomic DNA extracted above as a template, amplify the fragment containing the SNP molecular marker at the 25,879,500th base on chromosome 7 of Moschus berezovskii.
[0022] Forward primer: 5’- TAGCCACTGCCAAAGACACC-3’ (SEQ ID NO: 1) Reverse primer: 5’- GGTTAAGGGTCCAGCCATCC-3’ (SEQ ID NO: 2) The length of the amplified product is 925 bp. The final concentrations in the reaction system are calculated based on a 50 μl volume as follows: DNA of Moschus berezovskii to be tested 50 ng 2 x Accurate Taq Master Mix 25 μl Forward primer 2 μl Reverse primer 2 μl Sterilized water Make up to 50 μl. The reaction conditions for PCR amplification are: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 58°C for 15 sec, extension at 72°C for 15 sec, for a total of 35 cycles, followed by extension at 72°C for 5 min; store at 4°C; take 10 μl for agarose detection. The amplified product obtained has a single target band with a length of 925 bp and contains the 25,879,500th base on chromosome 7 of Moschus berezovskii. The sequences of the amplified product are shown in SEQ ID NO:3 and SEQ ID NO:4.
[0023] (4)Sequencing verification and genotyping Perform Sanger sequencing on the PCR products of each sample respectively. The sequencing peak diagrams are as Figure 2 shown.
[0024] 2. Result analysis Select 132 Moschus berezovskii and measure the relative content of isovaleric acid in their mature musk using GC / MS for correlation analysis. Use the t.test function in R4.0 software for statistical testing, and select the average comparison mode between pairs to statistically test the genotypes and the relative content of isovaleric acid of the experimental Moschus berezovskii. P < 0.001 indicates a highly significant difference. The results are shown in Table 2 and Figure 3 as follows. Among the tested individuals, there are 15 individuals with the AG genotype and 117 individuals with the GG genotype. The difference in the relative content of isovaleric acid in the musk of the two genotypes of Moschus berezovskii is highly significant ( P(< 0.01), the average relative content of isovaleric acid in the AG genotype was: 0.344, which was significantly higher than the average relative content of isovaleric acid in the GG genotype, which was 0.095. The results showed that the SYK gene molecular marker was significantly correlated with the relative content trait of isovaleric acid in the musk of Moschus berezovskii. Individuals with the A / G genotype could be selected according to the actual breeding goal to increase the content of isovaleric acid and improve the quality of the overall musk.
[0025] Genotype Number per Head Relative Content of Isovaleric Acid / g Standard Deviation CV G / G 117 <![CDATA[0.095 a > 0.639 66.8% A / G 15 <![CDATA[0.344 b > 0.070 20.3% Note: Data in the same column with the same superscript letters indicate no significant difference, while data with different superscript letters indicate significant difference ( P <0.001).
[0026] In addition to the above embodiments, the present invention may have other embodiments. All technical solutions formed by equivalent replacement or equivalent transformation fall within the protection scope required by the present invention.
Claims
1. A SYK gene SNP primer related to the isovaleric acid content in musk deer, characterized in that: The deoxyribonucleotide sequences of the SNP primers are shown in SEQ ID NO: 1 and SEQ ID NO:
2. The SNP is located at base 25879500 of chromosome 7 of the musk deer reference genome, the base mutation is A or G, and the genotype is GG or AG.
2. The use of the SYK gene SNP primers related to the isovaleric acid content in musk deer according to claim 1, characterized in that: SNP molecular marker genotypes used to detect the isovaleric acid content in musk deer.
3. The use of the SYK gene SNP primers related to the isovaleric acid content in musk deer according to claim 2, characterized in that: The detection method includes the following steps: The first step is to detect the musk deer DNA sample and perform PCR amplification using the SNP primers to obtain an amplification product; The second step is to perform Sanger sequencing on the amplified product; Step 3: Determine the molecular marker genotype of the target site based on the sequencing results obtained in step 2.
4. The use of the SYK gene SNP primers related to the isovaleric acid content in musk deer according to claim 3, characterized in that: The deoxyribonucleotide sequence of the musk deer-specific primer pair in the first step consists of TAGCCACTGCCAAAGACACC upstream and GGTTAAGGGTCCAGCCATCC downstream, and the amplified product is 925 bp in length and contains the 25879500th base on chromosome 7 of the musk deer reference genome.
5. The use of the SYK gene SNP primers related to the isovaleric acid content in musk deer according to claim 4, characterized in that: In the first step, the final volume of the reaction system is 50 μl. Musk deer DNA 50 ng, 2 x Accurate Taq Master Mix 25μl, Upstream primer 2 μl, Downstream primer 2 μl, Sterile water is added to make up to 50 μl. The reaction conditions of the PCR amplification are: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 15 seconds, a total of 35 cycles, extension at 72°C for 5 minutes; and storage at 4°C.
6. The use of the SYK gene SNP primers related to the isovaleric acid content in musk deer according to claim 5, characterized in that: The nucleotide sequence of the amplified product is shown in SEQ ID NO:3 or SEQ ID NO:
4.
7. The use of the SYK gene SNP primers related to the isovaleric acid content in musk deer according to claim 5, characterized in that: In the third step, the judgment criterion is that the isovaleric acid content of individuals with the genotype A / G at the SNP site is higher than that of individuals with the genotype G / G.
Citation Information
Patent Citations
Microsatellite site of natural forest musk yield trait as well as selection method thereof
CN109536621A
SLC26A11 gene SNP (Single Nucleotide Polymorphism) primer related to androstenediol content in forest musk and application of SLC26A11 gene SNP primer
CN120158526A
Single nucleotide polymorphism (SNP) primer of DSTN gene related to musk ketone content in natural musk and application of single nucleotide polymorphism (SNP) primer
CN120249555A