KASP-SNP marker of Chinese cabbage dry-burning heart disease resistant gene BrGRXS14 and application of KASP-SNP marker

By positioning and developing the KASP marker of the anti-dry heartburn gene BrGRXS14 in Chinese cabbage, the frequent occurrence of dry heartburn disease in Chinese cabbage was solved, and efficient breeding of anti-dry varieties was achieved.

CN120174141APending Publication Date: 2025-06-20河南省农业科学院蔬菜研究所 +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510515045.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-23
Publication Date
2025-06-20

AI Technical Summary

Technical Problem

Heart-burn disease in dried cabbage occurs frequently, seriously affecting yield and quality, and it is difficult for the existing technology to effectively solve this problem.

Method used

A new anti-dry heartburn gene, BrGRXS14, was localized by BSA-seq technology, and a tightly linked KASP marker KASP-A09:34901635 was developed for high-throughput detection and breeding of Chinese cabbage.

Benefits of technology

This marker can significantly distinguish disease-resistant and sensory materials, provide the basis for molecularly assisted breeding, and help breed varieties that are resistant to dry heartburn.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120174141A_ABST
    Figure CN120174141A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of molecular genetic breeding, and relates to a KASP-SNP marker of a Chinese cabbage dry-burning heart disease resistant gene BrGRXS14 and application of the KASP-SNP marker. According to the invention, a BSA-seq (Bulk Seq) technology is adopted, so that the novel resistance gene BrGRXS14 of the dry-burned heart disease can be successfully positioned, and the resistance gene BrGRXS14 of the dry-burned heart disease can be used for detecting the resistance of the dry-burned heart disease. The invention also identifies an SNP (Single Nucleotide Polymorphism) marker KASP-A09: 34901635 related to the resistance gene BrGRXS14 of the dry burning heart disease. According to the present invention, the DNA of the Chinese cabbage genetic population is subjected to PCR amplification, the detection is performed by using the KASP gene typing system, and the results show that the KASP-A09: 34901635 can significantly distinguish the disease-resistant material from the disease-susceptible material, and can be subsequently used for the breeding of the Chinese cabbage dry-burning heart disease-resistant variety;
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of molecular genetic breeding, and particularly relates to a high-throughput detection marker for the dry heartburn resistance gene BrGRXS14 of Chinese cabbage and its application in breeding. Background Art

[0002] Chinese cabbage (Brassica rapa L. ssp. pekinensis) belongs to the genus Brassica of the Cruciferae family, originated in China, and has a long cultivation history. It has become an indispensable vegetable in daily diet. However, due to adverse factors such as environmental conditions or improper cultivation management, the occurrence frequency and severity of dry heartburn disease have been increasing year by year. It has become a disease that seriously affects the production of Chinese cabbage after the three major diseases - downy mildew, virus disease, and soft rot disease. In recent years, dry heartburn disease has occurred to varying degrees across the country. In different years, different varieties, and different growth environments, the manifestation and severity of dry heartburn disease also vary. Dry heartburn disease often occurs in leafy vegetables such as lettuce, Chinese cabbage, and cabbage. In the early stage of the disease, the edge of the young leaves turns yellow and withers, curls inward, and the growth of the diseased plants is inhibited; as the disease progresses, the edge of the leaves shows a water-soaked state; in the late stage of the disease, the leaf margin becomes dry and paper-like, and the boundary between the diseased part and the healthy part is relatively clear, with obvious disease spots. The occurrence of dry heartburn disease not only affects the yield of Chinese cabbage but also reduces its quality, resulting in serious economic losses.

[0003] Dry heartburn disease of Chinese cabbage usually shows yellowing and withering of the heart leaves, and even complete death. This disease often occurs at the critical stage of Chinese cabbage growth, especially when the calcium content in the soil is insufficient or the calcium absorption ability of the plant is limited, seriously affecting the yield and quality of Chinese cabbage. Therefore, the excavation of genes related to dry heartburn disease of Chinese cabbage and the study of its molecular mechanism are the keys to promoting the high-quality production of Chinese cabbage and are of great significance. Research on the molecular aspect of dry heartburn disease shows that most of them belong to quantitative trait inheritance controlled by non-single genes. Among them, Sun Xiufeng et al. constructed a molecular genetic map of Chinese cabbage through amplified fragment length polymorphism (AFLP) molecular marker technology and first conducted research on the molecular level of dry heartburn disease. On this basis, QTL mapping was carried out for the dry heartburn disease trait, and a total of 4 QTL loci related to the trait were detected, which were distributed on the LG1, LG2, LG3, and LG5 linkage groups, explaining 11.0 - 58.9% of the genetic variation. Su et al. co-localized a candidate interval on chromosome A06 through genome-wide association analysis (GWAS), BSA-seq, and QTL analysis. There were a total of 35 genes in the interval, including the gene BrCRT2 encoding calreticulin.

[0004] Kompetitive allele specific PCR (KASP) is a genotyping technology for detecting SNPs or InDels by specific base matching at the primer ends. It consists of two forward primers and one reverse primer, with different fluorescent linker sequences FAM or HEX carried at the 5' ends of the two forward primers respectively. Therefore, different alleles can be distinguished by the difference in fluorescence signals, thus achieving specific detection of SNPs or InDels. With its advantages such as high accuracy, low cost and high throughput, this method has become one of the mainstream technologies for SNP and InDel genotyping in the world. KASP-SNP genotyping technology is widely used in fields such as plant genetic map construction, gene mapping, germplasm resource analysis, molecular marker-assisted breeding, and seed purity identification. Summary of the Invention

[0005] In this invention, a new gene resistant to tipburn in Chinese cabbage was identified, and a tightly linked KASP marker KASP-A09:34901635 was developed for this gene, providing a basis for using this marker in molecular-assisted breeding of Chinese cabbage varieties resistant to tipburn and for studying disease-resistant breeding of Chinese cabbage.

[0006] To apply the above discovery to specific Chinese cabbage breeding, the present invention provides the following technical solutions:

[0007] The first aspect of the present invention is to provide a set of KASP-SNP primer sets for specifically amplifying the gene BrGRXS14 resistant to tipburn in Chinese cabbage. It is characterized in that the KASP-SNP primer sets are used for cloning the gene BrGRXS14 related to tipburn disease in Chinese cabbage, and the KASP-SNP primer sets include KASP-A09:34901635Fa, whose nucleotide sequence is as shown in SEQ ID NO:1; KASP-A09:34901635Fb:, whose nucleotide sequence is as shown in SEQ ID NO:2; KASP-A09:34901635R: whose nucleotide sequence is as shown in SEQ ID NO:3.

[0008] Furthermore, the primer combination is used for amplifying the KASP molecular marker KASP-A09:34901635 of the new gene BrGRXS14 resistant to tipburn in Chinese cabbage.

[0009] Furthermore, KASP-A09:34901635Fa is a specific upstream primer for the homozygous susceptible trait gene.

[0010] Furthermore, KASP-A09:34901635Fb is a specific upstream primer for the homozygous disease-resistant trait gene;

[0011] Furthermore, KASP-A09:34901635R is a common reverse primer.

[0012] Furthermore, KASP-A09:34901635Fa and KASP-A09:34901635Fb are respectively labeled with different fluorescent groups for fluorescence detection of amplification products; preferably, the fluorescent groups include FAM, Fluorescein, AlexaFluor 488, HEX, VIC, TAMRA, ROX, CY3, CY5; preferably FAM and HEX, and most preferably, KASP-A09:34901635Fa is labeled with FAM and KASP-A09:34901635Fb is labeled with HEX.

[0013] The second aspect of the present invention is to provide a kit for identifying whether Chinese cabbage is resistant to tipburn, characterized in that the kit includes the primer combination described in the first aspect.

[0014] Furthermore, the kit further includes reagents required for PCR, including KASP Master Mix.

[0015] Furthermore, the concentration of each primer in the primer combination included in the kit is 80 - 120 μmol / L, preferably, the concentration of each primer in the primer combination is 100 μmol / L.

[0016] The third aspect of the present invention is a method for identifying whether Chinese cabbage is resistant to tipburn, characterized in that the method includes the following steps:

[0017] 1) Extract DNA,

[0018] 2) Perform KASP-SNP PCR reaction amplification on the DNA sample using the primer combination described in the first aspect or the kit described in the second aspect,

[0019] 3) Read the fluorescence signal and perform data analysis.

[0020] Furthermore, in step 2) of the PCR, the reaction system is 10 - 50 μL, the DNA sample is 100 - 500 ng, and the dosages of primers KASP-A09:34901635Fa, KASP-A09:34901635Fb, and KASP-A09:34901635R are respectively 1.5 - 5 pmol, 1.5 - 5 pmol, and 3 - 10 pmol.

[0021] Further, the KASP-SNP PCR reaction program is as follows: (1) pre-denaturation at 92-95°C for 12-18 min; (2) denaturation at 92-95°C for 15-25 s, annealing at 58-63°C for 0.5-1.5 min, for a total of 8-12 cycles, with a decrease of 0.6°C in each cycle; (3) denaturation at 92-95°C for 15-25 s, annealing at 52-57°C for 0.5-1.5 min, for a total of 26 cycles; (4) 1-2 min at 35-38°C.

[0022] The fourth aspect of the present invention is to provide the application of the primer combination described in the first aspect and the kit described in the second aspect in identifying whether Chinese cabbage is resistant or susceptible to tipburn.

[0023] Further, the application is to detect the DNA sample of Chinese cabbage by the method described in the third aspect.

[0024] The fifth aspect of the present invention is to provide a KASP molecular marker KASP-A09:34901635 for the new Chinese cabbage tipburn resistance gene BrGRXS14. It is characterized in that the KASP-A09:34901635 is amplified by the primer group described in the first aspect. Among them, KASP-A09:34901635Fa is the specific upstream primer for the homozygous susceptible trait gene, KASP-A09:34901635Fb is the specific upstream primer for the homozygous resistant trait gene; the KASP-A09:34901635R is a common reverse primer.

[0025] The beneficial effects of the present invention include:

[0026] 1) By adopting the BSA-seq (Bulked segregant analysis sequencing) technology, the present invention successfully locates a new tipburn resistance gene BrGRXS14.

[0027] 2) The present invention discloses for the first time the SNP marker related to the tipburn resistance gene BrGRXS14 and its detection primer KASP-A09:34901635.

[0028] 3) By performing PCR amplification on the DNA of Chinese cabbage and detecting it using the KASP genotyping system. The results show that KASP-A09:34901635 can significantly distinguish resistant and susceptible materials, and can be used for the breeding of Chinese cabbage varieties resistant to tipburn in the future. Description of the Drawings

[0029] Figure 1 Tipburn disease grading standard of Chinese cabbage;

[0030] Figure 2 Phenotypic identification of tipburn in parental materials Y578-2 and Y920-2;

[0031] Figure 3 BSA-seq mapping results of tipburn-related genes;

[0032] Figure 4 Fine mapping of candidate gene BrGRXS14;

[0033] Figure 5 Cloning of BrGRXS14 and sequence differences, where the red box indicates the BrGRXS14 gene sequence, the positions marked with red stars are the mutation sites, and the positions marked with blue lines are the primer sequences;

[0034] Figure 6 KASP genotyping of the F2 population using the marker KASP-A09:34901635. Detailed implementation manners

[0035] The following further elaborates on the concept and technical effects of the present invention in combination with specific embodiments to fully understand the purpose, features, and effects of the present invention. The methods are conventional methods unless otherwise specified. The materials can be obtained from public commercial channels unless otherwise specified. The illustrative embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. It should be noted that, without conflict, the embodiments and features in the embodiments of the present invention can be combined with each other.

[0036] Example 1 Obtaining of SNPs

[0037] 1. Test materials and phenotypic trait investigation

[0038] Using the Chinese cabbage tipburn-resistant DH line material Y578-2 (P1) and the susceptible DH line material Y920-2 (P2) as parents, the F1 generation was obtained by crossing the two materials, and the F2 generation was obtained by self-crossing the F1 material. All materials were planted in an intelligent light incubator and uniformly managed by hydroponics. The tipburn phenotype was investigated at the seedling stage, Figure 1 which is the disease grading standard established through repeated experiments by the research group in the early stage, Figure 2 and is the tipburn phenotypic identification result of parental materials Y578-2 and Y920-2.

[0039] Inheritance law of the tipburn trait in Chinese cabbage: Through the investigation of the tipburn phenotypes of the four generations of P1, P2, F1, and F2, it was found that the phenotypes of 12 F1 plants were disease-resistant. Among the F2 population, there were 1472 disease-resistant plants and 526 susceptible plants. Using the chi-square test, it conformed to the segregation ratio of 3:1.

[0040] Table 1 Analysis of genetic rules of dry heartburn resistance in hybrid combinations of Y578-2 and Y920-2

[0041]

[0042] 2. Genomic DNA Extraction

[0043] The modified CTAB method was used to extract the genomic DNA of the two parents, F1 and F2. The specific steps are as follows:

[0044] (1) Place 4 fresh leaves the size of a tube cap into a 2 mL centrifuge tube, add a steel ball with a diameter of about 5 mm and 1000 μL of 2% CTAB buffer into each centrifuge tube;

[0045] (2) Oscillate and crush on a tissue crusher at 30 r / s for 90 s to ensure that the sample is fully ground;

[0046] (3) Place the sample in a 65°C drying oven for 1 hour, turning it upside down 2-3 times to ensure that the sample is fully mixed;

[0047] (4) Add 500 μL of isopropanol to each 1.5 mL centrifuge tube and precool in a -20 °C refrigerator for 30-60 min;

[0048] (5) Cool the sample to room temperature, add 500 μL of chloroform (in a fume hood), mix by inversion, and centrifuge at 12,000 rpm for 10 min. Add 600 μL of the supernatant to pre-cooled isopropanol, mix thoroughly, and place in a -20°C refrigerator for 30 min, then take out and centrifuge at 12,000 rpm for 5 min;

[0049] (6) Discard the supernatant, add 500 μL of 75% ethanol to the centrifuge tube, and centrifuge at 12,000 rpm for 2 min;

[0050] (7) Discard the supernatant, dry the DNA at room temperature, then add 100 μL of double-distilled water and vortex to completely dissolve the DNA. Use Nano 300 micro-volume spectrophotometer (Thermo Fisher Scientific, USA) to measure the quality and concentration of DNA;

[0051] 3. Location of the new gene BrGRXS14 in Chinese cabbage for resistance to dry heart disease

[0052] Select 10 plants each of parental lines Y578-2 and Y920-2 to construct two parental mixed pools (P-Y578 and P-Y920). Select 30 extremely resistant and 30 extremely susceptible materials from the F2 population to construct two offspring mixed pools, namely the disease-resistant (bulk-resistance) and disease-susceptible (bulk-susceptibility) pools. After the sample DNA passes the quality inspection, BSA-seq is performed. After the library construction is completed, its quality is detected. Once the quality meets the requirements, Paired-end 150bp (PE150) sequencing is carried out on the Illumina HiSeq platform. Using the Chinese cabbage reference genome (V3.5) as the reference sequence, the MEM algorithm of the BWA software is used to align the sequencing data with the reference genome, and the reference data is extracted in SAM format. Then, the samtools software is used to convert the SAM file into BAM format, the reads in the BAM file are sorted, and the coverage and coverage depth are statistically analyzed. Based on the obtained BAM file, first, the HaplotypeCaller module in the GATK software package (v3.7) is used to create a gvcf file for each sample, and then the GenotypeGVCFs module is used to detect the variation conditions of all samples, including SNP and InDel variant sites. The QTLseqr (R package) software is used to calculate the Δ(SNP-index) value of each variant site, and its distribution on the genome is analyzed with a 2Mb sliding window. Finally, the interval is located within 32.37 - 36.30Mb on chromosome A09, with an interval length of 3.94Mb, and there are a total of 680 genes in the interval ( Figure 3 ). Then, InDel and SNP markers are designed to further narrow down the interval, which is narrowed down to 48.01Kb, and there are 7 genes in the interval ( Figure 4 ).

[0053] 4. KASP molecular marker KASP-A09:34901635 of the new gene BrGRXS14 for Chinese cabbage resistance to tipburn

[0054] Design InDel and KASP-SNP markers to genotype the disease-susceptible single plants in the F2 segregation population, narrowing down the interval to within 48.01Kb; there are 7 genes in the candidate interval. By combining functional annotation and gene expression analysis, it is found that the gene BraA09g047600.3.5C encodes glutaredoxin S14 (GRXS14), which interacts with CAX1 (Ca 2+ / H + antiporter) and activates the Ca 2+ transport activity of CAX1. Therefore, we speculate that BraA09g047600.3.5C is a candidate gene for tipburn ( Figure 4) Sequencing and sequence alignment of candidate genes revealed 8 non-synonymous mutation sites in the coding region of the gene ( Figure 5 ), one of which (at base 34901635 on chromosome A09, Figure 5 the position marked with a red star) is located within the conserved domain and causes a change in the protein secondary structure. Based on the SNP mutation site within the domain, a molecular marker KASP-A09:34901635 was developed to genotype F2 individual plants, including three primers:

[0055] KASP-A09:34901635Fa:

[0056] 5'- GAAGGTGACCAAGTTCATGCT GAGTGGTGAGTTGCAGGAAGC-3' (SEQ ID NO:1);

[0057] KASP-A09:34901635Fb:

[0058] 5'- GAAGGTCGGAGTCAACGGATT CAGAGTGGTGAGTTGCAGGAAGT-3' (SEQ ID NO:2);

[0059] KASP-A09:34901635R:

[0060] 5'-GAAGACTTTCGCTCATGACATAGAG-3' (SEQ ID NO:3).

[0061] KASP-A09:34901635Fa and KASP-A09:34901635Fb are two allele-specific forward primers. KASP-A09:34901635Fa is the specific primer for the homozygous susceptible trait, and KASP-A09:34901635Fb is the specific primer for the homozygous resistant trait. Their 5' ends are respectively added with FAM (blue fluorescence) and HEX (green fluorescence) fluorescent sequence tags (underlined part).

[0062] KASP-A09:34901635R is a common reverse primer.

[0063] Example 2 Verification using KASP primer KASP-A09:34901635 in parents Y578-2, Y920-2, their F2 population and natural population

[0064] 1. Verification of F2 population

[0065] 1) Add each component of the KASP reaction system to a 96-well plate. The reaction system is:

[0066] 1.5 μL DNA (100 ng·μL -1 ),

[0067] 5 μL 2×KASP Master Mix,

[0068] 0.28 μL primer mixture (obtained by mixing KASP - A09:34901635Fa, KASP - A09:34901635Fb, KASP - A09:34901635R with a concentration of 100 μmol·L -1 and ddH2O in a volume ratio of 6:6:15:73),

[0069] 3.5 μL ddH2O.

[0070] 2) The KASP - SNP reaction program is as follows:

[0071] (1) Pre - denaturation at 94°C for 15 min;

[0072] (2) Denaturation at 94°C for 20 s, annealing at 61°C for 1 min, for a total of 10 cycles, with a decrease of 0.6°C in each cycle;

[0073] (3) Denaturation at 94°C for 20 s, annealing at 55°C for 1 min, for a total of 26 cycles;

[0074] (4) 1 min at 37°C.

[0075] 3) Finally, use the LightCycler 480 Instrument II to read the end - point fluorescence signal. Perform genotyping analysis with LC480 software v1.5.1. There are three types of genotyping results: The fluorescence signal of the homozygous resistant material is green, and it is the competitive amplification of the primer with the HEX fluorescence tag sequence connected to the 5' end, close to the Y - axis; the fluorescence signal of the homozygous susceptible material is blue, and it is the competitive amplification of the primer with the FAM fluorescence tag sequence connected to the 5' end, close to the X - axis; the fluorescence signal of the heterozygous resistant material is red, located on the diagonal of the coordinate axis ( Figure 6 ).

[0076] The results show that in the F2 population, the phenotype is consistent with the genotype. The KASP - A09:34901635 marker can significantly distinguish the two homozygous genotypes and can also identify the heterozygous genotype, with a 100% coincidence rate between the genotype and the phenotype, indicating the successful development of the marker.

[0077] 2. Verification in natural populations

[0078] Verify in 66 natural populations using the same method as above. The results are shown in Table 2. Among them, the genotypes of 64 populations are completely consistent with the phenotypes, and the coincidence rate of genotype and phenotype reaches 96.96%.

[0079] Table 2 KASP - A09:34901635 Genotyping Results of Markers in 66 Natural Populations

[0080]

[0081] Note: Markers with the same genotype as the disease - resistant parent Y578 - 2 are designated as A, and markers with the same genotype as the disease - susceptible parent Y920 - 2 are designated as B.

[0082] The embodiments described above are only a part of the embodiments of the present invention, not all of them. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative efforts fall within the scope of protection of the present invention.

Claims

1. A set of primers for specifically amplifying KASP-SNP of Chinese cabbage anti-dry heartburn gene BrGRXS14, characterized in that: The KASP-SNP primer set is used to clone the KASP molecular marker KASP-A09:34901635 of the cabbage dry heartburn disease-related gene BrGRXS14, wherein the KASP-SNP primer set includes KASP-A09:34901635Fa, whose nucleotide sequence is shown in SEQ ID NO:1; KASP-A09:34901635Fb:, whose nucleotide sequence is shown in SEQ ID NO:2; KASP-A09:34901635R: whose nucleotide sequence is shown in SEQ ID NO:

3.

2. The primer set according to claim 1, characterized in that Among them, KASP-A09:34901635Fa is a specific upstream primer of the homozygous disease-susceptible trait gene; among them, KASP-A09:34901635Fb is a specific upstream primer of the homozygous disease-resistant trait gene; and the KASP-A09:34901635R is a common reverse primer.

3. The primer set according to claim 1 or 2, characterized in that: KASP-A09:34901635Fa and KASP-A09:34901635Fb are respectively labeled with different fluorescent groups for fluorescence detection of amplified products; the fluorescent groups include FAM, Fluorescein, Alexa Fluor 488, HEX, VIC, TAMRA, ROX, CY3, and CY5.

4. The primer set according to claim 3, characterized in that: Among them, KASP-A09:34901635Fa is labeled with FAM, and KASP-A09:34901635Fb is labeled with HEX.

5. A kit for identifying whether Chinese cabbage is resistant or susceptible to dry heart disease, characterized in that: The kit comprises the primer set according to any one of claims 1 to 4.

6. The kit according to claim 5, characterized in that The kit also includes reagents required for PCR, including KASP Master Mix.

7. A method for identifying whether Chinese cabbage is resistant to dry heart disease, characterized in that: The method comprises the following steps: 1) Extract DNA, 2) performing KASP-SNP PCR amplification on a DNA sample using the primer set described in any one of claims 1 to 4 or the kit described in any one of claims 5 to 6, 3) Read the fluorescence signal and perform data analysis.

8. Use of the primer set according to any one of claims 1 to 4 or the kit according to any one of claims 5 to 6 in identifying whether Chinese cabbage is resistant or susceptible to dry heart disease.

9. The use according to claim 8, characterized in that: The application is to detect the DNA sample of Chinese cabbage using the method described in claim 7.

10. A KASP molecular marker KASP-A09:34901635 of a new gene BrGRXS14 for resistance to dry heart disease in Chinese cabbage, characterized in that: The KASP-A09:34901635 is obtained by amplification using the primer set described in any one of claims 1 to 4, wherein KASP-A09:34901635Fa is a specific upstream primer for a homozygous disease-susceptible trait gene, and KASP-A09:34901635Fb is a specific upstream primer for a homozygous disease-resistant trait gene; and the KASP-A09:34901635R is a common reverse primer.