Methods of treating insulin resistance and related conditions

Abstract

The invention relates to a method for treating or preventing insulin resistance and related diseases, in particular to the use of a 4-epimerase inhibitor for treating or preventing insulin resistance and related diseases such as obesity and type 2 diabetes.

Description

[0001] Cross - Reference to Related Applications

[0002] This application claims priority to Australian Provisional Patent Application No. 2022903188, filed on October 27, 2022, the entire content of which is incorporated herein by cross-reference. Technical Field

[0003] The present invention generally relates to methods for treating or preventing insulin resistance and conditions associated with insulin resistance. Specifically, the present invention relates to the use of 4-epimerase inhibitors for treating or preventing insulin resistance and related conditions, including metabolic diseases such as obesity and type 2 diabetes. Background Art

[0004] Metabolic diseases such as obesity and type 2 diabetes affect approximately 650 million people worldwide. Since 1975, the global prevalence of metabolic diseases has tripled, and if current trends continue without effective treatment, by 2030, >51% of the world's population will be obese or have type 2 diabetes. A key hallmark of many metabolic diseases, including obesity and type 2 diabetes, is insulin resistance.

[0005] Insulin is a peptide hormone synthesized and secreted by β-cells of the pancreas. After being secreted into the bloodstream, insulin affects various cells expressed throughout the body, and it plays a crucial role in maintaining blood glucose levels within an optimal range. In this context, insulin targets peripheral tissues, including skeletal muscle and adipose tissue, to promote glucose uptake from the circulation, and targets the liver to inhibit gluconeogenesis and glycogenolysis. Insulin also signals to the brain, which plays a crucial role in how the brain controls whole-body glucose and energy homeostasis. Insulin resistance occurs when the target tissues for insulin in the periphery become insensitive to the action of insulin.

[0006] Obesity is characterized by the excessive accumulation of adipose tissue, which is highly responsive to insulin and contributes significantly to both glucose and lipid metabolism. In obese individuals, adipose tissue releases higher amounts of non-esterified fatty acids, glycerol, hormones, and pro-inflammatory cytokines, which are involved in the development of insulin resistance. Initially, β-cells compensate for insulin resistance by secreting more insulin, but over time, the β-cells are unable to meet the body's demand for insulin, and blood glucose levels also increase. Thus, in addition to its own health complications, obesity-related insulin resistance is also a major risk factor for type 2 diabetes.

[0007] Type 2 diabetes can be a difficult disease to manage because it requires long-term maintenance of blood glucose levels. Current anti-diabetic drugs do not control blood glucose levels well and cannot completely prevent the occurrence of hyperglycemic and hypoglycemic levels, which can cause long-term complications such as retinopathy, nephropathy, neuropathy, and peripheral vascular disease. Many of the treatments available on the market for type 2 diabetes are only partially successful because they target the reduction of beta-cell function or insulin resistance, and their efficacy decreases as the disease progresses, meaning that additional or combination therapies are needed over time. People with type 2 diabetes are also at increased risk of developing other medical conditions such as obesity, hypertension, stroke, heart disease, and hyperlipidemia.

[0008] In addition to metabolic diseases such as obesity and type 2 diabetes, insulin resistance is also associated with many other serious health problems, including metabolic syndrome, hypertension, dyslipidemia, hyperglycemia, atherosclerosis, non-alcoholic fatty liver disease (NAFLD), polycystic ovary syndrome (PCOS), and coagulopathy.

[0009] Therefore, there is a need for improved or alternative methods for treating or preventing insulin resistance and related conditions, including metabolic diseases such as obesity and type 2 diabetes. Summary of the Invention

[0010] The present invention is at least partially based on the discovery that during the development of central insulin resistance and metabolic dysfunction, perineural fibrosis occurs around metabolically related neurons in the arcuate nucleus (ARC) of the hypothalamus, and 4-epimerase inhibitors can reduce or prevent perineural fibrosis in the ARC, thereby treating or preventing insulin resistance and related conditions.

[0011] Accordingly, in one aspect, the present invention provides a method for treating or preventing insulin resistance or related conditions in a subject, the method comprising administering an effective amount of a 4-epimerase inhibitor to the subject.

[0012] In another aspect, the present invention provides the use of a 4-epimerase inhibitor for the preparation of a medicament for treating or preventing insulin resistance or related conditions in a subject.

[0013] In another aspect, the present invention provides a 4-epimerase inhibitor for treating or preventing insulin resistance or related conditions in a subject. Brief Description of the Drawings

[0014] Embodiments of the present invention will now be described with reference to the following drawings, which are intended to be illustrative only and in which:

[0015] Figure 1Obesity drives neurofibrosis in the ARC. Age-matched C57BL / 6J mice were fed a chow or HFHS diet for 12 weeks, and the brains were processed for a-c) WFA or g-i) aggrecan immunostaining, and b, h) the area within the ARC and c, i) the intensity were quantified. d) ARC homogenates from 12-week obese or age-matched chow-fed C57BL / 6J were subjected to ZIC-HILIC chromatography, and CS-GAG and HA abundances were quantified using 2-aminobenzamide fluorescently labeled disaccharides from enzymatically depolymerized GAG chains. C57BL / 6J mice were fed an HFHS diet for 0 days, 3 days, 1 week, 4 weeks, 8 weeks, or 12 weeks, and the brains were processed for immunohistochemical monitoring of e, f) WFA within the ARC or m, n) aggrecan expression; f, n) the stained area was quantified. Age-matched C57BL / 6J mice were fed a chow or HFHS diet for 12 weeks, and the brains were processed for g-i) WFA and aggrecan immunostaining, and j, k) the co-expression within the ARC was quantified. Results are mean ± SEM; significance and represent at least three independent experiments. Significance was determined using b, c, d, h, i) t-tests and f, n) two-way ANOVA with Tukey multiple comparisons. Scale bar, 100 μm.

[0016] Figure 2 During the development of metabolic disease, attenuated CSPG-ECM turnover in the ARC drives neurofibrosis. a) Schematic overview of the CSPG-ECM tracker technique. b, c) 8-week-old C57BL6J mice received unilateral administration of WFA-biotin or saline into the ARC. One day after injection, the brains were extracted and processed for immunohistochemical monitoring of WFA-biotin and WFA-FITC, and d) the stained area within the ARC was quantified. e) 12-week obese or age-matched chow-fed C57BL6J male mice received bilateral administration of WFA-biotin into the ARC. Brains were extracted at 0 days, 1 week, 3 weeks, 5 weeks, or 10 weeks after injection and subjected to immunohistochemical monitoring of the presence of WFA-biotin and WFA-FITC, and f, g) the CSPG-ECM turnover within the ARC was quantified over time. h) Extracellular matrix regulatory enzyme or profibrotic factor gene expression was determined in the mediobasal hypothalamus of 12-week obese or age-matched chow-fed C57BL6J male mice. Results are mean ± SEM; significance was determined using g) simple linear regression. Scale bar, 100 μm.

[0017] Figure 3:Neurofibrosis occurs around AgRP neurons in the ARC. a-c, g-i) Npy-GFP and d-f) Pomc-EGFP male mice were fed an HFHS diet for 0, 4, and 12 weeks, and the brain was processed for a-f) WFA or g-i) aggrecan immunostaining, and the number of stained enwrapping cells in b, e, h) and the intensity of surrounding staining in c, f, i) were quantified. Whole-cell patch-clamp electrophysiology was performed in NPY neurons of 12-week HFHS diet Npy-GFP mice after vehicle or chABC was applied into the ARC. Four days after injection, the proportion of j) spontaneously firing neurons, k, l) firing frequency, and m) resting membrane potential were determined. Results are mean ± SEM; significance was determined using the following, respectively: b, c, h, i) one-way ANOVA with Tukey's multiple comparisons, g) ANCOVA, or k, m) unpaired t-test (two-tailed) or unpaired t-test (one-tailed). Electrophysiological recordings were made from 17 (vehicle) and 18 (chABC) neurons, with 4 mice per treatment group. Scale bar, 100 μm.

[0018] Figure 4:Disassembly of neurofibrosis in the ARC promotes remission of metabolic diseases. a) C57BL / 6J mice were fed a HFHS diet for 12 weeks, and vehicle or chABC was bilaterally injected into the ARC to disassemble the CSPG-ECM. ARC targeting was confirmed by analysis of ARC WFA immunofluorescence (inset in a). b) Body weight, c) adiposity, d) food intake, g) energy expenditure, h) overall morphology of ingWAT, i) ingWAT histology and UCP-1 immunohistochemistry, j, k) inguinal skin thermography, l) glucose tolerance, and m) HOMA-IR were evaluated. C57BL / 6J mice were fed HFHS for 12 weeks, and vehicle or chABC was bilaterally injected into the ARC. One day after ARC injection, vehicle-administered mice were pair-fed, with their daily food supply restricted to that consumed by chABC-treated mice, and e) body weight and f) adiposity were evaluated. Hyperinsulinemic euglycemic clamps were performed in conscious unrestrained C57BL / 6J mice fed a HFHS diet for 12 weeks and bilaterally injected with vehicle or chABC into the ARC. Results for n) GIR, o) basal and clamped EGP are shown. p) Mice undergoing hyperinsulinemic euglycemic clamps were administered a bolus of 2-DG, and tissue-specific insulin-stimulated uptake in BAT, brain (hypothalamus) epiWAT, BAT and ingWAT, heart, and gastrocnemius was measured. 15-week-old db / db mice were bilaterally injected with vehicle or chABC into the ARC. q) Body weight, r) adiposity, s) glucose tolerance, and t) HOMA-IR were evaluated. Results are mean ± SEM; significance was determined using: b, c, e, f, o, q, r) two-way ANOVA with repeated measures, d, g, k, l, m, p, s, t) t test. Scale bar, 100 μm.

[0019] Figure 5: Neurofibrosis in obesity promotes ARC insulin resistance. a-c) C57BL / 6J mice were fed a chow or HFHS diet for 12 weeks, and vehicle or chABC was bilaterally injected into the ARC. Two or eight days after ARC injection, vehicle or insulin was administered to the mice, and the brain was processed for immunohistochemical monitoring of: b, c) insulin-induced p-AKT expression. d-h) C57BL / 6J mice were fed a HFHS diet for 12 weeks, and vehicle or chABC was bilaterally injected into the ARC. Four days after intracerebroventricular injection into the ARC, insulin-FITC was administered to the mice, and the f) area, g) intensity, and h) insulin-FITC-induced AKT phosphorylation within the ARC expressing FITC were quantified. i, j) Insulin-FITC was incubated with CSPG-ECM components, and insulin binding was evaluated in vitro. Results are mean ± SEM; significance was determined using two-way ANOVA with Tukey's multiple comparison test in c) and one-way ANOVA with Tukey's multiple comparison test in f-j). Scale bar, 100 μm.

[0020] Figure 6 : The impact of ARC neurofibrosis on systemic metabolic dysfunction is driven by impaired AgRP IR signaling. a) Schematic of the AAV-gIR construct for conditional targeting of IR in mice. b) 12-week HFHS-fed AgRP-Cas9 mice received bilateral intracerebroventricular injection of AAV-g scrambled or AAV-gIR. ARC targeting was confirmed by analysis of GFP and mCherry immunofluorescence (inset in b). One week later, the mice received bilateral injection of vehicle or chABC to disassemble neurofibrosis in the ARC, and c) body weight, d) adiposity, e) food intake, f) energy expenditure, g) glucose tolerance, and h) HOMA-IR were determined. Results are mean ± SEM; significance was determined using two-way ANOVA with repeated measures in c, d) and one-way ANOVA with Tukey's multiple comparison test in e, f, g, h). Scale bar, 100 μm.

[0021] Figure 7: Pharmacological targeting of neuropilin promotes weight loss and improves glycemic control in obesity. a) Male mice fed a HFHS diet for 12 weeks were administered vehicle or flamine I.C.V. daily for 10 days. b, c) CSPG-ECM expression in the ARC, d) body weight, e) adiposity, f) energy expenditure, g) food intake, and h) glucose tolerance were evaluated. After 10 days of vehicle or flamine treatment, mice were administered insulin and the brain was processed for immunohistochemical monitoring of i, j) insulin-induced p-AKT expression. Hyperinsulinemic euglycemic clamps were performed in awake unrestrained C57BL / 6J mice fed a HFHS diet for 12 weeks and administered flamine I.C.V. daily for 3 days, and k) GIR was evaluated. C57BL / 6J mice with a phenotype of late T2D fed a HFHS diet and treated with low-dose STZ received vehicle or flamine administered I.C.V. daily for 14 days. l) Daily blood glucose and m) glucose tolerance were evaluated. n) 12-week HFHS-fed AgRP-Cas9 mice received bilateral injections of AAV-g scrambled or AAV-gIR. One week later, mice were administered vehicle or flamine I.C.V. daily for 10 days, and o) body weight, p) food intake, q) energy expenditure, and r) body weight, n) glucose tolerance were evaluated. Results are mean ± SEM. Significance was determined using two-way ANOVA with repeated measures for d, e, k, l, o) and one-way ANOVA with multiple comparisons for c, f, g, h, j, m, p, q, r). Scale bar, 100 μm.

[0022] Figure 8 : Intranasal drug administration delivers biotinylated flamine (PZ6005) to the ARC. a) Schematic overview of intranasal administration of biotinylated PZ6005. 7- to 8-week-old chow-fed C57BL / 6J mice received vehicle or biotinylated PZ6005 (5 mg / animal / day) I.N. for 3 consecutive days. Mice brains and lungs were then extracted for immunohistochemistry to detect the presence of the drug, and d-h) intensity was quantified. Scale bars: b) 500 μm or 100 μm, and f) 200 μm. Results are mean ± SEM. Statistical significance was determined using unpaired t test.

[0023] Figure 9: In diet-induced obesity, intranasal administration of fluoramine (PZ6005) attenuates ARC neurofibrosis. a) Schematic overview of intranasal administration of PZ6005. a) C57BL / 6J mice fed a 12-week HFHS diet received I.N. administration of vehicle or PZ6005 (1 mg or 5 mg / animal / day) for 14 consecutive days. b) Mouse brains were then extracted and processed for WFA immunohistochemistry to determine CSPG-ECM expression within the ARC, and c, d) area and e, f) intensity were quantified. Scale bar: 100 μm. Results are mean ± SEM. Statistical significance was determined using one-way ANOVA with Tukey's multiple comparison test.

[0024] Figure 10 : In diet-induced obesity, pharmacological inhibition of ARC neurofibrosis using fluoramine (PZ6005) induces weight loss. C57BL / 6J mice fed a 12-week HFHS diet received I.N. administration of vehicle or PZ6005 (1 mg or 5 mg / animal / day) for 14 consecutive days. a, b) The effect of 14-day treatment on mouse body weight was measured daily. Results are mean ± SEM. Statistical significance was determined using two-way ANOVA with repeated measures and Tukey's multiple comparison test.

[0025] Figure 11 : In diet-induced obesity, pharmacological inhibition of ARC neurofibrosis using fluoramine (PZ6005) reduces adiposity. C57BL / 6J mice fed a 12-week HFHS diet received I.N. delivery of vehicle, PZ6005 (1 mg or 5 mg / animal / day) for 14 consecutive days. a, b) Fat tissue and liver were extracted and weighed to determine tissue-specific adiposity, and c, d) fat mass was evaluated after 14-day treatment. Results are mean ± SEM. Statistical significance was determined using a, b, d) one-way ANOVA with Tukey's multiple comparison test and c) two-way ANOVA with repeated measures and Tukey's multiple comparison test.

[0026] Figure 12 : In diet-induced obesity, pharmacological inhibition of ARC neurofibrosis using fluoramine (PZ6005) reduces food intake and increases energy expenditure. C57BL / 6J mice fed a 12-week HFHS diet received daily I.N. administration of vehicle or PZ6005 (1 mg or 5 mg / animal / day) for 14 days. On days 8 - 11 of treatment, a) 24-hour food intake, b) cumulative food intake, c, d) oxygen consumption, and e - g) energy expenditure were determined. Results are mean ± SEM. Statistical significance was determined using a, e) one-way ANOVA with Tukey's multiple comparison test and c, f) two-way ANOVA with repeated measures and Two-way ANOVA of multiple comparison tests determines statistical significance.

[0027] Figure 13 : In diet-induced obesity, pharmacological attenuation of ARC neurofibrosis using fludiamine (PZ6005) attenuates ARC insulin resistance. C57BL / 6J mice fed a 12-week HFHS diet were delivered vehicle or PZ6005 (1 mg or 5 mg / animal / day) I.N. daily for 14 days. After 14 days of treatment, insulin (5 mg / g) was then delivered I.P. to the mice. Brains were extracted 15 minutes after injection and then processed for immunohistochemistry a) to detect insulin-induced p-AKT signaling. b) Quantification of ARC pAKT+ve. cells was performed. Scale bar: 100 μm. Results are mean ± SEM. Statistical significance was determined using one-way ANOVA with Tukey's multiple comparison test for b).

[0028] Definitions

[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0030] As used herein, the terms "composition" and "formulation" are used interchangeably and have the same meaning.

[0031] Unless otherwise indicated, as used herein, the indefinite articles "a", "an", and "the" include plural aspects. Thus, for example, reference to "an agent" includes a single agent as well as two or more agents; reference to "the composition" or "formulation" includes a single composition or formulation, as well as two or more compositions or formulations; and so on.

[0032] As used herein, the term "about" means ±10% of the recited value.

[0033] Throughout this specification and the following claims, unless the context requires otherwise, the word "comprise" and variations such as "comprises" and "comprising" will be understood to imply the inclusion of the stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

[0034] The term "consisting of" means "consisting only of", that is, including and limited to the integer or step or group of integers or steps and excluding any integer or step or group of integers or steps.

[0035] The term "consisting essentially of" means including the recited integer or step or group of integers or steps, but also including other integers or steps or groups of integers or steps that do not materially affect or contribute to the operation of the invention.

[0036] Reference to any prior art in this specification is not and should not be taken as an admission that the prior art forms part of the common general knowledge or as any form of suggestion.

[0037] Other definitions are provided throughout this specification. Detailed Description

[0038] The present invention relates to methods for treating or preventing insulin resistance and related disorders such as type 2 diabetes and obesity. Specifically, the inventors have identified neurofibrosis in the arcuate nucleus (ARC) of the hypothalamus as a novel disease mechanism underlying central insulin resistance and the development of metabolic diseases, and administration of 4-epimerase inhibitors can reduce or prevent neurofibrosis in the ARC. Thus, 4-epimerase inhibitors may be suitable for treating or preventing insulin resistance and related disorders such as type 2 diabetes and obesity. The terms "type-2 diabetes mellitus", "type-2 diabetes", and "T2D" are used interchangeably herein and have the same meaning.

[0039] Excessive deposition and remodeling of the extracellular matrix (ECM) promotes fibrosis and is an established disease mechanism of insulin resistance in muscle, adipose, and liver tissues. However, both insulin resistance and fibrosis have traditionally been regarded as peripherally centered phenomena, and the incidence and relevance of ECM in the brain to the development of metabolic diseases have not been explored previously. A distinct type of ECM has recently been described in the ARC of humans and mice (Alonge et al., 2020; Mirzadeh et al., 2019), which consists of specialized perisynaptic aggregates of hyaluronic acid, chondroitin sulfate proteoglycan (CSPG), and chondroitin sulfate glycosaminoglycan side chains. The inventors have identified that the CSPG-ECM within the ARC is a unique multicellular aggregate that is concentrated proximal to the median eminence (ME), providing an extracellular connection between the nervous and peripheral endocrine systems. Thus, the CSPG-ECM provides an interface that links circulating metabolic hormones entering the ARC to metabolism-related ARC neurons such as agouti-related peptide neurons (AgRP) and pro-opiomelanocortin (POMC) neurons.

[0040] The present inventors have identified that the development of insulin resistance and related disorders, such as obesity and type 2 diabetes, is underscored by CSPG-ECM remodeling at both the compositional and glycosaminoglycan levels, which represents a previously unrecognized property of insulin resistance and related disorders and is termed "neurofibrosis". Neurofibrosis within the ARC impedes the manifestation of circulating insulin, which can give rise to neuronal insulin resistance. Remodeling of CSPG components, including alterations in the sulfation pattern of chondroitin sulfate glycosaminoglycans (CS-GAGs), may be mediated by elevated CS-0S, CS-4S, and CS-2S6S sulfation, which promotes a rigid CSPG-ECM structure that sequesters extracellular diffusion. CS-4S sulfation drives the activity of chondroitin N-acetylgalactosaminyltransferase-1 (CS-GalNAcT-1), which in turn promotes the expression of aggrecan, the key CSPG species underlying neurofibrosis in the ARC. CSPG-ECM remodeling that underscores neurofibrosis occurs specifically around AgRP neurons, which are key regulators of metabolism and essential for survival. Impairment of insulin signaling in the ARC may contribute to the development of obesity and diabetes through enhanced feeding behavior, diminished energy expenditure, and defective glucose metabolism.

[0041] 4-Epimerase (also known as UDP-galactose 4-epimerase) is an essential enzyme for generating the nucleotide sugar substrate UDP-N-acetylgalactosamine, which is required for the assembly and elongation of CS-GAG chains on CSPGs and is a core feature of neurofibrosis in the ARC. Accordingly, the present inventors hypothesized that 4-epimerase inhibitors could reduce or prevent neurofibrosis in the ARC, which represents a novel treatment for insulin resistance and related disorders. As a non-limiting example, the present inventors have demonstrated that fluoroamine (1; Ac-4-F-GlcNAc), a fluorinated N-acetyl-D-glucosamine analogue previously identified to inhibit chondroitin sulfate proteoglycan (CSPG) synthesis (Keough et al., 2016; Stephenson et al., 2019), preferentially attenuates CSPG-ECM in the ARC. This effect may be mediated by a relatively rapid CSPG-ECM turnover rate within the ARC, which enhances the functional efficacy of fluoroamine in the ARC while the degradation rate is slower in other brain regions. Since there is little CSPG-ECM expression in the amygdala, orbitofrontal cortex, and ventral striatum, targeting brain ECM may limit off-target effects on depression and anxiety, which have undermined previous attempts to pharmacologically target the brain to treat metabolic diseases.

[0042] Accordingly, the present invention relates to the use of 4-epimerase inhibitors for the treatment or prevention of insulin resistance or related disorders. In one or more embodiments, the present invention relates to the use of fluorinated N-acetyl-glucosamine derivatives, such as fluoroamine (1), for the treatment or prevention of insulin resistance or related disorders, including metabolic diseases associated with insulin resistance, such as obesity and type 2 diabetes. Stephenson et al., 2019 previously identified that the most effective fluorinated N-acetyl-glucosamine derivatives, in terms of reducing chondroitin sulfate GAG stubs attached to core proteins, have substitutions only at the anomeric carbon (C-1), such as a hydroxy group, O-acetyl or O-propionyl, and at least one fluorine at C-4. Thus, as used herein, the term fluorinated N-acetyl-glucosamine "derivative" may specifically refer to an N-acetyl-glucosamine (preferably N-acetyl-D-glucosamine) core structure substituted at C-1 by a hydroxy group or -OC(O)C 1-4 alkyl (preferably a hydroxy group, O-acetyl or O-propionyl), and substituted at C-4 by one or two fluorine groups. Stephenson et al., 2019 also identified that it may be advantageous to include removable acyl protecting groups at O4 and O6.

[0043] Accordingly, in one or more embodiments, a 4-epimerase inhibitor suitable for the present invention is a compound of formula (I):

[0044]

[0045] or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof,

[0046] wherein:

[0047] R 1 , R 3 and R 5 are independently selected from H or C(O)C 1-4 alkyl; and

[0048] R 4 and R 4' are independently selected from H and fluorine, wherein at least one of R 4 and R 4' is fluorine.

[0049] As used herein, the term "alkyl" refers to monovalent ("alkyl") and divalent ("alkylene") straight or branched chain saturated aliphatic groups. Alkyl may have 1 to 4 carbon atoms, denoted as C 1-4 alkyl, or it may have 1 to 3 carbon atoms, denoted as C 1-3 alkyl, or it may have 1 to 2 carbon atoms, denoted as C 1-2Alkyl. Examples of suitable alkyls can include, but are not limited to, methyl, ethyl, 1-propyl, isopropyl, 1-butyl, 2-butyl, isobutyl, sec-butyl, and tert-butyl.

[0050] It should be recognized that the fluorinated N-acetyl-glucosamine derivatives (or other 4-epimerase inhibitors) disclosed herein may have asymmetric centers and can thus exist in more than one stereoisomeric form. Accordingly, 4-epimerase inhibitors (such as the fluorinated N-acetyl-glucosamine derivatives disclosed herein) can exist as a single stereoisomer, a racemate, and / or a mixture of enantiomers and / or diastereomers. Thus, unless otherwise stated, the fluorinated N-acetyl-glucosamine derivatives referred to herein include their stereoisomers. As used herein, the term "stereoisomer" refers to any two or more isomers having the same molecular constitution and differing only in the three-dimensional arrangement of their atomic groups in space. Stereoisomers can be diastereomers or enantiomers. In some embodiments, the fluorinated N-acetyl-glucosamine derivatives disclosed herein can be in a substantially pure isomeric form at one or more asymmetric centers (e.g., greater than about 90% ee, 95% ee, 97% ee, or 99% ee) or a mixture thereof (including a racemic mixture).

[0051] Preferably, the fluorinated N-acetyl-glucosamine derivative is an N-acetyl-D-glucosamine-derived compound of formula (IA):

[0052]

[0053] or a pharmaceutically acceptable salt, solvate, or hydrate thereof, or a stereoisomer thereof,

[0054] wherein:

[0055] R 1 、R 3 and R 5 are independently selected from H or C(O)C 1-4 alkyl; and

[0056] R 4 and R 4' are independently selected from H and fluorine, wherein at least one of R 4 and R 4' is fluorine.

[0057] In a preferred embodiment of the compounds of formula (I) and formula (IA), R 1 、R 3 and R 5 are independently selected from H or C(O)C 1-3 alkyl, and more preferably, R 1 、R 3 and R5 Independently selected from the group consisting of H or H or C(O)C 1-2 alkyl.

[0058] In preferred embodiments of the compounds of formula (I) and formula (IA), R 1 is H or C(O)C 1-2 alkyl, and R 3 and R 5 are both acyl.

[0059] In preferred embodiments of the compounds of formula (I) and formula (IA), R 1 , R 3 and R 5 are each acyl.

[0060] In preferred embodiments of the compounds of formula (I) and formula (IA), R 4 is fluorine and R 4' is H, or R 4 is H and R 4' is fluorine, or R 4 and R 4' are both.

[0061] In one or more preferred embodiments, the compounds of formula (IA) are selected from:

[0062]

[0063] or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof.

[0064] In a preferred embodiment, the compound of formula (IA) is:

[0065]

[0066] or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof.

[0067] Keough et al., 2016 and Stephenson et al., 2019 describe suitable methods for preparing fluorinated N-acetyl-glucosamine derivatives. Other methods for preparing N-acetyl-glucosamine derivatives will be apparent to those skilled in the art.

[0068] Other 4-epimerase inhibitors that may be applicable to the present invention have also been previously described. For example, the xyloside Ac-bXyl-TEG(2) described by Stephenson et al., 2019, and the aminooxy and hydrazide functionalized uridine derivatives described by Winans and Bertozzi, 2002.

[0069] Thus, in one embodiment, the 4-epimerase inhibitor is:

[0070]

[0071] or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof.

[0072] In another embodiment, the 4-epimerase inhibitor is a compound of formula (II), formula (III) or formula (IV):

[0073]

[0074] or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof,

[0075] wherein:

[0076] R 6 is selected from:

[0077]

[0078] R 7 is selected from:

[0079] and R 8 is selected from:

[0080]

[0081]

[0082] It should be understood that the present invention is not intended to be limited to the specific 4-epimerase inhibitors described herein. In view of the mechanism underlying the present invention as discovered by the present inventors, any compound that inhibits 4-epimerase can be applicable to the present invention. Preferably, the 4-epimerase inhibitor is a pharmaceutically acceptable compound. Those skilled in the art can readily determine the ability of a compound to inhibit 4-epimerase, for example, using the Western blot of chondroitin-4-sulfate attached to a core protein described by Keough et al., 2016 and Stephenson et al., 2019, or the coupled enzyme system with spectrophotometric readings described by Winans and Bertozzi, 2002.

[0083] It should be understood that, according to the present invention, 4-epimerase inhibitors (including flamine and other fluorinated N-acetyl-glucosamine derivatives as disclosed herein) can be provided as pharmaceutically acceptable salts, hydrates or solvates. The term "pharmaceutically acceptable salt" includes pharmaceutically acceptable solvates and hydrates, as well as pharmaceutically acceptable addition salts of 4-epimerase inhibitors, as appropriate. The term "solvate" includes molecular complexes that contain the 4-epimerase inhibitor and one or more pharmaceutically acceptable solvent molecules, such as, for example, ethanol. When the solvent is water, the term "hydrate" is used. It is also contemplated that 4-epimerase inhibitors may be useful for treating or preventing insulin resistance and related disorders in animals. Accordingly, the term "pharmaceutically acceptable salt" is also intended to include veterinarily acceptable solvates and hydrates, as well as veterinarily acceptable addition salts of 4-epimerase inhibitors, including fluorinated N-acetyl-glucosamine derivatives as disclosed herein.

[0084] In some embodiments, pharmaceutically acceptable salts can include acid addition salts and quaternary ammonium salts. A pharmaceutically acceptable salt involves including another molecule, such as a chloride ion, acetate ion, sulfate ion or other counterion, in the parent compound (i.e., the 4-epimerase inhibitor). The counterion can be any organic or inorganic moiety that stabilizes the charge on the parent compound. Additionally, a pharmaceutically acceptable salt can have more than one charged atom in its structure. When there are multiple charged atoms in the parent compound, its pharmaceutically acceptable salt will have multiple counterions, and these counterions can be several instances of the same counterion or different counterions. Thus, a pharmaceutically acceptable salt can have one or more charged atoms and / or one or more counterions in the parent compound.

[0085] The acid addition salts suitable for the present invention can be formed from 4-epimerase inhibitors (e.g., fluorinated N-acetyl-glucosamine derivatives) and pharmaceutically acceptable inorganic or organic acids, including but not limited to hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, methanesulfonic acid, toluenesulfonic acid, benzenesulfonic acid, acetic acid, propionic acid, ascorbic acid, citric acid, malonic acid, fumaric acid, maleic acid, lactic acid, salicylic acid, sulfamic acid or tartaric acid. The counterions of quaternary amines include chloride ions, bromide ions, iodide ions, sulfate ions, phosphate ions, methanesulfonate ions, citrate ions, acetate ions, malonate ions, fumarate ions, sulfamate ions and tartrate ions. In addition, basic nitrogen-containing groups can be quaternized with agents such as lower alkyl halides, such as methyl, ethyl, propyl and butyl chlorides, bromides and iodides; dialkyl sulfates, such as dimethyl sulfate and diethyl sulfate; and others. The preparation of the pharmaceutically acceptable salts described above and other typical pharmaceutically acceptable salts is more fully described in Berge et al., "Pharmaceutical Salts", Journal of Pharmaceutical Sciences, 1977:66:1-19.

[0086] In some embodiments, according to the present invention, the salts of the 4-epimerase inhibitor can be prepared from the free form of the compound in a separate synthetic step prior to incorporation into a formulation to be administered to a subject. In still other embodiments, the salts of the 4-epimerase inhibitor can be prepared in situ during the preparation of the formulation for administration. For example, the formulation for administration can further comprise a suitable acid which, upon contact with the free form of the 4-epimerase inhibitor, forms in situ the desired pharmaceutical salt for administration.

[0087] In addition, those skilled in the art will recognize that 4-epimerase inhibitors (such as the fluorinated N-acetyl-glucosamine derivatives disclosed herein) can be provided in crystalline form, either as the free compound or as a solvate (e.g., a hydrate), and both forms are intended to be within the scope of the present invention. Solvation methods are generally known in the art.

[0088] The present invention also contemplates the use of pharmaceutically acceptable prodrugs of the 4-epimerase inhibitor for the treatment or prevention of insulin resistance and related disorders. For example, the 4-epimerase inhibitor can be provided in the form of a prodrug which, upon administration to a subject, is capable of (directly or indirectly) providing the desired 4-epimerase inhibitor, or its active metabolite or residue. The term "prodrug" is used in its broadest sense and encompasses those derivatives which are converted in vivo to the active agent. Such prodrugs will be readily apparent to those skilled in the art.

[0089] As previously described, the present invention encompasses the use of 4-epimerase inhibitors (e.g., fluorinated N-acetyl-glucosamine derivatives) in the free base form or as a pharmaceutically acceptable salt or solvate thereof for the treatment of insulin resistance or related disorders (e.g., metabolic diseases). When a specific dose or concentration of a 4-epimerase inhibitor is mentioned herein, it should be understood that the specific dose or dosage refers to the concentration or equivalent of the free base of the 4-epimerase inhibitor. Thus, when using a pharmaceutically acceptable salt of a 4-epimerase inhibitor, those skilled in the art will readily understand that the concentration or dosage of the salt refers to the equivalent concentration or dosage of the free base form of the 4-epimerase inhibitor.

[0090] According to the present invention, a 4-epimerase inhibitor, such as the fluorinated N-acetyl-glucosamine derivative or a pharmaceutically acceptable salt thereof disclosed herein, can be administered together with one or more pharmaceutically acceptable carriers, diluents, adjuvants, and / or excipients. When carriers, diluents, adjuvants, and / or excipients are used, they must be "pharmaceutically acceptable", i.e., compatible with the other components of the composition and not harmful to the subject. Such pharmaceutically acceptable carriers, diluents, adjuvants, or excipients will be apparent to those skilled in the art and may depend on the intended mode of administration. For example, the carrier, diluent, adjuvant, or excipient may vary depending on the formulation and / or mode of administration. In some embodiments, the 4-epimerase inhibitor can be provided in the form of a sustained release formulation.

[0091] The pharmaceutical composition comprising a 4-epimerase inhibitor for use in the present invention can be prepared by any method known in the pharmacological art. Generally, such preparation methods include the steps of associating the 4-epimerase inhibitor with one or more carriers, diluents, adjuvants, excipients, or other auxiliary components, and then shaping and / or packaging the product into the desired single-dose or multi-dose units if needed and / or desired. In certain embodiments, the unit dose composition is those unit dose compositions that contain the daily dose or unit, daily sub-dose (as described herein) of the 4-epimerase inhibitor or an appropriate fraction thereof. As used herein, "unit dose" is a discrete amount of a pharmaceutical composition that contains a predetermined amount of the active ingredient. The amount of the active ingredient (i.e., the 4-epimerase inhibitor) is typically equal to the dose of the active ingredient to be administered to the subject and / or a convenient fraction of such dose, e.g., half or one-third of such dose.

[0092] General considerations in the formulation and / or preparation of pharmaceutical compositions can be found, for example, in Remington's Pharmaceutical Sciences, 16th Edition, E.W. Martin (Mack Publishing Co., Easton, Pa., 1980) and Remington: The Science and Practice of Pharmacy, 21st Edition (Lippincott Williams & Wilkins, 2005).

[0093] In a preferred embodiment, the 4-epimerase inhibitor can be formulated for intranasal administration. In some embodiments, the intranasal formulation can be prepared as a pharmaceutically acceptable emulsion, microemulsion, solution or suspension. Specifically, the 4-epimerase inhibitor can be prepared as an aqueous solution or suspension. When the 4-epimerase inhibitor formulation is an aqueous solution or suspension, the formulation can contain greater than 50% by weight of the total composition, preferably greater than about 60% by weight of the total composition, more preferably greater than about 70% by weight of the total composition, even more preferably greater than about 80% by weight of the total composition of water. In still other embodiments, when the formulations disclosed herein are aqueous solutions or suspensions, water can comprise from about 80% to about 99% by weight of the total composition, more preferably from about 85% to about 98% by weight of the total composition.

[0094] The intranasal compositions disclosed herein can further comprise a pharmaceutically acceptable co-solvent. Suitable co-solvents can include, but are not limited to, alcohols, polyvinyl alcohol, propylene glycol, polyethylene glycol and its derivatives, glycerin, sorbitol, polysorbates, ethanol and mixtures thereof. Specifically, the co-solvent can be selected from glycerin, propylene glycol and mixtures thereof. In still other embodiments, the co-solvent can comprise from about 1% to about 60% by volume of the total composition, preferably from about 2% to about 50% by volume of the total composition, more preferably from about 3% to about 40% by volume of the total composition, even more preferably from about 5% to about 35% by volume of the total composition.

[0095] The intranasal formulations described herein may include a thickening agent. The use of a thickening agent can provide improved adhesion of the formulation to the nasal mucosa without adversely affecting the convenience of administration, particularly when administered as an intranasal spray. In addition, the thickening agent can advantageously improve the nasal absorption of the active agent, increase the residence time of the formulation on the nasal mucosa, and / or reduce losses due to mucociliary clearance of the formulation through the nasal passages. Accordingly, the use of a thickening agent can advantageously provide enhanced bioavailability and / or sustained release of the desired active agent. Suitable thickening agents for use in the present invention can be any pharmaceutically acceptable nasal mucosa-tolerated thickening agents known to those skilled in the art. The thickening agent can advantageously contribute to the controlled release of the active ingredient on the mucosa. Suitable thickening agents for use in the present invention include methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, polyacrylic acid polymers, poly(2-hydroxyethyl methacrylate), polyethylene oxide, polyvinylpyrrolidone, polyvinyl alcohol, tragacanth, sodium alginate, karaya gum, guar gum, xanthan gum, lectins, soluble starch, gelatin, pectin, and chitosan. The amount of thickening agent required to achieve an appropriate balance between the adhesion of the formulation to the nasal mucosa and the sprayability of the formulation may vary depending on the nature of the thickening agent. The amount of a particular thickening agent required to achieve such a balance can be determined by those skilled in the art. For example, the thickening agent can be present in the total composition in an amount of from about 0.1 wt% to about 2 wt%, from about 0.25 wt% to about 1.5 wt%, or from about 0.5 wt% to about 1 wt%.

[0096] In some embodiments, the intranasal formulations suitable for use in the present invention may include one or more of the following: pH regulators, sensory agents, antioxidants, surfactants, binders, stabilizers, osmotic pressure regulators, preservatives, permeation enhancers, chelating agents, sweeteners, flavoring agents, taste masking agents, and coloring agents. Some of the agents or components of the intranasal formulation may have more than one function. For example, when ethanol is used as a sensory agent in the formulations disclosed herein, it can further function as a permeation enhancer and / or co-solvent.

[0097] Suitable additives for nasal preparations and their amounts will be apparent to those skilled in the art. By way of example, suitable sensates can include C2 to C4 alcohols (such as ethanol or isopropanol), menthol, terpenes, thymol, camphor, capsicum, phenol, terpineol, menthol glucuronide, eucalyptus oil, benzyl alcohol, salicyl alcohol, clove oil, mint, spearmint, peppermint, eucalyptus, lavender, citrus, lemon, lime, hexylresorcinol, ketals, diols, and mixtures thereof. Examples of suitable preservatives can include benzalkonium chloride, methylparaben, ethylparaben, propylparaben, butylparaben, benzyl alcohol, sodium benzoate, phenylethyl alcohol, and benzethonium.

[0098] Therapeutic use

[0099] According to the present invention, a 4-epimerase inhibitor or a composition comprising said inhibitor can be used for treating or preventing insulin resistance and related disorders. In the context of the present invention, disorders related to insulin resistance can include disorders that are at least partially caused by insulin resistance (e.g., type 2 diabetes), as well as disorders that at least partially cause or exacerbate insulin resistance per se (e.g., obesity). Such disorders can include, but are not limited to, prediabetes, type 2 diabetes, obesity, metabolic syndrome, hypertension, dyslipidemia, atherosclerosis, non-alcoholic fatty liver disease (NAFLD), polycystic ovary syndrome (PCOS), and coagulopathy.

[0100] According to the present invention, a 4-epimerase inhibitor can be administered to a subject in need of treatment for insulin resistance or a related disorder, or it can be administered prophylactically. Specifically, it is apparent that the methods of the present invention can be used prophylactically, as well as for alleviating the symptoms of insulin resistance or related disorders. Thus, the term "treatment" and the like as referred to herein can include such prophylactic treatment, as well as therapeutic treatment of acute conditions or symptoms. Accordingly, in one or more embodiments, the present invention provides a 4-epimerase inhibitor for the therapeutic treatment of insulin resistance or related disorders. In other embodiments, the present invention provides a 4-epimerase inhibitor for the prophylactic treatment of insulin resistance or related disorders.

[0101] Accordingly, the present invention relates to a method of treating or preventing insulin resistance or a related disorder in a subject, the method comprising administering an effective amount of a 4-epimerase inhibitor to the subject.

[0102] The present invention also relates to the use of a 4-epimerase inhibitor for the preparation of a medicament for treating or preventing insulin resistance or related disorders in a subject.

[0103] The present invention further relates to a 4-epimerase inhibitor for treating or preventing insulin resistance or related disorders in a subject.

[0104] The terms "treat", "treating", or "treatment" with respect to a condition (including a disease or condition as described herein) refer to alleviating or eliminating the cause and / or effects of the condition. As used herein, the terms "treat", "treatment", and "treating" refer to a reduction in the progression, severity, and / or duration of a condition, or an improvement in one or more symptoms (e.g., one or more distinguishable symptoms) of the condition, caused by the administration of one or more therapies (e.g., one or more therapeutic agents such as the 4-epimerase inhibitors disclosed herein) (i.e., "managing" the condition without "curing" the condition). In a specific embodiment, the terms "treat", "treatment", and "treating" refer to an improvement in at least one measurable physical parameter of a condition (such as insulin resistance or related disorders) as described herein. In other embodiments, the terms "treat", "treatment", and "treating" refer to inhibiting the progression of a condition as described herein physically, e.g., by stabilizing distinguishable symptoms, or physiologically, e.g., by stabilizing physical parameters, or both.

[0105] As used herein, the terms "prevent" and "prophylaxis" refer to the pre-administration of a medicament to avoid or prevent the appearance of one or more symptoms of a condition. Those of ordinary skill in the medical art recognize that the term "prevent" is not an absolute term. In the medical art, it is to be understood to refer to the prophylactic administration of a medicament to substantially reduce the likelihood or severity of a condition or the symptoms of a condition, and this is the intended meaning of this disclosure. In the standard text in the field, The Physician's Desk Reference, the terms "prevent", "preventing", and "prevention" with respect to a condition refer to avoiding the cause, effects, symptoms, or progression of a condition before it is fully manifested.

[0106] In some embodiments, the subject in need of treatment or prevention of insulin resistance or related disorders is a mammal. As used herein, the term "mammal" includes humans, primates, domestic animals (e.g., horses, cows, sheep, pigs, donkeys), laboratory test animals (e.g., mice, rats, guinea pigs), companion animals (e.g., dogs, cats), and captive wild animals (e.g., kangaroos, deer, foxes). Preferably, the mammal is a human.

[0107] According to the present invention, the 4-epimerase inhibitor is administered to a subject in need thereof in a therapeutically effective amount. In some embodiments, a therapeutically effective amount is a therapeutically effective amount or a prophylactically effective amount. As used herein, the term "therapeutically effective amount" means an amount of the 4-epimerase inhibitor sufficient to treat or alleviate the symptoms associated with insulin resistance or related disorders. The therapeutically effective amount of the compound to be administered will be determined by such considerations and is the maximum tolerated dose or the minimum amount required to ameliorate, cure, or treat one or more symptoms of the condition or its symptoms. The term "prophylactically effective amount" means an amount effective to prevent or substantially reduce the chance of developing a disease or disorder, or to reduce the severity thereof before the onset of the disease or disorder, or to reduce the severity of one or more symptoms thereof before the symptoms develop. Generally, prophylactic measures can be divided into primary prophylaxis (preventing the development of a disease or symptoms) and secondary prophylaxis (wherein the disease or symptoms have already developed and protecting the patient from the worsening of the process).

[0108] As used herein, the term "effective amount" relates to an amount of the 4-epimerase inhibitor that, when administered according to a desired dosing regimen, provides the desired therapeutic activity. For example, an effective amount of the 4-epimerase inhibitor can be an amount sufficient to inhibit, slow down, interrupt, stop, prevent, or arrest insulin resistance. A suitable effective amount may depend on the age, sex, weight, and general health of the patient and can be determined by the attending physician. Suitable doses can range from about 0.1 ng / kg body weight to 100 g / kg body weight per dose. The dose can range from 1 μg / kg body weight to 10 g / kg body weight per dose, such as from 1 mg / kg body weight to 1000 mg / kg body weight per dose. In one embodiment, the dose can range from 1 mg / kg body weight to 500 mg / kg body weight per dose. In another embodiment, the dose can range from 1 mg / kg body weight to 250 mg / kg body weight per dose. In yet another embodiment, the dose can range from 1 mg / kg body weight to 200 mg / kg body weight per dose, such as up to 50 mg / kg body weight per dose.

[0109] The terms "administer", "administering", or "administration" with reference to the compounds, compositions, or formulations disclosed herein mean introducing an active agent (i.e., a 4-epimerase inhibitor) into the system of a subject in need of treatment. When the active agent is provided in combination with one or more other active agents, "administer" and its variants are each understood to include the simultaneous and / or sequential introduction of the 4-epimerase inhibitor and the other active agents.

[0110] In certain embodiments, an effective amount of a 4-epimerase inhibitor for administration once or more times a day to a 70 kg adult can comprise from about 0.0001 mg to about 4000 mg, from about 0.0001 mg to about 3000 mg, from about 0.0001 mg to about 200 mg, from about 0.001 mg to about 1500 mg, from about 0.01 mg to about 1000 mg, from about 0.1 mg to about 1000 mg, from about 1 mg to about 1000 mg, from about 1 mg to about 100 mg, from about 10 mg to about 1000 mg, or from about 100 mg to about 1000 mg of the 4-epimerase inhibitor per unit dosage form. In certain embodiments, the formulation of the 4-epimerase inhibitor can be at a dosage level sufficient to deliver from about 0.001 mg / kg to about 100 mg / kg, from about 0.01 mg / kg to about 50 mg / kg, from about 0.1 mg / kg to about 40 mg / kg, from about 0.5 mg / kg to about 30 mg / kg, from about 0.01 mg / kg to about 10 mg / kg, from about 0.1 mg / kg to about 10 mg / kg, and from about 1 mg / kg to about 25 mg / kg of the subject's body weight, once or more times a day, to achieve the desired therapeutic effect. In certain embodiments, an effective amount of a 4-epimerase inhibitor for intranasal administration to a 70 kg adult can comprise from about 0.0001 mg to about 4000 mg, from about 0.0001 mg to about 3000 mg, from about 0.0001 mg to about 200 mg, from about 0.001 mg to about 1500 mg, from about 0.01 mg to about 1000 mg, from about 0.1 mg to about 1000 mg, from about 1 mg to about 1000 mg, from about 1 mg to about 100 mg, from about 10 mg to about 1000 mg, or from about 100 mg to about 1000 mg of an extract or compound. In some embodiments, a single dose may be sufficient to treat or prevent insulin resistance and related conditions, which can be delivered in one or more aliquots (e.g., spraying the intranasal formulation once or more times per nostril) to achieve the desired dose. In other embodiments, multiple doses may be required to treat or prevent insulin resistance and related conditions. Administration can occur at intervals of minutes, hours, days, weeks, months, or years, or can occur continuously within any of these time periods. The dose administered can be an amount sufficient to treat or alleviate symptoms associated with insulin resistance or related conditions.

[0111] The intranasal formulations disclosed herein can be administered to a person in need thereof by any suitable intranasal delivery method. Suitable methods for intranasal administration will be well known to those skilled in the art. The intranasal formulations disclosed herein can be administered as a spray or a drop. Accordingly, suitable commercial packages containing the intranasal formulations can be in any spray container known in the art. In one or more embodiments, the formulations disclosed herein can be administered by a spray device or container. The spray device can be a single unit dose system or a multi-dose system, such as comprising a bottle, a pump, and / or an actuator. Such spray devices are commercially available, for example, from Nemera, Aptar Group, Bespak, and Becton-Dickinson. In still other embodiments, the formulations disclosed herein can be administered by an electrospray device, as described in U.S. Patent No. 5,655,517. According to the present invention, other suitable means for intranasal administration of the formulations include by dropper, syringe, squeeze bottle, and any other means known in the art for applying a liquid to the nasal mucosa in an accurate and reproducible manner.

[0112] The spray device for administering the intranasal formulation can be a disposable metered dose spray device, a multi-use metered dose nasal spray device, and is not limited to spraying the solution into each nostril, but can be administered as a gentle stream of liquid from a plunger, syringe, etc. or as droplets from a unit dose or multi-dose squeeze bottle, or other means known in the art for accurately applying a liquid to the nasal mucosa.

[0113] In one or more embodiments, the spray device suitable for the present invention can generally deliver a liquid volume in the range of 0.01 mL to 0.15 mL in a single spray actuation. The typical dosing regimen of a nasal spray product can be in the range from one spray into a single nostril to two sprays into each nostril. Repeated dosing into the same nostril can also be performed. It should be recognized that the dosing schedule can be modified, including the repeated dosing schedule, to obtain the desired pharmacokinetic profile. In addition, the dosing schedule can be modified to achieve a rapid reduction, preferably cessation, of the severity of the symptoms of insulin resistance or related disorders. In some cases, an incremental increase in the repeated dosing may be required to achieve a reduction in the severity of a viral infection or cessation of symptoms. For example, it may be necessary to increase each repeated dose by 25%, 50%, 75%, 100%, 150%, or 200% to achieve a reduction in the severity of insulin resistance or related disorders or cessation of symptoms.

[0114] The amount of 4-epimerase inhibitor administered per dose or the total volume of the composition administered will depend on factors such as the nature and severity of the symptoms, the age, weight, and general health of the patient, and the mode of administration. It should be appreciated that the relative amounts of excipients, solvents, diluents, salts, thickeners, sensates, buffers, and / or any additional ingredients in the pharmaceutical compositions disclosed herein may also depend on the identity, size, and / or medical condition of the subject, as well as the mode of administration. For example, in some embodiments, the dose of a dosage form of 4-epimerase inhibitor required to achieve a therapeutically equivalent effect may be greater compared to another dosage form. As used herein, the term "therapeutically equivalent" or "therapeutically equivalent" refers to different compositions containing the same active agent that produce the same clinical effect and safety profile and / or are pharmaceutical equivalents of each other.

[0115] Formulations containing a 4-epimerase inhibitor can be administered in a single dose or a series of doses. Appropriate doses and dosing regimens can be determined by the attending physician and may depend on the specific medical condition being treated, the severity of the condition, and the general age, health, and weight of the subject. It should be understood that the dosage ranges described herein provide guidance for administering the pharmaceutical compositions to adults. The amount to be administered can be determined by a medical practitioner or a person skilled in the art.

[0116] In certain embodiments, it is contemplated that a 4-epimerase inhibitor, such as the fluorinated N-acetyl-glucosamine derivatives disclosed herein, can be administered to a subject in need thereof as a replacement or substitute for other conventional medications for treating insulin resistance or related conditions. In other embodiments, it is contemplated that a 4-epimerase inhibitor can be administered to a subject in need thereof as a supplement or adjunct to conventional medications. In still other embodiments, it is contemplated that a 4-epimerase inhibitor can be administered to a subject in need thereof in the absence of adjunctive therapy. Treating metabolic diseases with a 4-epimerase inhibitor instead of a conventional medication may be advantageous, particularly in cases where the conventional medication is associated with one or more adverse effects.

[0117] In other embodiments, a 4-epimerase inhibitor can be administered to a subject in need thereof in discrete time periods together with one or more additional therapeutic agents to address specific symptoms of insulin resistance or related conditions. In still other embodiments, a subject in need thereof can be treated with a 4-epimerase inhibitor and one or more additional therapeutic agents (administered sequentially or in combination) over the duration of a treatment period. For example, such combination therapies may be particularly useful when an additive or synergistic therapeutic effect is desired. If the active agents are provided in separate dosage formulations, the active agents can be administered separately or in combination. Additionally, the administration of one active agent can be before, simultaneous with, or after the administration of another agent.

[0118] As used herein, the phrase "combination therapy" is to be understood to mean the administration of an effective amount using a first amount, such as a 4-epimerase inhibitor, and a second amount of an additional suitable therapeutic agent. The "effective amount" of the second agent will depend on the type of drug used. Suitable dosages are known for approved agents and can be adjusted by those skilled in the art based on the condition of the subject, the type of condition being treated, and the amount of the compound or composition used. In certain embodiments, the 4-epimerase inhibitor and the additional therapeutic agent are each administered in an effective amount (i.e., each is administered in an amount that would be therapeutically effective when administered alone). In other embodiments, the 4-epimerase inhibitor and the additional therapeutic agent are each administered in an amount that does not provide a therapeutic effect alone (sub-therapeutic dose). In still other embodiments, the 4-epimerase inhibitor may be administered in an effective amount while the additional therapeutic agent is administered in a sub-therapeutic dose. In yet other embodiments, the 4-epimerase inhibitor may be administered in a sub-therapeutic dose while the additional therapeutic agent is administered in an effective amount.

[0119] As used herein, the terms "combination" or "co-administration" are used interchangeably and refer to the use of more than one therapy (e.g., one or more prophylactic and / or therapeutic agents). The use of these terms does not limit the order in which the therapies (e.g., prophylactic and / or therapeutic agents) are administered to a person in need. Co-administration encompasses the administration of the 4-epimerase inhibitor and one or more additional therapeutic agents in a substantially simultaneous manner, such as in a single pharmaceutical composition, e.g., having a fixed ratio of a first amount and a second amount, or as discrete dosage forms. Additionally, such co-administration also encompasses the use of each compound in a sequential manner in any order. When co-administration involves the separate administration of a first amount of the 4-epimerase inhibitor and a second amount of an additional therapeutic agent, they are administered within a time period close enough to achieve the desired therapeutic effect. For example, the time period between each administration that can produce the desired therapeutic effect can range from a few minutes to several hours, and can be determined considering the characteristics of each compound, such as potency, solubility, bioavailability, plasma half-life, and kinetic profile.

[0120] In one or more embodiments of the co-administration of a 4-epimerase inhibitor and an additional therapeutic agent, the additional therapeutic agent can be any therapeutic agent that provides the desired therapeutic outcome. Specifically, the additional therapeutic agent can be selected from known therapeutic agents for treating or preventing insulin resistance or related conditions (including one or more symptoms thereof). Such therapeutic agents will be known to those skilled in the art. By way of non-limiting example, known therapeutic agents for treating obesity or type 2 diabetes that may be suitable for combination with the 4-epimerase inhibitor of the present invention.

[0121] When a 4-epimerase inhibitor is administered in combination with another therapeutic agent, the other agent can be administered in any "effective amount" that provides the desired therapeutic activity, as described above. Suitable dosages and dosing regimens for the other therapeutic agent can be determined by the attending physician and may depend on the particular condition being treated, the severity of the condition, and the general age, health, and weight of the subject. It should be understood that, unless otherwise indicated, the dosage ranges described herein provide guidance for administering the pharmaceutical compositions to adults. The amount to be administered can be determined by a medical practitioner or a person skilled in the art.

[0122] The 4-epimerase inhibitor and its formulations can be included in a kit. The kit can include, for example, the 4-epimerase inhibitor and another agent, each individually packaged or formulated, or packaged or formulated in combination. Thus, the 4-epimerase inhibitor can be present in a first container, and the kit can optionally include one or more agents in a second container. One or more containers are placed within a package, and the package can optionally include instructions for administration or dosage. The kits disclosed herein can contain the 4-epimerase inhibitor in a form suitable for intranasal administration. The kit can optionally contain instructions describing the use of the pharmaceutical composition in one or more of the methods described herein (e.g., for preventing or treating metabolic diseases). The kit can optionally contain a second pharmaceutical composition comprising one or more of the additional agents, pharmaceutically acceptable carriers, diluents, adjuvants, and / or excipients described herein for combination therapy. The pharmaceutical composition containing the 4-epimerase inhibitor and the second pharmaceutical composition contained in the kit can optionally be combined in the same pharmaceutical composition.

[0123] Those skilled in the art will recognize that the invention described herein is subject to variations and modifications other than those specifically described. It should be understood that the invention described herein includes all such variations and modifications. The invention also includes all such steps, features, methods, compositions, and compounds referred to or indicated in this specification individually or collectively, and any combination and all combinations of any two or more of said steps or features.

[0124] Certain embodiments of the invention will now be described with reference to the following examples, which are for illustrative purposes only and are not intended to limit the scope of the general description above.

[0125] Examples

[0126] Abbreviations

[0127] +ve: positive

[0128] 2-DG: 14C] 2-Deoxyglucose

[0129] III: Third ventricle

[0130] ARC: Arcuate nucleus of the hypothalamus

[0131] AUC: Area under the curve

[0132] BAT: Brown adipose tissue

[0133] chABC: Chondroitinase ABC

[0134] CPSG-ECM: Chondroitin sulfate proteoglycan extracellular matrix

[0135] DAPI: 4',6-Diamidino-2-phenylindole

[0136] ddH2O: Double distilled water

[0137] EGP: Endogenous glucose production

[0138] epiWAT: Epididymal white adipose tissue

[0139] FITC: Fluorescein isothiocyanate

[0140] GIR: Glucose infusion rate

[0141] HABP: Hyaluronic acid binding protein

[0142] HFHS: High-fat high-sugar diet

[0143] HOMA-IR: Homeostatic model assessment of insulin resistance

[0144] I.C.V.: Intracerebroventricular

[0145] I.N.: Intranasal

[0146] I.P.: Intraperitoneal

[0147] epiWAT: Epididymal white adipose tissue

[0148] ingWAT: Inguinal white adipose tissue

[0149] IR: Insulin receptor

[0150] NPY: Neuropeptide-Y

[0151] NZO: New Zealand obese mouse

[0152] p-AKT: AKT Ser-473 phosphorylation

[0153] PF: Pair-fed

[0154] POMC: Pro-opiomelanocortin

[0155] PV: Parvalbumin

[0156] RER: Respiratory exchange ratio

[0157] RSG: Retrosplenial cortex

[0158] UCP1: Uncoupling protein 1

[0159] VMH: Ventromedial hypothalamus

[0160] WFA: Wisteria floribunda agglutinin

[0161] General procedure

[0162] General procedure A. Animals

[0163] According to the NHMRC Australian Code of Practice for the Care and Use of Animals, mice were maintained on a 12-hour light / dark cycle in temperature-controlled high-barrier facilities with free access to food and water. C57BL / 6J and Balb / C mice were obtained from the Animal Resources Centre, Australia, while Agrp-IRES-Cre (strain number: 012899), db / db (strain number: 000697), Npy-GFP (strain number: 006417), Pomc-GFP (strain number: 009593), LSL-Cas9 (strain number: 028551), NZO (strain number: 002105) mice were obtained from Jackson Laboratories, USA. Agrp-IRES-Cre; LSL-Cas9-GFP (AgRP-Cas9) mice were generated by co-housing hemizygous Agrp-IRES-Cre mice with homozygous LSL-Cas9-GFP mice. Male Sprague-Dawley rats (ARC, Canning Vale, Australia) were housed individually on a 12-hour light / dark cycle (lights out at 9:00 am) at a room temperature of 23 ± 2 °C and an indoor humidity of 40%-70% and were provided with nesting / enrichment materials. Animals were fed a standard diet (Barastoc, Ridley AgriProducts, Australia) or a high-fat high-sugar diet (mice: 43% and 20% of total energy from fat and carbohydrates respectively, SF04-001; Specialty Feeds, Australia. Rats: 30% of total energy from fat, SF17-204, Specialty Feeds, Australia). To induce late-stage type 2 diabetes in mice, male C57Bl / 6J mice were fed an HFHS diet for 4 weeks and then received a total of 6 intraperitoneal injections of streptozotocin (STZ, 40 mg / kg, Sigma, in 50 mM sodium citrate buffer at pH 4.5) over the next 2 weeks. Blood glucose levels were monitored, and mice exhibiting stable blood glucose levels >15 mM were used for downstream experiments.The experiments were approved by the University of Melbourne Animal Ethics Committee (10323, 10324, 10352, 10385, 10427, 21712, 22282, 22404).

[0164] General procedure B. Genotyping

[0165] DNA was extracted from tail biopsies using tissue extraction PCR buffer (MDX004, Meridian Bioscience, OH) and amplified by PCR using MyTaq TM HS Red Mix (BIO-25048, Meridian Bioscience, OH) and the following primers to detect Cre (forward: 5'GCG GTCTGG CAG TAA AAA CTA TC'3 (SEQ ID NO:1), reverse 5'GTG AAA CAG CAT TGC TGT CAC TT'3 (SEQ ID NO:2)), LSL-Cas9 (wt forward: 5'AAG GGA GCT GCA GTG GAG TA'3 (SEQ ID NO:3), wt reverse: 5'CAG GAC AAC GCC CAC ACA'3 (SEQ ID NO:4), mt forward: 5'TCC CCA TCA AGC TGATCC'3 (SEQ ID NO:5), mt reverse: 5'CTT CTT CTT TGG GGC CAT CT'3 (SEQ ID NO:6)), Npy-GFP (common forward: 5'TAT GTG GAC GGG GCA GAA GAT CCA GG'3 (SEQ ID NO:7), wt reverse: 5'CCCAGC TCA CAT ATT TAT CTA GAG'3 (SEQ ID NO:8), mt reverse: 5'GGT GCG GTT GCC GTA CTGGA'3 (SEQ ID NO:9)), Pomc-GFP (forward 5'AAG TTC ATC TGC ACC ACC G'3 (SEQ ID NO:10), reverse 5'TGC TCA GGT AGT GGT TGT CG'3 (SEQ ID NO:11)) alleles. The CRISPR-mediated deletion of mouse InsR (ΔInsr CRISPR):Forward 5'GAG ATG GTC CAC CTG AAG GA'3 (SEQ ID NO:12), Reverse 5'GTG AAG GTC TTG GCA GAA GC'3 (SEQ ID NO:13).

[0166] General procedure C. Immunohistochemistry

[0167] For immunohistochemistry of the brain, mice were anesthetized and perfused transcardially with heparinized saline [10,000 units / L heparin] followed by perfusion with 10% neutral buffered formalin. The brains were post-fixed for 16 hours and kept in 30% sucrose in PBS at 4°C for three days to cryoprotect the tissues, after which they were frozen on dry ice. 30-μm sections (120 mm apart) were cut in the coronal plane over the rostro-caudal extent of the entire hypothalamus. The sections were stored long-term at -20°C in cryoprotectant (30% ethylene glycol, 20% glycerol in PBS). To detect only HABP and versican, the sections were subjected to heat-induced epitope retrieval using citrate buffer (10 mM sodium citrate, 0.05% Tween 20, pH 6.0) for 20 minutes at 95°C.

[0168] To detect aggrecan, GFP, HABP, parvalbumin, mCherry, versican, tenascin-C, HAPLN1, neurocan, phosphacan, brevican, WFA, and WFA-FITC sections were incubated in blocking buffer (0.3% Triton X-100, 5% normal goat serum, Gibco, ThermoFisher, MA, 0.02% sodium azide) for 1 hour at room temperature and then overnight at 4°C in 1% blocking buffer containing rabbit anti-aggrecan (1:1000, AB1031, Millipore, MA), chicken anti-GFP (1:2000; ab13970, Abcam, Cambridge, UK), biotinylated HABP (1:100, 385911, Burlington, MA), sheep anti-parvalbumin (1:1000, internal), rabbit anti-dsRed (1:2000, 600-401-379, Rockland, PA), rabbit anti-versican (1:1000, AB1033, Millipore, MA), tenascin-C (1:500, M1-B4, Developmental Studies Hybridoma Bank, Iowa), HAPLN1 (1:500, 9 / 30 / 8-A-4, Developmental Studies Hybridoma Bank, Iowa), neurocan (1:300, 1F6-S, Developmental Studies Hybridoma Bank, Iowa), phosphacan (1:300, 3F8, Developmental Studies Hybridoma Bank, Iowa), brevican (1:500, 610895, BD Transduction Laboratories), biotinylated WFA (1:2000, L1516; Sigma-Aldrich, MO), WFA-FITC (1:2000, FL-1351-2, Vector Laboratories, CA), rabbit anti-PGP9.5 (1:1000, 14730-1-AP, Proteintech, IL), guinea pig anti-AgRP (1:500, AS506, Antibodies Australia, Melbourne, AUS).After washing with PBS-T (0.3% Triton X-100 in PBS, +0.02% sodium azide), the sections were incubated with goat anti-chicken Alexa Fluor 488 (ab150169, Abcam, Cambridge, UK), goat anti-rabbit Alexa Fluor-488, 595, 647 (ab150077, ab150080, ab150083, Abcam, Cambridge, UK), donkey anti-sheep Alexa Fluor 594 (ab150180, Abcam, Cambridge, UK), Alexa Fluor 594, 647 streptavidin (405240, BioLegend, CA) conjugated secondary antibodies in 5% blocking buffer for 2 h at room temperature. The sections were mounted with Mowiol 4-88 mounting medium and visualized using an Olympus BX61 microscope. Images were captured with an Olympus BX61 camera, acquired using Olympus cellSens Dimension software v2.1, and processed using ImageJ software (NIH, MA). Images of cell internalization were captured using a Zeiss LSM880 Airyscan Fast confocal microscope, acquired using Zeiss ZEN software v2.1, and processed using ImageJ software (NIH, MA). The brightness and contrast in the color merged images were adjusted to aid in the analysis of co-incidence.

[0169] For ingWAT immunohistochemistry, ingWAT was immediately dissected and fixed in buffered formalin solution on a rocking platform for 48 h. At room temperature, tissues were embedded in paraffin, and 5-μm sections were prepared at 100-μm intervals. For hematoxylin and eosin (H&E), tissue sections were incubated in hematoxylin for 3 min, followed by incubation in eosin for 30 s. To detect UCP-1, sections were subjected to antigen retrieval in citrate buffer (10 mM sodium citrate, 0.05% Tween 20, pH 6.0) at 95 °C for 20 min. Sections were incubated in 5% blocking buffer at room temperature for 1 h and then overnight at 4 °C in rabbit anti-UCP-1 (1:1000; ab10983, Abcam, Cambridge, UK) in 1% blocking buffer. After washing in PBS-T, sections were incubated with goat anti-rabbit Alexa Fluor488 (ab150077, Abcam, Cambridge, UK) secondary antibody in 5% blocking buffer at room temperature for 2 h. Sections were incubated in DAPI (20 ng / ml in PBS solution) for 10 min, then mounted with Mowiol 4-88 mounting medium and visualized with an Olympus BX61 microscope. Images were captured with an Olympus BX61 camera, acquired using Olympus cellSens Dimension software v2.1, and processed using ImageJ software (National Institutes of Health, USA, Massachusetts). Brightness and contrast in the color-combined images were adjusted to aid in the analysis of co-incidence.

[0170] General procedure D. Functional p-AKT immunohistochemistry

[0171] Mice were intraperitoneally injected with vehicle (PBS) or insulin (3 mU / g, i.p., Actrapid, Novo Nordisk, Denmark), and perfused transcardially with 10% neutral buffered formalin (as described above) for 15 minutes. Brains were post-fixed on a rocking platform at RT for 16 hours and then stored in 30% sucrose in PBS for two days to cryoprotect the tissues, after which they were frozen on dry ice. 30-μm sections were cut in the coronal plane across the rostrocaudal extent of the entire hypothalamus. Sections were pre-treated in 0.3% glycine for 10 minutes, washed in PBS-T, and incubated in 0.03% SDS for 10 minutes. Sections were then blocked in 5% blocking buffer at RT for 1 hour and incubated with rabbit anti-p-AKT (Ser-473) (1:300; #4060, Cell Signaling Technology, Beverly, MA) in 1% blocking buffer for 48 hours. Sections were then incubated in 5% blocking buffer containing goat anti-rabbit Alexa Fluor 647 (ab150083, Abcam, Cambridge, UK) or biotinylated goat anti-rabbit (BA-1000, Vector Laboratories, CA, blocking buffer without sodium azide). Fluorescent sections were mounted with Mowiol 4-88 mounting medium and visualized using an Olympus BX61 microscope. Images were captured with an Olympus BX61 camera, acquired using Olympus cellSens Dimension software v2.1, and processed using ImageJ software (National Institutes of Health, MA). For chromogenic detection, the p-AKT signal was amplified using an ABC-HRP kit (1:500, PK-4000, Vector Laboratories, CA), and visualized using a 0.1% H2O2 DAB solution (3,3'-diaminobenzidine, ICN980681, Thermo Fisher Scientific, MA) peroxidase substrate kit (Vector Laboratories, UK). p-STAT3 and p-AKT immunopositive cells were visualized using a Leica DM2000 LED brightfield microscope with a Leica DMC6200 camera and Leica Application Suite X software.

[0172] General procedure for E.CSPG-ECM immunofluorescence analysis

[0173] Stereological assessment of ARC CSPG-ECM was performed on the entire rostro-caudal ARC. The ARC was divided into three zones, including the rostral ARC (-1.22 / -1.58 mm anterior-posterior), medial ARC (-1.58 / -1.94 mm anterior-posterior), and caudal ARC (-1.94 / -2.18 mm anterior-posterior). CSPG-ECM was quantified in the VMH and RSG cortex (-1.58 / -1.94 mm anterior-posterior).

[0174] All image quantification was performed in Image J (National Institutes of Health, USA) software (National Institutes of Health, Massachusetts). The raw images were background subtracted using a rolling ball algorithm to minimize any potential differences in background and tissue autofluorescence. To quantify the area and intensity of CSPG-ECM within each brain region (ARC, VMH, or RSG cortex), the images were thresholded and binarized to create a region of interest (ROI) mask of only the CSPG-ECM of interest. For each brain region, the CSPG-ECM ROI area (μm 2 ) and intensity (sum of all pixel intensities within the ROI) were calculated. This process was automated to minimize bias and account for differences in brain nucleus size across multiple images. Brain nuclei were defined according to the Paxinos and Franklin mouse brain atlas (http: / / labs.gaidi.ca / mouse-brain-atlas / ). The area and intensity of CSPG-ECM within each zone were normalized relative to the corresponding control.

[0175] To determine the co-localization (WFA positive staining) of ECM components (HA, HAPLN1, tenascin-C, aggrecan, versican, phosphacan, brevican, neurocan) within CSPG-ECM, 2 masks were generated for each image: one for the total CSPG-ECM staining and another for the component staining within the ARC. The overall area and intensity of the total CSPG-ECM structure were calculated. The area and intensity of the components within CSPG-ECM were determined by quantifying the expression only within the total CSPG-ECM mask. This allowed for the characterization of ECM components specifically expressed within ARC CSPG-ECM. The area and intensity of CSPG-ECM within each zone were normalized relative to the corresponding control. Conversely, to determine the co-localization of WFA-labeled ARC CSPG-ECM within ARC CSPG-ECM components, 2 masks were generated for each image; one for the total CSPG-ECM staining and another for the component staining within the ARC. The overall area and intensity of the total component structure were calculated. The area and intensity of CSPG-ECM containing the components were determined by quantifying the WFA expression only within the total component mask. The area and intensity of CSPG-ECM within each zone were normalized relative to the corresponding control. This combined approach further characterized the specificity of the components to the CSPG-ECM zones.

[0176] General procedure F. Quantification of ARC neurons within CSPG-ECM

[0177] To determine which metabolism-related ARC neurons were encapsulated within CSPG-ECM during the development of metabolic diseases, brains were analyzed from Npy-GFP (for visualizing AgRP / NPY neurons) and Pomc-GFP (for visualizing POMC neurons) mice fed a HFHS diet for 0, 4, and 12 weeks. As described in the immunohistochemistry section, ARC sections were stained for GFP and WFA and analyzed using Image J (National Institutes of Health, USA) software. To determine the number of GFP-positive neurons encapsulated within CSPG-ECM, two masks were generated. To define the CSPG-ECM structure in the ARC image, the image was thresholded and binarized to create the CSPG-ECM mask. To identify individual GFP-positive neurons, the image was thresholded and binarized to create the GFP mask. To define individual GFP neurons, the GFP mask was segmented using the watershed separation algorithm. The total number of GFP-positive cells was counted within the entire ARC region and within the CSPG-ECM mask. This quantified the percentage of GFP cells covered by CSPG-ECM in the ARC.

[0178] To determine the intensity of CSPG-ECM specifically surrounding individual GFP cells in the ARC, the GFP images were thresholded and binarized. Using the dilation, distance map, and Voronoi processes in ImageJ software, a ROI of 1.29 μm was generated around each GFP cell (average size of the ECM surrounding cortical neurons). This produced a mask that could specifically analyze the CSPG-ECM contiguous with individual GFP cells. Using this mask, the CSPG-ECM staining intensity around GFP cells present within the ARC CSPG-ECM was determined.

[0179] General procedure G. Behavior meets order

[0180] Mice were fasted overnight and individually housed in clear cages with free access to water. Two hours after the start of the light cycle (9:00 am), pre-weighed food was provided to the mice, and the mice were observed for 90 minutes without interference and carefully. During the 90-minute observation, the instantaneous behavior was scored every 30 seconds. The behavior at each 30-second interval was recorded according to the following classification: eating (the animal at the hopper attempts to obtain food, chew, or gnaw), drinking (the animal licks the water spout), grooming (the animal scratches, bites, or licks any part of its anatomy), resting (the animal curls up and rests with eyes closed), active (the animal shows activity, including movement, sniffing, rearing), or inactive (the animal does not move when conscious, or shows signs of illness behavior). The data were collated into 5-minute statistical stacks, and several variables were evaluated, including: the average percentage of time the mice participated in each recorded behavior (% of total behavior), food intake, the transition from eating to resting, and the time to satiety (the time at which the frequency of the eating behavior intersects with the frequency of the resting behavior).

[0181] General procedure H. Hyperinsulinemic euglycemic clamp in awake freely behaving mice

[0182] For hyperinsulinemic euglycemic clamps, mice were anesthetized with isoflurane and cannulated in the right jugular vein for infusion as previously described by Dodd et al., 2018. The catheter was attached to an implantable button (BMSW25, RWD Life Sciences, Shenzhen, China). The implant button was capped, allowing group housing of the mice, and the catheter was kept patent by flushing daily with 40 μL of saline containing 200 units / mL heparin. On the day of the experiment, food was removed at 7:00 am. After a 3.5-hour fast, a primed (1 minute, 1.25 μCi / min) continuous infusion (0.05 μCi / min) of [3-3H]glucose (NET331A001MC, PerkinElmer, MA) was administered to measure whole-body glucose turnover as previously described by Dodd et al., 2018. Ninety minutes later, the mice received a 40 mU / Kg insulin bolus over 10 minutes, followed by a continuous insulin infusion (4 mU / kg / min of gelofusine). Euglycemia (≈8 - 10 mM blood glucose) was maintained by variable infusion of a 30% glucose solution.

[0183] During steady-state conditions (Ra = Rd), tail blood samples were collected at 80, 90, 100, 110, and 120 minutes to determine Rd and Ra as described above. At 120 minutes, a 13 uCi bolus of 14 C]-2-deoxy-D-glucose (NEC495A250UC, PerkinElmer, MA) was injected into the jugular vein, and blood was sampled at 122, 125, 135, 145, and 155 minutes. At the end of the experiment, tissues were harvested for determination of glucose uptake.

[0184] General procedure I. Pair-feeding

[0185] Twelve-week-old HFHS-fed C57BL / 6J mice were bilaterally injected with vehicle or chABC into the ARC. Twenty-four-hour food intake was determined in mice treated with chABC within the ARC, and a group of mice treated with vehicle within the ARC was pair-fed such that the food supply was restricted to the mean food consumption of mice treated with chABC within the ARC.

[0186] General procedure J. Metabolic assessment

[0187] Metabolic measurements were performed at the Melbourne Mouse Metabolic Phenotyping Platform (The University of Melbourne, Melbourne, Australia). Glucose tolerance tests were performed on conscious mice fasted for 6 h by injecting D-glucose (2 mg / g lean body mass and 1 mg / g lean body mass for db / db and HFHS+STZ mice, respectively) into the peritoneal cavity and measuring glucose in tail blood immediately before and at 15, 30, 45, 60, 90, and 120 min after injection using an Accu-Check glucometer (Roche, Germany). The area under the blood glucose excursion curve was determined and expressed as mmol / L×min. Fasting (12-h fast) plasma insulin or blood glucose levels were determined using a rat / mouse insulin ELISA (EZRMI-13K, Merck Millipore, CA) or an Accu-Check glucometer, respectively. HOMA-IR was calculated using the equation [(glucose×insulin) / 405]. Obesity propensity was measured using a TD-NMR minispec (Bruker Optics Inc., Billerica, MA).

[0188] Mice were acclimated for 24 h and then monitored for 48 h in a Promethion metabolic screening system (Sable Systems International, NV) equipped with indirect open-circuit calorimetry, food consumption, and activity monitors in an environmentally controlled setting to measure activity, caloric intake, and energy expenditure. The respiratory quotient was calculated as the ratio of CO2 production to O2 consumption, and the respiratory exchange ratio and energy expenditure were calculated using the Weir equation (Kcal h-1 = 60×(0.003941×VO2 + 0.001106×VCO2)). To account for differences in body mass / composition, ANCOVA was used, and energy expenditure was analyzed and adjusted using a script available on the energy expenditure analysis page (https: / / www.mmpc.org / shared / regression.aspx) of the National Mouse Metabolic Phenotyping Centers (MMPC, Nashville, TN, USA).

[0189] To provide indices of ingWAT and BAT thermogenesis, temperature changes in the inguinal and interscapular regions were measured using infrared thermography, as previously described (Dodd et al., 2019). An FLIR T1010 thermal imaging camera (FLIR Systems Australia Pty Ltd, VIC, Australia) was mounted on a tripod, and animals were positioned at a standard distance of 70 cm from the camera. Animals were anesthetized, the area of interest was shaved, and whole-body images were collected in both the prone and supine positions. Temperatures were analyzed using the FLIR ResearchIT Max 4 program (FLIR Systems, OR, United States). Peak temperatures within ingWAT and BAT were determined.

[0190] General procedure K. Stereotactic surgery

[0191] All stereotactic injections were performed under isoflurane anesthesia using an Ultra-Precision Stereotaxic Instrument (963 Kopf, Munich, Germany) or an Ultra-Precision Rotary Stereotaxic Instrument (69100, Shenzhen Reword Biotechnology Co., Ltd., Shenzhen, China) and a Stereotaxic Nanoinjector (788130, KD Scientific, Holliston, MA) with a Neuro syringe (Hamilton, NE).

[0192] To dissociate CSPG-ECM within the ARC, mice received bilateral (unless otherwise noted) administration of active chABC (C3667, Sigma, St. Louis, MI) at 15 mU / side, dissolved in 1 M trehalose, or heat-inactivated chABC protein as vehicle (chABC in 1 M trehalose heat-inactivated at 85 °C for 45 min as previously described by Alonge et al., 2020), in a total volume of 150 nl / side. To pulse CSPG-ECM within the ARC or RSG, mice received bilateral (unless otherwise noted) administration of biotinylated WFA (0.3 μg / side, volume of 150 nl). To disrupt IR in AgRP neurons, 12-week HFHS-fed AgRP-Cas9 mice were stereotaxically injected with AAV expressing U6-driven guide RNAs targeting the InsR gene or scrambled sequence (5'GTGTAG TTC GAC CAT TCG TG'3 (SEQ ID NO:14)) together with a CAG-driven mCherry FLEX switch. Unless otherwise noted, injections were bilateral into the ARC (coordinates, bregma: anterior-posterior, –1.70 mm; dorsal-ventral, –5.85 mm; lateral, + / –0.18 mm, 200 nl / side) or into the RSG (coordinates, bregma: anterior-posterior, –1.40 mm; dorsal-ventral, –1.80 mm; lateral, + / –0.50 mm, 200 nl / side). Unilateral injection of WFA-biotin was made into the cc (coordinates, bregma: anterior-posterior, –1.40 mm; dorsal-ventral, –5.80 mm; lateral, + / -0.20 mm, 200 nl / side).

[0193] General Procedures L. Virus Production

[0194] To generate AAV-g scramble (pAAV-U6>mScramble-GTGTAGTTCGACCATTCGTG (SEQ ID NO:14)-CAG>LL:rev(mCherry):rev(LL):WPRE) and AAV-gIR

[0195] (pAAV[-U6>mInsr[gRNA-TATCGACTGGTCCCGTATCC(SEQ ID NO:

[0196] 15)]-U6>mInsr[gRNA-GTCTGTCCAGGCACCGCCAA(SEQ ID NO:

[0197] 16)] - CAG>LL:rev(mCherry):rev(LL):WPRE) viral vector, first design sgRNA using online CRISPR tools (http: / / crispr.mit.edu and http: / / chopchop.cbu.uib.no / ). Use Off-Spotter (https: / / cm.jefferson.edu / Off-Spotter / ) to computationally evaluate potential off-target gRNA binding, and considered guides that exhibited ≥3 mismatches with non-specific genomic regions (Anderson et al., 2015). For AAV-g scramble, use Gibson assembly of the pDONR P4-P1R backbone and primers 5'

[0198] GGGGACAACTTTGTATAGAAAAGTTGGAGGGCCTATTTCCCATGATTC'3 (SEQ ID NO:17) and 5'GGGGACTGCTTTTTTGTACAAACTTGAAAAAAGCACCGACTCGGTGCC'3 (SEQ ID NO:18) to generate the pUp-U6>Scramble gRNA vector. For AAV gIR, use the AarI-digested pUp-U6-gRNA-AarI-Stuffer-AarI backbone and primers 5'

[0199] ATATCTTGTGGAAAGGACGAAACACCGTATCGACTGGTCCCGTATCCG'3 (SEQ ID NO:19) and 5'AACTTGCTATTTCTAGCTCTAAAACTTGGCGGTGCCTGGACAGAC'3 (SEQ ID NO:20) to generate the pUp-U6>mInsr[gRNA-TATCGACTGGTCCCGTATCC(SEQ ID NO:15)]-U6>mInsr[gRNA-GTCTGTCCAGGCACCGCCAA(SEQ ID NO:16)] gRNA vector. For both AAV-g scramble and AAV-gIR, the p-Up vector was cloned together with pDown-CAG and pTail-LL:rev(mCherry):rev(LL) to generate the final vector via an LR reaction using the Gateway method. AAV vectors were packaged into the AAV-DJ / 8 serotype at a titer of >2 × 10^13 GC / ml). All vector cloning and AAV packaging were completed by VectorBuilder (Chicago, IL).

[0200] Insulin Extravasation in the General Procedure M.ARC

[0201] Twelve-week HFHS-fed C57BL / 6J or age-matched chow-fed controls received bilateral injections of vehicle or chABC into the ARC. Three days after injection (before the weight difference was seen), the mice were fasted for 6 hours. To evaluate insulin extravasation into the ARC in mice, the mice were administered insulin-FITC (50 μg / animal, volume of 100 μl, i.v., I3661, Sigma-Aldrich, St. Louis, MO) or FITC (64.3 μmol / animal, volume of 100 μl, i.v., F3651, Sigma-Aldrich, St. Louis, MO). The mice were perfused 30 minutes after injection (as described above). To evaluate insulin extravasation into the ARC, regardless of the BBB, insulin-FITC (1 μg / animal, volume of 2 μl) was directly administered into the lateral ventricle of the mice. For this, the mice were anesthetized and insulin-FITC was stereotaxically injected (as described above) into the lateral ventricle (coordinates, bregma: anterior-posterior, –0.20 mm; dorsal-ventral, –2.4 mm; lateral, +0.10 mm) at a rate of 200 nl / min. The mice were perfused 20 minutes after the start of injection (as described above). To evaluate insulin-FITC, the brains were fixed overnight and cryoprotected in 30% sucrose in PBS. To preserve the autofluorescence signal, the brains and sections were kept in the dark and mounted and imaged immediately after sectioning.

[0202] General Procedure N. Lateral Ventricle Catheter

[0203] Under isoflurane anesthesia, 12-week HFHS-fed C57BL / 6J or AgRP-Cas9 mice were stereotaxically implanted with a guide cannula into the right lateral ventricle (0.2 mm posterior, 1.0 mm lateral to bregma). The guide cannula was positioned 1.3 mm above the injection site (1 mm ventral to the surface of the skull). AgRP-Cas9 mice were treated with AAV-g scrambled or AAV-gIR and guide cannula placement was performed 7 days after AAV administration. The mice received vehicle (ddH2O), flumamine (100 μg / animal / day or 250 μg / animal / day) I.C.V., volume of 2 μl / animal, and all compounds were delivered approximately 1 hour before lights out (7 PM).

[0204] General Procedure O. Intranasal Drug Delivery

[0205] Awake mice were restrained by scraping and inverted parallel to the floor with the chin at approximately a 180-degree angle to the neck. Using a 10 μL tip, 5 μL of vehicle (ddH2O) or fluoramine (1 mg / animal in 20 μL or 5 mg / animal in 20 μL) was loaded into the pipette. The tip of the filled pipette was placed at a 45-degree angle near the left nostril and the drug was ejected to form a small 5 μl droplet at the tip for the mouse to inhale. Immediately after the mouse inhaled the first droplet, the remaining solution was ejected to form another small droplet for the mouse to inhale through the same nostril. The mouse was kept in this position for 15 seconds before repeating the procedure in the right nostril. The mouse was returned to the cage for 2 minutes and the process was repeated such that each mouse received four droplets, each 5 μl, delivering a total of 20 μl of solution. All drugs were administered approximately 1 hour before lights out (7:00 p.m.).

[0206] General procedure P.CSPG-ECM tracker validation and quantification

[0207] To determine CSPG-ECM turnover in the ARC, RSG, or CC, mice received stereotaxic injections of biotinylated WFA (WFA-biotin) as described in the stereotaxic surgery section. At the experimental endpoint, mice were perfused transcardially and pulsed-labeled ARC CSPG-ECM was identified by immunofluorescent detection of WFA-biotin (CSPG-ECM at the pulse time) and WFA-FITC (total CSPG-ECM) as described in the immunohistochemistry section.

[0208] To trace pulsed WFA-biotin in the ARC, sections were imaged and analyzed using Image J (National Institutes of Health) software. The raw images were background subtracted using a rolling ball algorithm to minimize background and tissue autofluorescence. To quantify the stained area within the ARC, the images were thresholded and binarized to create ROI masks for WFA-biotin and WFA-FITC. For each image, the stained ROI area (μm 2 ) and intensity (sum of all pixel intensities within the ROI) were calculated.

[0209] To validate the CSPG-ECM tracer technique, 8-week-old C57BL / 6J mice were unilaterally stereotaxically injected with WFA (0.3 μg / side, volume of 150 nl) to pulse CSPG-ECM into one side of the ARC and saline into the other side. One day later, the mice were perfused transcardially, and ARC brain sections were stained and analyzed for CSPG-ECM tracer analysis. To determine the fidelity of the pulsed WFA-biotin representation of current CSPG-ECM, the percentage of the area of co-localization of WFA-biotin (pulse-labeled) with WFA-FITC (total CSPG-ECM present) was quantified.

[0210] To verify that the traced WFA-biotin signal represents authentic CSPG-ECM staining, WFA (0.3 μg / side, volume of 150 nl) was bilaterally stereotaxically injected into the ARC of 8-week-old C57BL / 6J mice. Three days later, the mice received unilateral ARC injections of chABC (15 mU / side, volume of 150 nl) or vehicle to disassemble the WFA-biotin-bound CSPG-ECM. To determine the specificity of the pulsed WFA-biotin, the area and intensity of WFA-biotin staining were quantified and compared in the chABC- and vehicle-treated sides of the ARC.

[0211] To determine CSPG-ECM turnover in lean and obese mice, WFA-biotin (0.3 μg / side, volume of 150 nl) was bilaterally stereotaxically injected into the ARC of 12-week HFHS-fed C57BL / 6J mice or age-matched controls. Brains were extracted 1 day (day 0) after surgery or 1, 3, 5, and 10 weeks after injection. Brain sections were stained to determine the presence of WFA-biotin and WFA-FITC, and the area of WFA-biotin staining was quantified as described above. To determine CSPG-ECM turnover, the WFA-labeled CSPG-ECM present at the start of the experiment (day 0) was compared to that remaining at weeks 1, 3, 5, and 10. CSPG-ECM was labeled with WFA-FITC at each time point to verify the presence of ARC CSPG-ECM and to ensure that changes in WFA-biotin labeling were not due to loss of CSPG-ECM over time. The same procedure was used to evaluate turnover in the RSG of the CC and in blood vessels.

[0212] General procedure Q. ARC CS-GAG and HA quantification

[0213] Microdissected ARC tissues from male mice fed an HFHS diet for 0 and 12 weeks were incubated for 30 minutes in extraction buffer containing 8 M urea, 0.5% Triton x-100, 5 mM Tris 2-carboxyethylphosphine, and protease inhibitor mixture without cOmplete TM mini ETDA (Merck), gently mixed, and then homogenized. Samples were centrifuged at 5000 rpm for 30 minutes, and the supernatant was collected and the buffer was exchanged into PBS using Amicon Ultracell-10k MWCO centrifugal tubes. Protein concentration of each sample was estimated using Bradford assay. 20 μg of each protein extract was reduced with 5 mM dithiothreitol at 50 °C for 30 minutes and alkylated with 10 mM iodoacetamide at room temperature for one hour, then blotted onto a 0.45 μm PVDF membrane (Millipore, catalog number IPVH20200) and dried overnight. Each sample dot was transferred to a 96-well plate and blocked with 1% (v / v) polyvinylpyrrolidone solution.

[0214] The disaccharide analysis procedure was adapted from Moh et al., 2022 with the following modifications. GAG disaccharides were released from PVDF sample dots using an enzyme mixture containing 5 mU chondroitinase ABC (chABC; Sigma, catalog number C3667), 50 ng each of heparinase I / II / III (R&D Systems) in 100 mM ammonium acetate (pH 7), 5 mM calcium chloride, and incubated overnight at 30 °C. An additional mixture of purified GAG polysaccharides was digested with the samples as an enzyme reaction control and retention time standard, the mixture containing 1 μg each of bovine kidney heparan sulfate (Sigma Aldrich, H7640), 10 μg shark chondroitin sulfate (Sigma Aldrich, C4382), and 1 μg Streptococcus equi HA (Sigma Aldrich, 53747). Digested disaccharides were collected and dried under low pressure for labeling with 2-AB (2-aminobenzamide) according to the commercially available protocol (Ludger LT-KAB-VP24-Guide-v2.0). Samples were labeled with 2-AB together with a standard mixture of 8 common HS (Iduron, UK, HS mixture) and 8 common CS disaccharides (Iduron, UK, CS mixture), and washed twice with octanal to remove excess labeling agent. The cleaned samples in the aqueous layer were dried and resuspended in 75% acetonitrile with 10 mM ammonium acetate (pH 6.8).

[0215] The labeled disaccharides were separated by liquid chromatography using an Agilent 1260 Infinity II with fluorescence detection at 35 °C on a SeQuant ZIC-HILIC column (3.5 μm, 1 mm × 150 mm). Mobile phase solvents A (10 mM NH4Ac, pH 6.8) and B (90% acetonitrile in 10 mM NH4Ac, pH 6.8) were run in microflow mode at a constant flow rate of 50 μL / min, with gradient parameters as follows: 0–3 min – 100% B, 4 min – 90% B, 20 min – 88% B, 35 min – 70% B, 36–40 min – 60% B, 42–50 min – 100% B. Fluorescence detection was performed at excitation and emission wavelengths of 320 nm and 420 nm, respectively. Peaks were identified using a standard plate and a polysaccharide digestion control as retention time references, and abundances were manually quantified by peak area.

[0216] General procedure R. Patch-clamp electrophysiology

[0217] Male Npy-GFP mice were placed on an HFHS diet for 12 weeks, after which they received a stereotaxic injection of vehicle (n = 4) or chABC (n = 4) into the ARC 3 days before electrophysiological characterization. Before brain extraction, mice were anesthetized with isoflurane, and the brains were incubated in ice-cold aCSF with the following composition: 127 mM NaCl, 1.2 mM KH2PO4, 1.9 mM KCl, 26 mM NaHCO3, 3 mM D-glucose, 7 mM mannitol, 2.4 mM CaCl2, 1.3 mM MgCl2 (saturated with 95% O2 and 5% CO2, pH 7.4). Coronal slices (250 μm) of the ARC were cut using a vibratome (Leica VTS1000S, Germany). Slices were heated at 34 °C for 30 min and then cooled to room temperature before recording. Slices were placed in a recording chamber and continuously perfused with room temperature aCSF.

[0218] Npy-GFP neurons in the ARC were visualized using fluorescence and differential interference contrast optics, in combination with an infrared video microscope (AxioCam MRm, Zeiss, Germany) and an upright microscope (BX51WI, Olympus, Germany). For current-clamp recordings, patch pipettes (8–11 MΩ) were pulled from thin-walled borosilicate glass (Sutter Instruments, BF150-86-10) using a horizontal puller (Sutter Instruments, USA) and filled with an intracellular solution containing: 140 mM K-gluconate, 10 mM HEPES, 10 mM KCl, 1 mM EGTA, 4 mM Na-ATP, 0.3 mM Na-GTP, and 10 mM biocytin (300 mOsm and pH 7.3, adjusted for osmolarity and pH with sucrose and KOH, respectively). In voltage-clamp recordings examining K+ currents, the patch pipettes (3–6 MΩ) were filled with an intracellular solution containing: 130 mM K-gluconate, 6 mM NaCl, 4 mM NaOH, 11 mM EGTA, 1 mM CaCl2, 10 mM HEPES, 1 mM MgCl2, 2 mM Na-ATP, 0.2 mM Na-GTP, 0.1% biocytin (295 mOsm and pH 7.3, adjusted for osmolarity and pH with sucrose and KOH, respectively). Cells with series resistance >20 MΩ were not included in the analysis. Recordings were made in the presence of tetrodotoxin, starting from a holding potential of -80 mV, with 11 depolarizing pulses from -40 mV to +60 mV applied in 10 mV increments for 500 ms. A 50 ms prepulse to 0 mV was used to inactivate any remaining voltage-dependent Na+ currents. Whole-cell recordings were made using a dual-IPA integrated patch amplifier controlled by SutterPatch software (Sutter Instruments, USA), with all current-clamp data filtered at 5 kHz. Data were analyzed using Sutterpatch (Sutter Instruments, USA) and Clampfit 10.7 (Axon Instruments).

[0219] General procedure S. Immunoblotting

[0220] The medial basal hypothalamus was microdissected and quickly frozen in liquid N2. Tissues were mechanically homogenized in 100 ul of ice-cold RIPA lysis buffer (ab156034, Abcam, UK, containing PhosStop phosphatase inhibitor, 1 tablet / 10 mL; Roche PHOSS-RO) and clarified by centrifugation (13,000 x rpm, for 20 minutes at 4 °C). Tissue lysates were resolved by SDS-PAGE and immunoblotted as described previously (PMID: 31509751). The antibodies used were rabbit phospho-IR (Tyr1162, Tyr1163) polyclonal antibody (1:1000, 44-804G, Invitrogen, MA), rabbit monoclonal anti-IR (1:1000, 3025x, Cell Signaling, MA), rabbit β-actin polyclonal antibody (1:2000, 4967, Cell Signaling), mouse Gapdh monoclonal antibody (1:5000, 60004-1-Ig, Proteintech, IL), mouse monoclonal anti-tubulin (1:2000, T5168, Sigma).

[0221] General procedure T. Real-time PCR

[0222] RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA) and the total RNA quality and quantity were determined using NanoDrop 3300 (Thermo Scientific, Wilmington, DE, USA). mRNA was reverse transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA) and processed for quantitative real-time PCR using SYBR Green PCR Master Mix (4309155, Applied Biosystems, MA). The following primers were used for SYBR green expression assays:

[0223] Adamst4 (f-GAACGGTGGCAAGTATTGTGAGG (SEQ ID NO:21),

[0224] r-TTCGGTGGTTGTAGGCAGCACA (SEQ ID NO:22)),

[0225] Adamst5 (f-CTGCCTTCAAGGCAAATGTGTGG (SEQ ID NO:23),

[0226] r-CAATGGCGGTAGGCAAACTGCA (SEQ ID NO:24)),

[0227] Il-6 (f-GGTGCCCTGCCAGTATTCTC (SEQ ID NO:25)),

[0228] r-GGCTCCCAACACAGGATGA (SEQ ID NO:26)),

[0229] Kcna4 (f-GCAGATTGCTGAATGACACCTCG (SEQ ID NO:27)),

[0230] r-GGACAAGCAAAGCATCGAACCAC (SEQ ID NO:28)),

[0231] Kcnb1 (f-GAGGAGTTCGACAACACGTGCT (SEQ ID NO:29)),

[0232] r-TGAGTGACAGGGCAATGGTGGA (SEQ ID NO:30)),

[0233] Kcnb2 (f-GCTGGAGAAACCTAACTCGTCC (SEQ ID NO:31)),

[0234] r-CTCGTCGTTTTCTTGCAGCTCTG (SEQ ID NO:32)),

[0235] Kcnc3 (f-GAAGAGGTGATTGAAACCAACAGG (SEQ ID NO:33)),

[0236] r-TGGGCTCTTGTCTTCTGGAGAC(SEQ ID NO:34)), Kcnc4 (f-CCAGCTCGAATCGCCCATTTAC(SEQ ID NO:35), r-AGCACCGCATTAGCATCGCCAT(SEQ ID NO:36)), Kcnd2 (f-CCTACATGCAGAGCAAGCGGAA(SEQ ID NO:37), r-GTGGTTTTCTCCAGGCAGTGAAG(SEQ ID NO:38)), Kcnd3 (f-AGAAGAGGAGCAGATGGGCAAG(SEQ ID NO:39), r-CTTGATGGTGGAGGTTCGTACAG(SEQ ID NO:40)), Kcnj11 (f-TGCGTCACAAGCATCCACTCCT(SEQ ID NO:41), r-GGACATTCCTCTGTCACCATGC(SEQ ID NO:42)), Kcnj3 (f-CAGTTCGAGGTTGTCGTCATCC(SEQ ID NO:43), r-CCCAAAGCACTTCGTCCTCTGT(SEQ ID NO:44)), Kcnj6 (f-GGAACTGGAGATTGTGGTCATCC(SEQ ID NO:45), r-TCTTCCAGCGTTAGGACAGGTG(SEQ ID NO:46)), Kcnj9 (f-TCTCACCTCTCGTCATCAGCCA(SEQ ID NO:47), r-GCTTCGAGCTTGGCACGTCATT(SEQ ID NO:48)), Kcnma1 (f-CCTGAAGGACTTTCTGCACAAGG(SEQ ID NO:49), r-ACTCCACCTGAGTGAAATGCCG(SEQ ID NO:50)), Kcnn3 (f-TCCACCGTCATCCTGCTTGGTT(SEQ ID NO:51), r-CAGGCTGATGTAGAGGATACGC(SEQ ID NO:52)), Kcnq3 (f-AAGCCTACGCTTTCTGGCAGAG(SEQ ID NO:53), r-ACAGCTCGGATGGCAGCCTTTA(SEQ ID NO:54)), Mmp13 (f-AGCAGTTCCAAAGGCTACAACT(SEQ ID NO:55), r-GGATGCTTAGGGTTGGGGTC(SEQ IDNO:56)), Mmp14 (f - AGCACTGGGTGTTTGACGAA (SEQ ID NO:57), r - CCGGTAGTACTTATTGCCCCG (SEQ ID NO:58)), Mmp2 (f - GTCGCCCCTAAAACAGACAA (SEQ ID NO:59), r - GGTCTCGATGGTGTTCTGGT (SEQ ID NO:60)), Mmp9 (f - GCTGACTACGATAAGGACGGCA (SEQ ID NO:61), r - TAGTGGTGCAGGCAGAGTAGGA (SEQ ID NO:62)), r18s (f - CAGCTCCAAGCGTTCCTGG (SEQ ID NO:63), r - GGCCTTCAATTACAGTCGTCTTC (SEQ ID NO:64)), Tgfβ1 (f - GGATACCAACTATTGCTTCAG (SEQ ID NO:65),

[0237] r - TGTCCAGGCTCCAAATATAG (SEQ ID NO:66)),

[0238] Tgfβ2 (f - CTAATGTTGTTGCCCTCCTACAG (SEQ ID NO:67),

[0239] r - GCACAGAAGTTAGCATTGTACCC (SEQ ID NO:68)),

[0240] Tgfβr1 (f - GGACCATTGTGTTACAAGAAAGC (SEQ ID NO:69),

[0241] r - CATGGCGTAACATTACAGTCTGA (SEQ ID NO:70)),

[0242] Tgfβr2 (f - TCCTAGTGAAGAACGACTTGACC (SEQ ID NO:71),

[0243] r - TACCAGAGCCATGGAGTAGACAT (SEQ ID NO:72)),

[0244] Timp1 (f - TCTTGGTTCCCTGGCGTACTCT (SEQ ID NO:73),

[0245] r - GTGAGTGTCACTCTCCAGTTTGC (SEQ ID NO:74)),

[0246] Timp3 (f - GCTAGAAGTCAACAAATACCAG (SEQ ID NO:75),

[0247] r - TAGTAGCAGGACTTGATCTTG (SEQ ID NO:76)),

[0248] Tnfα (f - CTGTGAAGGGAATGGGTGTT (SEQ ID NO:77),

[0249] r - GGTCACTGTCCCAGCATCTT (SEQ ID NO:78)).

[0250] Gene expression was normalized relative to r18s, and relative quantification was achieved using the ΔΔCT method. Reactions were performed using a BioRad CFX 384 (Bio - Rad, Hercules, CA).

[0251] General procedure U.CSPG - ECM binding assay

[0252] To determine the interaction of insulin with CSPG-ECM components in vitro, flat-bottom 96-well plates were first coated with 10 μg / ml poly-L-lysine overnight and then rinsed with water. The purified CSPG mixture containing neurocan, phosphacan, versican, and aggrecan (CC117, Merck Millipore, MA), purified aggrecan (A1960, Merck Millipore, MA), or purified chondroitin 4-sulfate (S9004, Selleck Chemicals, TX) was coated onto 96-well plates at a concentration of 10 μg / ml for 4 h at RT, and then rinsed with water. Insulin-FITC was incubated on the ECM-containing plates at concentrations ranging from 5 ng / ml to 1 mg / ml for 2 h at RT and protected from light. Control wells contained no ECM, bovine serum albumin (10 μg / ml), or poly-L-lysine alone. The wells were washed 3 times with water and imaged at 495 nm using a SPECTROstar Nano microplate reader (BMG Labtech, Germany). To digest CSPG-ECM or neutralize the negative charge of CSPG-ECM, after ECM coating, the wells were incubated with chABC (0.5 U / ml) or poly-L-arginine (10 μg / ml, P7762, Merck Millipore, MA) at 37 °C for 1 h, washed 3 times with water, and then incubated with insulin-FITC.

[0253] General Procedure Q. Statistical Analysis

[0254] Statistical significance was determined by one-way or two-way ANOVA with multiple comparisons or repeated measures, or one-tailed or two-tailed paired Student's t test or ANCOVA as appropriate, or simple linear regression. p < 0.05 was considered significant: *p < 0.05, **p < 0.01 and ***p < 0.001. Exact statistical details of individual experiments, such as exact values of n and exact statistical tests, can be found in the figures and legends.

[0255] Results

[0256] Example 1. Unique CSPG-ECM in the ARC

[0257] To identify CSPG-ECM in the hypothalamus, immunostaining was performed using wheat germ agglutinin (WFA), a lectin that selectively binds to N-acetylgalactosamine residues on chondroitin sulfate (CS) chains of CSPG-ECM. CSPG-ECM expression was detected throughout the rostro-caudal extent of the medial basal hypothalamus in mice ( Figure 1 a-c). There was prominent CSPG-ECM expression within the ARC ( Figure 1 a-c), and expression in the adjacent ventromedial hypothalamus was notable and significantly reduced (VMH, -90.2 ± 2.2%). CSPG-ECM in the brain canonically surrounds and modulates parvalbumin cortical neurons. In the retrosplenial granular cortex (RSG), CSPG ECM was observed to surround 89.5 ± 4.3% of parvalbumin neurons. However, cells within the ARC surrounded by CSPG-ECM were not parvalbumin positive, and there were distinct differences between the CSPG-ECM present in the ARC compared to traditional CSPG-ECM in other brain regions.

[0258] Example 2. Neurofibrosis associated with the ARC develops during the progression of metabolic diseases

[0259] To explore the effect of obesity on ARC CSPG-ECM, expression was quantified in C57BL / 6J mice fed a high-fat high-sugar (HFHS) diet for 12 weeks to render them diet-induced obese and insulin resistant. Compared to lean, age-matched mice, the area and intensity of CSPG-ECM expression in the ARC across the entire rostro-caudal extent was robustly increased in obese mice ( Figure 1 a-c). This finding was highly robust (n = 45) and was observed in several independent experiments. No increase in CSPG-ECM was observed in the VMH ( Figure 1 g-i) or RSG after HFHS diet, indicating that obesity-driven CSPG-ECM remodeling occurs specifically within the ARC.

[0260] To explore whether the glycan composition of ARC CSPG-ECM was also remodeled, glycobiomics was used to quantify chondroitin sulfate glycosaminoglycan (CS-GAG) side chain sulfation. CS-GAG side chains are regulated by sulfotransferases that add sulfate groups to CS-GAG at different sites that modulate biological function. CS-GAG sulfation occurs at the C4 or C6 position of N-acetylgalactosamine (CS-4S and CS-6S, respectively) or at the C2 position of glucuronic acid (CS-2S). CS-GAG chains can also be non-sulfated (CS-0S) or present by a combination of sulfation patterns. The major CS-GAG sulfation in the ARC was identified as CS-4S ( Figure 1d). In the ARC of obese mice, significant changes in the sulfation abundance of CS-GAG were observed, with elevated levels of ΔCS-4S, ΔCS-0S, and ΔCS-2S6S. There was no effect on the expression of ΔCS-4S6S ( Figure 1 d), which is consistent with the increased CSPG-ECM detected by immunohistochemistry.

[0261] To determine the validity of this phenomenon, CSPG-ECM expression was quantified in several independent dietary and genetic mouse models of obesity. A consistent increase in CSPG-ECM expression was observed in the ARC of obese Sprague-Dawley rats and obese BALB / cJ mice fed a high-fat, high-cholesterol diet. Increased CSPG-ECM was also present in both the monogenic (leptin receptor deficiency, db / db) and polygenic (New Zealand obese) mouse models of metabolic disease, indicating CSPG-ECM remodeling in many obesity and metabolic disease models.

[0262] After both acute and chronic HFHS diet consumption, the development of detrimental metabolic adaptations drives the progression of metabolic disease. It has been reported that ARC neuronal signaling is defective 72 hours after ingestion of an obesity-promoting diet (Olofsson et al., 2013), and within one to three weeks, tissue-specific insulin resistance is lost and the propensity for obesity increases, and these effects worsen over time. To identify the temporal pattern of CSPG-ECM remodeling during the progression of metabolic disease, the ARC CSPG-ECM content was determined in mice fed an HFHS diet for 3 days, 1 week, 4 weeks, 8 weeks, and 12 weeks. CSPG-ECM expression increased significantly within 4 weeks of HFHS feeding and further increased at 8 and 12 weeks ( Figure 1 e, f). These effects were associated with key pathophysiological markers of metabolic disease, such as increased body weight, increased propensity for obesity, and impaired glycemic control. The excessive deposition and remodeling of CSPG-ECM in the ARC observed during the development of metabolic disease is a phenomenon that the inventors refer to as neurofibrosis.

[0263] Example 3. Aggrecan is the key CSPG species underlying neurofibrosis in the ARC

[0264] CSPG-ECM contains four core components: 1) CS-GAG chains; 2) CSPG core proteins covalently bound to CS-GAG chains; 3) hyaluronic acid (HA) backbone; and 4) link proteins and glycoproteins that stabilize CSPG aggregates. To explore how the composition of ARC CSPG-ECM is remodeled in neurofibrosis, the extent of HA backbone changes was first determined. Using biotinylated HABP, heterogeneous staining of HA was noted throughout the brain parenchyma, where WFA in the ARC was almost completely co-localized (96 ± 4.5%). Consistent with neurofibrosis promoting obesity within the ARC, both the staining area and intensity of the HA backbone increased, which was consistent with the increased HA abundance observed in the ARC GAG curve ( Figure 1 d). Notably, the changes in ARC HA expression occurred in the non-CSPG-ECM regions of the ARC, which may reflect the role of the HA backbone in supporting other ECMs.

[0265] The increase in the HA backbone within the ARC of diet-induced obese mice occurred in combination with a significant increase in the abundance of hyaluronan and proteoglycan link protein (HAPLN1) within the ARC. These link proteins are used to bind CSPGs to the HA backbone and are widely expressed throughout the hypothalamus, indicating the function of ECM outside of ARC CSPG-ECM. Similarly, the CSPG cross-linking glycoprotein, tenascin C, also showed increased staining intensity within the ARC of obese mice. The increased staining intensity contributed to ARC CSPG-ECM, but tenascin C was also expressed throughout other hypothalamic regions, indicating non-ARC CSPG-ECM-specific expression.

[0266] To identify the relevant CSPGs present in ARC CSPG-ECM, next, versican, phosphacan, neurocan, brevican, and aggrecan (the major CSPG components expressed in CSPG-ECM in other parts of the brain) were stained. Although all CSPG components were present in the ARC to some extent, under chow-fed and HFHS-fed conditions, aggrecan (91.5 ± 3.1%, Figure 1 g, j, k) was mainly co-localized with WFA in the ARC, where the other CSPG components showed different spatial patterns from the CSPG-ECM labeled by ARC WFA ( Figure 1 g, jk). Obesity also promoted enhanced versican, neurocan, brevican, and aggrecan expression within the ARC region ( Figure 1g-i), however, phosphacan expression did not change. Additionally, during the development of obesity, the increased expression of aggrecan occurred within a time frame similar to that of the WFA-labeled CSPG-ECM ( Figure 1 m, n). Collectively, these results suggest that obesity promotes the increase of most major ECM components, but aggrecan is the privileged CSPG species that supports neurofibrosis in the ARC.

[0267] Example 4. CSPG-ECM Tracker - A Novel Tool for Determining Site-Specific CSPG-ECM Turnover

[0268] CSPG-ECM has been described as exhibiting a slow biological turnover rate and persisting for several months to several years in adult tissues. Results showed that the remodeling and increase in CSPG composition in the ARC were relatively rapid after exposure to a high-fat diet ( Figure 1 ). To explain this, it was hypothesized that i) the CSPG-ECM turnover rate within the ARC is different from that in other brain regions, and ii) the turnover rate of CSPG-ECM within the ARC in obesity is attenuated, leading to enhanced CSPG-ECM deposition and neurofibrosis.

[0269] To experimentally determine the CSPG-ECM turnover rate in vivo, a novel technique named "CSPG-ECM Tracker" was developed ( Figure 2 a). The CSPG-ECM Tracker is a "pulse-chase" method that uses stereotaxic injection of biotinylated WFA (WFA-biotin) to "pulse" and label CSPG-ECM in the brain region of interest. After an in vivo latency period, the brain is extracted and processed ex vivo to determine the presence of WFA-biotin to "chase" the remaining labeled CSPG-ECM from the time of injection (day 0). The sections are co-stained with WFA-FITC simultaneously to reveal the total CSPG-ECM expression at the time of "chase". The areas of CSPG-ECM that are positive for WFA-biotin represent the matrix that still exists from day 0, while the areas that only express WFA-FITC are the new matrix synthesized after day 0 ( Figure 2 a).

[0270] To validate this method as a true tracker of CSPG-ECM turnover, the extent to which the injected WFA-biotin in the ARC faithfully labels CSPG-ECM within the ARC was first determined ( Figure 2 b-d). For this purpose, the ARC of adult chow-fed mice was "pulsed" unilaterally with WFA-biotin or saline, and the expression was traced one day later ( Figure 2b, c). Using this method, it was identified that the WFA-biotin of the pulse was almost completely co-expressed with WFA-FITC (total CSPG-ECM), indicating that the CSPG-ECM tracker faithfully labeled the CSPG-ECM in the ARC in vivo ( Figure 2 d). The spots of WFA-positive signal outside the ARC indicate that WFA-biotin leaked into the circulation and bound to the CSPG-ECM expressed in blood vessels ( Figure 2 c).

[0271] To verify whether the "pulsed" WFA-biotin signal faithfully binds to and labels the CSPG-ECM that is only present at the time of injection, and is not the rebinding of free WFA-biotin to newly synthesized CSPG-ECM, the ARC of adult chow-fed mice was pulsed bilaterally with WFA-biotin, and three days later the CSPG-ECM in the ARC was digested with chondroitinase ABC (chABC), which is an enzyme that specifically digests CSPG-ECM. Compared to the vehicle, enzymatic digestion of the "pulsed" WFA-biotin-bound CSPG-ECM was completely abolished after chABC treatment, indicating that WFA-biotin binds only to the CSPG-ECM component present at the time of pulsed injection. The CSPG-ECM tracker is the first viable method to evaluate the in vivo turnover of CSPG-ECM in a brain region-specific manner.

[0272] Example 5. ARC CSPG-ECM exhibits dynamic and rapid turnover

[0273] To determine the basal CSPG-ECM turnover within the ARC, WFA-biotin was "pulsed" into the ARC of adult chow-fed mice, and its expression was "tracked" at 0, 1, 3, 5, and 10 weeks post-injection ( Figure 2 e). Using the CSPG-ECM tracker, it was identified that the CSPG-ECM within the ARC of chow-fed C57BL / J mice exhibits a 5-week turnover period, characterized by a temporal decrease in CSPG expression at 1 and 3 weeks post-injection ( Figure 2 f, g). To evaluate whether the turnover of CSPG-ECM is consistent in other brain regions, WFA-biotin was "pulsed" into the RSG of adult chow-fed mice, and its expression was "tracked" at 0 and 5 weeks post-injection. Different from within the ARC, the CSPG-ECM in the RSG was still present at five weeks, although reduced by 61%. Significant CSPG-ECM expression was further identified within blood vessels adjacent to the corpus callosum, which did not show degradation over the 5-week post-injection period. These results indicate that the ARC exhibits a unique rapid degradation rate of CSPG-ECM and sets a precedent for differential ECM turnover throughout the brain.

[0274] Example 6. Reduced CSPG-ECM turnover in obesity drives neurofibrosis

[0275] It was hypothesized that neurofibrosis in the ARC was due to reduced CSPG-ECM degradation. To test this, WFA-biotin was “pulsed” into the ARC of obese mice and its expression was “tracked” at 0, 1, 2, 5, and 10 weeks post-injection ( Figure 2 e, f). As expected, higher CSPG-ECM expression was present in the obese ARC compared to lean age-matched controls, recapitulating the above finding that obesity drives neurofibrosis in the ARC ( Figure 1 ). It was determined that the rate of CSPG-ECM degradation was significantly reduced in the ARC of obese mice compared to lean mice (lean = 2.6% / day vs. obese = 0.1% / day, Figure 2 g). This reduced CSPG-ECM turnover resulted in the presence of WFA-biotin in the ARC up to 10 weeks post-injection, which was twice that seen in lean mice (5 weeks). These results identified that neurofibrosis is driven by reduced CSPG-ECM degradation and demonstrated significant remodeling of CSPG-ECM in the ARC during the development of metabolic disease.

[0276] To further elucidate the molecular mechanisms underlying the obesity-driven alterations in CSPG-ECM turnover, gene expression of established ECM synthesis / degradation enzymes within the medial basal hypothalamus of lean vs. obese mice was quantified. ECM composition and remodeling are tightly controlled by the balance of matrix metalloproteinases (MMPs), proteolytic enzymes known to degrade ECM, and their inhibitors, tissue inhibitors of metalloproteinases (TIMPs). A significant decrease in the expression of several key ECM proteases (Adamst4, Adamst5, Mmp2, Mmp9, Mmp13, Mmp14) was observed in the medial basal hypothalamus of obese mice ( Figure 2 h). Conversely, elevated expression of TIMPs (Timp1 and Timp3) was also observed, which may promote neurofibrosis by inhibiting MMPs ( Figure 2 h). Additionally, elevated expression of profibrotic inflammatory factors Tnfα, Tgfβ1, Tgfβ2, Tgfβr1, Tgfβr2, and Il6 was observed ( Figure 2 h), which are established regulators of fibrosis in peripheral tissues.

[0277] Example 7. Neurofibrosis occurs around AgRP neurons within the ARC

[0278] The ARC contains two metabolically related neuronal populations, called agouti-related peptide (AgRP) neurons and pro-opiomelanocortin (POMC) neurons. AgRP and POMC neurons are well-established neuronal populations within the ARC, crucial for the regulation of metabolism and playing a central role in the development of metabolic diseases. Using Npy-GFP (labeling AgRP neurons) and Pomc-GFP mice, it was identified that under chow-fed conditions, 44% ± 13% of AgRP neurons in the ARC ( Figure 3 a, b) and 24% ± 9% of POMC neurons ( Figure 3 d, e) were enwrapped within CSPG-ECM. It was determined that after 4 weeks of HFHS feeding, significantly more AgRP was enwrapped within CSPG-ECM (60% ± 6%, Figure 3 a, b), but not for POMC neurons (23% ± 5%, Figure 3 d - e). After 12 weeks of HFHS feeding, a further recruitment of AgRP neurons was noted (78% ± 7%; Figure 3 a, b), along with enhanced perineuronal WFA staining ( Figure 3 c), with no such effect around POMC neurons ( Figure 3 f), and not related to changes in neuron numbers.

[0279] Earlier, an enhanced abundance of aggrecan was identified as a constitutive hallmark of neurofibrosis within the ARC ( Figure 1 g - m). Consistent with this, in chow-fed mice, aggrecan-positive CSPG-ECM was detected around AgRP neurons ( Figure 3 g - i). As expected, aggrecan-positive CSPG-ECM enwrapped AgRP neurons to a similar extent as WFA and showed a similar recruitment of AgRP during the development of neurofibrosis ( Figure 3 g - i). Collectively, these results suggest that during the development of metabolic diseases, neurofibrosis develops around metabolically related AgRP neurons in the ARC.

[0280] Obesity affects the intrinsic excitability of AgRP neurons, as both the firing rate and resting membrane potential increase after prolonged high-fat feeding. Additionally, removal of CSPG-ECM expressed around cortical and brainstem neurons reduces membrane excitability, as demonstrated by a decrease in firing frequency. Therefore, the effect of CSPG-ECM recruitment on AgRP neuron function was investigated using whole-cell patch-clamp electrophysiology. At 12 weeks of HFHS feeding, more than 82% of AgRP neurons fired spontaneously ( Figure 3 j), while when the CSPG-ECM within the ARC was disassembled with chABC, spontaneous firing decreased to 33% (Figure 3 j). Consistent with a significant decrease in firing frequency ( Figure 3 k, l), a trend of decreased resting membrane potential was also observed ( Figure 3 m, p = 0.065), supporting the role of ARCCSPG-ECM in regulating the intrinsic electrophysiological properties of AgRP neurons.

[0281] Example 8. Elimination of ARC neurofibrosis protects against obesity

[0282] Obesity is characterized by increased obesity propensity and impaired glucose control, which are caused by overeating, reduced adaptive thermogenesis, and insulin resistance. The functional contribution of ARC neurofibrosis to the development of metabolic diseases is not well understood. To address this issue, chABC was used to selectively disassemble CSPG-ECM within the ARC of obese HFHS-fed mice. Intracerebroventricular delivery of chABC significantly reduced the expression of CSPG-ECM within the ARC ( Figure 4 a). Notably, disassembly of ARC CSPG-ECM in obese mice promoted progressive and substantial weight loss ( Figure 4 b), which was mediated by a significant reduction in obesity propensity (24 ± 16%; Figure 4 c). Changes in body mass and composition were partly due to a substantial reduction in calorie intake, as mice lacking CPSG-ECM in the ARC consumed much less food than HFHS-fed controls ( Figure 4 d). Neurofibrosis elimination regulates food intake by promoting satiety without inducing non-food-specific adverse behaviors such as nausea, excessive grooming, or sedation.

[0283] To explore the extent to which inhibition of feeding contributed to weight loss, vehicle-treated mice were pair-fed such that they consumed the same amount of food as mice lacking CSPG-ECM in the ARC, and the effects on body weight and obesity propensity were evaluated. Pair-feeding caused weight loss ( Figure 4 e) and a reduction in fat mass ( Figure 4 f), although not to the extent observed in freely chABC-treated mice ( Figure 4 e, f). This indicates that chABC-mediated inhibition of food intake partly explains the effect on weight loss. Despite these effects, there remained a significant difference between pair-fed vehicles compared to freely chABC-treated mice, suggesting that differences in body weight could not be explained by calorie intake alone and may include contributions from energy expenditure ( Figure 4 g). Energy expenditure was measured using indirect calorimetry, and mice lacking CSPG-ECM in the ARC were found to exhibit elevated whole-body energy expenditure and oxygen consumption, with effects not limited to substrate partitioning or locomotor activity.

[0284] Consistent with the increased energy expenditure, a significant upregulation of adipose tissue thermogenesis was also observed in both the inguinal white adipose tissue (ingWAT) depot and the brown adipose tissue (BAT) depot after chABC treatment in the ARC ( Figure 4 h–k). Disassembly of the CSPG-ECM in the ARC of diet-induced obese mice was accompanied by an increase in ingWAT browning, as evaluated by: (1) gross morphology ( Figure 4 h) and histology, monitoring the presence of multilocular lipid droplets ( Figure 4 i); (2) immunofluorescence, monitoring UCP-1-positive adipocytes ( Figure 4 i); and (3) an increase in ingWAT temperature in the skin in vivo ( Figure 4 j, k). In addition, chABC treatment also increased the skin BAT temperature, indicating substantial activation of adaptive thermogenesis.

[0285] Eliminating ARC neurofibrosis was also accompanied by a significant improvement in glucose homeostasis, as evaluated by a reduction in blood glucose fluctuations in the glucose tolerance test ( Figure 4 l), a decrease in fasting blood glucose, and a decrease in circulating insulin and the HOMA-IR (homeostatic model assessment of insulin resistance) index (as a measure of whole-body insulin resistance) ( Figure 4 m). Importantly, these tests were performed 4 days after chABC before a significant effect on body weight, indicating that the direct effect of neurofibrosis elimination on glucose metabolism was independent of changes in body weight.

[0286] To further explore the role of ARC neurofibrosis in the development of whole-body insulin resistance, whole-body insulin sensitivity and glucose control were evaluated using a hyperinsulinemic euglycemic clamp in weight-matched mice. In mice treated with chABC in the ARC, the glucose infusion rate (GIR) required to maintain euglycemia during the clamp was significantly increased, which was consistent with the improvement in whole-body insulin sensitivity by the elimination of neurofibrosis in the ARC ( Figure 4 n). The improvement in insulin sensitivity was mediated by an increased suppression of endogenous glucose production ( Figure 4 o) and an increased glucose disposal rate, which are corresponding measures of hepatic gluconeogenesis and skeletal glucose uptake. Enhanced glucose uptake was observed in skeletal muscle; however, this effect was not present in epididymal white adipose tissue, the heart, or the brain ( Figure 4 p). It has been previously shown that ARC neurons coordinate glucose metabolism through thermogenesis occurring in ingWAT and BAT. Consistent with this regulation, disassembly of neurofibrosis in the ARC promoted glucose uptake in BAT and ingWAT ( Figure 4p). The beneficial effects of chABC intracerebroventricular injection on body weight, obesity propensity, glycemic control, and insulin resistance were also recapitulated in genetically severely obese and type 2 diabetic db / db mice treated with chABC ( Figure 4 q - t), further confirming the causal role of ARC neurofibrosis in the development of metabolic diseases.

[0287] Collectively, these results indicate that the ECM in the brain exhibits a profound and unprecedented causal role in the development of metabolic diseases. These studies link the generation of neurofibrosis within the ARC to the progression and maintenance of metabolic diseases (through the development of hyperphagia, systemic insulin resistance, increased obesity propensity, and impaired adaptive thermogenesis). Notably, the disassembly of neurofibrosis within the ARC leads to weight loss and reversal of key metabolic disease phenotypes.

[0288] Example 9. Neurofibrosis impedes insulin entry into the ARC and promotes neuronal insulin resistance

[0289] Given the association between fibrosis and insulin resistance in peripheral tissues, it was hypothesized that the accumulated CSPG - ECM might impede insulin delivery from the circulation into the ARC, and that this might represent a novel mechanism underlying insulin resistance. To explore this, vehicle or chABC was bilaterally administered into the ARC of 12 - week HFHS - fed obese and chow - fed mice, and its effect on insulin receptor activation was evaluated ( Figure 5 a). As expected, systemic insulin administration in chow mice induced robust expression of phosphorylation of AKT (p - AKT) within the ARC. This effect was significantly attenuated in obese mice, indicating that obesity drives the development of insulin resistance within the ARC ( Figure 5 b, c). Disassembly of the ARC CSPG - ECM in obese mice rapidly improved insulin resistance within ARC neurons, as shown by the restoration of both p - AKT ( Figure 5 b, c) and insulin receptor phosphorylation within the ARC two days after chABC injection (before any effect on body weight) and within eight days ( Figure 5 b, c).

[0290] The CSPG - ECM in the brain regulates neuronal function by physically impeding the contact and interaction of extracellular molecules with target cells. Thus, it was speculated that obesity - driven neurofibrosis within the ARC CSPG - ECM might mechanically promote insulin resistance by impeding insulin access to neurons within the ARC. To explore this, fluorescein isothiocyanate - labeled insulin (insulin - FITC) was peripherally administered, and insulin entry and signaling within the ARC in lean mice were quantified relative to obese mice ( Figure 5d). Robust insulin-FITC appearance and internalization in the ARC of lean mice were observed ( Figure 5 e-g), followed by p-AKT signaling, confirming that circulating insulin enters and directly signals cells in the ARC ( Figure 5 e-h). Insulin-FITC entry was impaired in obese mice ( Figure 5 e-g), and this effect was accompanied by a corresponding decrease in insulin-induced p-AKT signaling ( Figure 5 e, h). Notably, CSPG-ECM disassembly in the ARC of obese mice restored insulin entry into the ARC, similar to that observed in lean mice ( Figure 5 e-h), and in turn restored insulin-induced p-AKT signaling ( Figure 5 e-h).

[0291] To examine whether the neural fiber obstruction of insulin transport was mediated by CSPG-ECM around the blood-brain barrier (BBB), insulin-FITC was infused into the cerebrospinal fluid to bypass the BBB. Here, insulin-FITC entered the ARC of lean mice, this effect was sharply attenuated in obese mice, and was rescued after CSPG-ECM disassembly. Collectively, these results indicate that neural fibrotic CSPG-ECM within the ARC rather than within the BBB impedes insulin entry into the ARC, thus promoting insulin resistance. The regulation of insulin-FITC entry into the ARC by CSPG-ECM is an insulin-specific effect.

[0292] To gain insights into how neural fibrosis impedes insulin infiltration and signaling within the ARC, in vitro binding assays were performed to evaluate insulin-ECM interactions. Insulin-FITC was incubated on plates coated with a mixture of CSPGs (aggrecan, neurocan, phosphacan, and versican) or specific core CSPG-ECM components that compose neural fibrosis (aggrecan or chondroitin 4-sulfate) for 2 hours ( Figure 5 i). Specific dose-dependent binding of insulin-FITC to the mixture of CSPGs, aggrecan, and C4S was observed, and this effect was abolished in the presence of chABC ( Figure 5j). To mechanistically explain the interaction between ECM and insulin, it was hypothesized that the highly negative charge of sulfated GAGs attached to CSPGs hindered ligand-receptor binding. To explore this, insulin-FITC was incubated with CSPG mixture in the presence of polyarginine, a positively charged peptide that neutralizes the negative charge of CSPGs. It was found that in the presence of polyarginine, the insulin-ECM interaction was significantly reduced, indicating that the negative charge of GAGs in CSPG-ECM also regulated the insulin-ECM interaction ( Figure 5 j).

[0293] Putative potassium (K+) currents were detected in AgRP neurons in the ARC. To determine whether the increased ability of insulin to contact and signal to ARC neurons was the basis for the regulation of AgRP membrane excitability mediated by neurofibrosis ( Figure 3 j-m), whole-cell electrophysiology was performed. It is known that activation of K+ channels on AgRP neurons hyperpolarizes the resting membrane potential, leading to a decrease in firing rate. To directly address the potential role of neurofibrosis in regulating K+ currents in AgRP neurons, the current-voltage relationship was examined in the presence of tetrodotoxin. After removal of neurofibrosis, the firing rate and membrane potential decreased in AgRP neurons of diet-induced obese mice ( Figure 3 j-m), while an upward shift in the current-voltage curve was observed, indicating enhanced K+ currents. To determine the contribution of the improved insulin signaling after removal of neurofibrosis to the regulation of K+ currents, gene expression analysis of several K+ channels known to be present in AgRP / Npy neurons was performed in the mediobasal hypothalamus. In diet-induced obese mice, upregulation of several K+ channels was demonstrated after digestion of ARC CSPG-ECM. To determine whether these changes were due to the increased ability of insulin to contact these neurons and regulate K+ channel activity, an insulin receptor antagonist (S961) was utilized. It has been shown that S961 attenuated the upregulation of K+ channels after removal of neurofibrosis, revealing an insulin receptor-dependent regulation of neuronal activity after digestion of ARC CSPG-ECM.

[0294] Collectively, these findings demonstrate that ARC CSPG-ECM directly interacts with insulin, and the development of neurofibrosis promotes insulin resistance and AgRP excitability by impairing the ability of insulin to contact and signal to key ARC neuronal populations.

[0295] Example 10. ARC Neurofibrosis Promotes Metabolic Diseases through Dysregulated AgRP Insulin Signaling

[0296] Since neurofibrosis specifically occurs around AgRP neurons (Figure 4 ), it is hypothesized that impaired insulin signaling within AgRP neurons may be the cell type underlying these effects. To determine whether the development of perineuronal fibrosis around AgRP neurons drives alterations in neuronal circuits controlling metabolism, AgRP peptide expression was examined within the ARC terminals projecting to the paraventricular hypothalamus (PVH). This ARC AgRP to PVH circuit is an established output by which AgRP neurons regulate metabolism and blood glucose control. A significant increase in AgRP peptide expression innervating the PVH was observed in obese mice compared to lean mice, and this effect was reversed following attenuation of perineuronal fibrosis. The decrease in AgRP peptide expression and subsequent reduction in AgRP inhibition of the melanocortin circuit in the PVH could explain how perineuronal fibrosis around AgRP neurons propagates metabolic dysfunction.

[0297] To define the causative role of perineuronal fibrosis in driving impaired AgRP insulin signaling, a mouse model was generated that enables conditional AgRP neuron insulin receptor deletion in the adult diet-induced obese state. Using CRISPR gene editing, two guide RNAs (sgRNAs) targeting the proximal region of exon 2 of the mouse insulin receptor (InsR) gene were identified. In the presence of Cas9 endonuclease, these sgRNAs excised a region of InsR exon 2 that was substantially approximately 82 bp, causing near-complete ablation of IR protein expression. An AAV expressing the two IR sgRNA sequences and Cre-dependent mCherry was then constructed to report AAV-transduced neurons (gIR-AAV, Figure 6 a). To target CRISPR-mediated excision of IR in AgRP neurons, Agrp-IRES-Cre was crossed with Rosa26-LSL-Cas9-GFP knock-in mice to generate AgRP-Cas9 (Agrp-IRES-Cre; Rosa26-LSL-Cas9-GFP) mice, which specifically express Cas9 and GFP in AgRP neurons. To examine the efficacy of CRISPR-mediated disruption of InsR in AgRP neurons in vivo, AAV-gIR or scrambled sgRNA control AAV (AAV-gscrambled) was bilaterally injected into the ARC of 12-week-old adult AgRP-Cas9 mice. Successful CRISPR-mediated disruption of InsR was confirmed by the presence of an approximately 419 bp PCR product (ΔInsr CRISPR , approximately 82 bp smaller than the wt of approximately 501 bp) in the mediobasal hypothalamus of AgRP-Cas9 mice. CRISPR-mediated disruption of IR in AgRP neurons resulted in impaired insulin signaling, further validating effective AgRP-specific disruption of IR expression.

[0298] To define the contribution of AgRP IR signaling to the attenuation of neurofibrosis on whole-body metabolism, AAV-gIR or AAV-scrambled was bilaterally injected into the ARC of obese 12-week-old AgRP-Cas9 mice ( Figure 6 b). One week later, mice received bilateral intra-ARC chABC or vehicle administration to disassemble neurofibrosis within the ARC. Reproducing previous findings, chABC treatment in the ARC of diet-induced control (AAV-scrambled) AgRP-Cas9 mice promoted weight loss ( Figure 6 c), reduced obesity propensity ( Figure 6 d), decreased caloric intake ( Figure 6 e), enhanced energy expenditure ( Figure 6 f), and improved glycemic control ( Figure 6 g, h). Notably, all effects on whole-body metabolism were dependent on functional insulin receptor signaling in AgRP neurons, as they were significantly attenuated in chABC-treated AAV-IR AgRP-Cas9 mice ( Figure 6 c-h). Collectively, obesity-driven neurofibrosis promotes the development of metabolic diseases through impaired insulin signaling in AgRP neurons. Furthermore, degradation of ARC neurofibrosis improves whole-body metabolism and glycemic control, at least in part, by restoring insulin receptor signaling within AgRP neurons.

[0299] Example 11. Pharmacological attenuation of neurofibrosis promotes weight loss in obesity

[0300] Targeting the ECM surrounding metabolic neural circuits, rather than the cells themselves, provides a unique therapeutic strategy. The major therapeutic challenge in targeting the ECM lies in developing small molecule inhibitors capable of reversing fibrotic ECM. Although the enzyme chABC can effectively digest CSPG-ECM and improve neurofibrosis when injected into discrete brain regions, its enzymatic activity rapidly depletes at body temperature. Thus, its therapeutic capacity is limited. To explore the pharmacological feasibility of targeting neurofibrosis in the brain, a recently characterized small molecule inhibitor, fluoramine (per-O-acetylated-4-F-N-acetylglucosamine), was used. Fluoramine is a competitive inhibitor of 4-epimerase, an essential enzyme that generates the nucleotide sugar substrate UDP-N-acetylgalactosamine, which is required for the assembly and elongation of CS-GAG chains on CSPGs. To directly target the brain, fluoramine was delivered intracerebroventricularly (I.C.V., bypassing effects on peripheral tissues) to obese mice for 10 days ( Figure 7 a). Using WFA immunostaining, it was observed that fluoramine treatment significantly attenuated neurofibrosis within the ARC ( Figure 7b, c). Central fluamine administration did not reduce CSPG-ECM in other brain regions (such as the RSG cortex), and at the highest dose, only partially attenuated the expression in the habenula, an effect that may be explained by the rapid turnover of CSPG in the ARC. Consistent with the enzymatic CSPG-ECM disassembly in the ARC, central fluamine treatment promoted weight loss ( Figure 7 d), reduced adiposity tendency ( Figure 7 e), enhanced energy expenditure independent of locomotor activity ( Figure 7 f), inhibited food intake through enhanced satiety ( Figure 7 g), and improved glucose tolerance ( Figure 7 h). In addition, fluamine treatment enhanced insulin-induced p-AKT signaling in the ARC, indicating a significant restoration of ARC insulin sensitivity ( Figure 7 i, j). Mechanistically, fluamine improved glycemic control by enhancing whole-body insulin sensitivity ( Figure 7 k), hepatic glucose production, and tissue-specific glucose uptake (i.e., in skeletal muscle, BAT, and ingWAT), as assessed using hyperinsulinemic euglycemic clamps in weight-matched obese mice. The utility and ability of fluamine treatment to promote remission of metabolic diseases were also observed in a mouse model of late-stage type 2 diabetes (HFHS plus low-dose streptozotocin treatment, Figure 7 l, m), further confirming the utility of targeting neurofibrosis to treat different stages of T2D progression.

[0301] Although fluamine and chABC differ in their mechanisms of CSPG-ECM disassembly, fluamine phenocopies the metabolic effects of chABC. Consistent with this, it was explored to what extent the metabolic effects of fluamine are mediated by AgRP insulin receptor signaling. To address this question, AAV-gIR or AAV-g scrambled were bilaterally injected into the ARC of 12-week-old obese AgRP-Cas9 mice, and one week later, vehicle or fluamine (100 μg / animal, I.C.V.) was delivered daily for 10 days ( Figure 7 n). Reproducing previous findings, fluamine treatment in control AAV-g scrambled, AgRP-Cas9 mice promoted weight loss ( Figure 7 o), reduced adiposity tendency, attenuated calorie intake ( Figure 7 p), enhanced energy expenditure independent of locomotor activity ( Figure 7 q), and improved glycemic control ( Figure 7 r). In AAV-IR AgRP-Cas9 mice, these positive metabolic outcomes of fluamine treatment were at least partially abrogated, suggesting that the requirement for insulin receptor signaling in AgRP neurons mediates the sequelae of fluamine-induced metabolic benefits.Figure 7 o-r).

[0302] To facilitate the translational treatment of humans, intranasal delivery of fludiamine was explored as a possible route of administration to ensure targeted delivery of the neurofibrosis inhibitor to the brain. To determine whether the neurofibrosis inhibitor could be successfully delivered intranasally, biotin-conjugated fludiamine molecules were administered intranasally to C57BL / 6J mice, and their biodistribution throughout the brain was determined ( Figure 8 a, b). A substantial accumulation of fludiamine was detected in the brain, with significant accumulation in the ARC ( Figure 8 b), indicating successful delivery of fludiamine to the site of neurofibrosis. To determine the efficacy of brain-targeted delivery of the neurofibrosis inhibitor for the treatment of metabolic diseases, fludiamine was delivered intranasally to diet-induced obese mice for 14 days ( Figure 8 c). Intranasal delivery of fludiamine successfully attenuated ARC neurofibrosis ( Figure 8 d, e), and reproduced the systemic metabolic improvements observed with intracerebroventricular delivery ( Figure 8 f-l). These effects may be mediated by enhanced insulin signaling to neurons within the ARC ( Figure 8 m, n).

[0303] Collectively, these results further confirm the role of neurofibrosis in the development of central insulin resistance and systemic metabolic dysfunction.

[0304] Example 12. Intranasal administration delivers biotin-conjugated fludiamine (PZ6005) to the brain

[0305] PZ6005 conjugated with biotin (PZ6005-biotin) or unconjugated PZ6005 ( Figure 8 a) was administered intranasally to mice for 3 days, and then the biotin-streptavidin signal was quantified. Compared with the control group, high biotin was expressed in the ARC in the PZ6005-biotin treatment ( Figure 8 b-e). Significant biotin expression was also observed in the lungs of PZ6005-biotin-treated mice ( Figure 8 f-h). However, this was much less in extent compared to that seen in the ARC (quantified). These results indicate that PZ6005-biotin can be delivered to the ARC and lungs by intranasal administration.

[0306] Example 13. Intranasal administration of fludiamine (PZ6005) attenuates CSPG-ECM expression within the ARC

[0307] To determine whether intranasal administration of PZ60005 inhibits ARC CSPG-ECM expression, obese mice fed a 12-week HFHS diet were subjected to intranasal administration of vehicle or PZ6005 (1 mg or 5 mg / animal / day) for 14 days ( Figure 9 a), and quantitative WFA immunostaining of CSPG-ECM expression within the ARC was performed ( Figure 9 b). Intranasal PZ6005 treatment at both doses robustly decreased the area and intensity of ARC CSPG-ECM. The CSPG-ECM areas in the 1 mg and 5 mg treatment groups were 13.54 ± 1.03% and 13.59 ± 4.09% lower than those in the control, respectively ( Figure 9 c, d). In the 1 mg treatment, the intensity decreased by 15.94 ± 7.17%, and further decreased by 30.16 ± 1.52% in the highest dose of intranasal PZ6005 treatment ( Figure 9 e, f). These results indicate that intranasal administration of PZ60005 decreases ARC CSPG-ECM expression in a dose-dependent manner and attenuates obesity-driven ARC neurofibrosis.

[0308] Example 14. Therapeutic elimination of ARC neurofibrosis using intranasal flamine (PZ6005) can promote weight loss while reducing obesity excess

[0309] Weight changes in obese mice fed a 12-week HFHS diet during the 14-day period of intranasal administration of vehicle or PZ6005 (1 mg or 5 mg / animal / day). Intranasal PZ6005 treatment induced weight loss in a dose-dependent manner, as evaluated by the significant differences in weight changes across groups. The 1 mg and 5 mg treatment groups began to show a robust decline in weight starting from day 7 and day 3, respectively. On day 9, the 5 mg treatment began to show significantly more weight loss than the 1 mg treatment and continued until day 14. At the end of the experiment, the mice in the highest dose of PZ6005 treatment lost 6.36 ± 0.88% of their body weight, and the mice in the 1 mg treatment lost 16.32 ± 1.41% of their body weight, while the control littermates maintained a body weight of 3.57 ± 1.28% ( Figure 10 a).

[0310] To determine the effects of intranasal PZ6005-mediated attenuated neurofibrosis on tissue-specific obesity propensity and body composition, the peripheral tissues and fat mass of the mice were weighed after 14 days of administration. In the 1 mg treatment, the masses of epiWAT, BAT, and liver decreased, while the highest dose of intranasal PZ6005 significantly decreased the tissue masses ( Figure 11a, b). In addition, the reduction in total fat mass depends on the dose of PZ6005. Compared with the pre-treatment mass, the post-treatment fat mass in the 1 mg treatment was reduced by 12.59 ± 2.29%, and further reduced by 23.21 ± 9.27% in the 5 mg treatment ( Figure 11 c, d). These results indicate that intranasal delivery of PZ6005 is associated with dose-dependent weight loss, accompanied by improvement of tissue-specific obesity and reduction of fat mass.

[0311] Example 15. Therapeutic elimination of ARC neurofibrosis using intranasal flumamine (PZ6005) improves glucose homeostasis in a dose-dependent manner while enhancing insulin sensitivity

[0312] Obese mice receiving vehicle or PZ6005 (1 mg or 5 mg / animal / day) intranasally were subjected to I.P. GTT was performed after a 6-hour fasting period, and I.P. insulin tolerance test (ITT) was performed after a 4-hour fasting period. The reduction in blood glucose fluctuations in both GTT and ITT indicates that mice treated with intranasal PZ6005 had better glucose tolerance than control littermates ( Figure 12 a, b), with enhanced insulin sensitivity ( Figure 12 c, d). In addition, 5 mg PZ6005 treatment showed significantly higher glucose clearance rates than the 1 mg treatment group and the control at 60 minutes after I.P. glucose injection and 0 minutes after I.P. insulin injection in GTT ( Figure 12 a-d). The reduction in fasting (12-hour) blood glucose levels further confirmed that intranasal PZ6005 treatment at both doses improved glucose control ( Figure 12 e).

[0313] These results indicate that intranasal delivery of PZ6005 can enhance systemic insulin sensitivity and improve glucose homeostasis in a dose-dependent manner.

[0314] Example 16. Therapeutic elimination of ARC neurofibrosis using intranasal flumamine (PZ6005) improves insulin receptor signaling within the ARC

[0315] ARC pAKT+ve cells of obese mice receiving vehicle or PZ6005 (1 mg or 5 mg / animal / day) by 14-day intranasal administration were examined to demonstrate the extent of the effect of intranasal PZ6005-mediated attenuation of CSPG-ECM on insulin receptor signaling within the ARC ( Figure 13 a). ARCs treated with intranasal PZ6005 at both doses enhanced insulin receptor signaling, as evaluated by the robust increase in ARC pAKT+ve cells ( Figure 13b). This result indicates that intranasally administered PZ6005, as a neurofibrosis inhibitor, can enhance insulin sensitivity in the ARC parenchyma.

[0316] References

[0317] Alonge, K.M. et al., Hypothalamic perineuronal net assembly is required for sustained diabetes remission induced by fibroblast growth factor 1 in rats. Nat Metab, 2020.2(10): pp. 1025 - 1033.

[0318] Anderson, E.M. et al., Systematic analysis of CRISPR - Cas9 mismatch tolerance reveals low levels of off - target activity. J Biotechnol, 2015.211: pp. 56 - 65.

[0319] Dodd, G.T. et al., TCPTP Regulates Insulin Signaling in AgRP Neurons to Coordinate Glucose Metabolism With Feeding. Diabetes, 2018.67(7): pp. 1246 - 1257.

[0320] Dodd, G.T. et al., Intranasal Targeting of Hypothalamic PTP1B and TCPTP Reinstates Leptin and Insulin Sensitivity and Promotes Weight Loss in Obesity. Cell Rep, 2019.28(11): pp. 2905 - 2922e5.

[0321] Keough, M. B. et al., An inhibitor of chondroitin sulfate proteoglycan synthesis promotes central nervous system remyelination. Nat Commun, 2016.7: p. 11312.

[0322] Mirzadeh, Z., et al., Perineuronal Net Formation during the Critical Period for Neuronal Maturation in the Hypothalamic Arcuate Nucleus. Nat Metab, 2019.1(2): pp. 212 - 221.

[0323] Moh, E. S. X., et al., Long - term intrathecal administration of morphine vs. baclofen: Differences in CSF glycoconjugate profiles using multiglycomics. Glycobiology, 2022.32(1): pp. 50 - 59.

[0324] Olofsson, L. E. et al., Modulation of AgRP - neuronal function by SOCS3 as an initiating event in diet - induced hypothalamic leptin resistance. Proc Natl Acad Sci U S A, 2013.110(8): pp. E697 - 706.

[0325] Stephenson, E.L. et al. Targeting the Chondroitin Sulfate Proteoglycans: Evaluating Fluorinated Glucosamines and Xylosides in Screens Pertinent to Multiple Sclerosis. *ACS Cent Sci.*, 2019. 5(7): pp. 1223-1234.

[0326] Winans, K.A. and Bertozzi, C.R. An Inhibitor of the Human UDP-GlcNAc4-Epimerase Identified from a Uridine-Based Library: A Strategy to Inhibit O-Linked Glycosylation. *Chemistry & Biology*, 2022. 9(1): pp. 113-129.

Claims

1. A method for treating or preventing insulin resistance or related disorders in a subject, the method comprising administering to the subject an effective amount of a 4-epimerase inhibitor.

2. The method according to claim 1, wherein the related disorder is selected from prediabetes, type 2 diabetes, obesity, metabolic syndrome, hypertension, dyslipidemia, atherosclerosis, non-alcoholic fatty liver disease (NAFLD), polycystic ovary syndrome (PCOS), and coagulopathy.

3. The method according to claim 2, wherein the related disorder is a metabolic disease.

4. The method according to claim 3, wherein the metabolic disease is type 2 diabetes.

5. The method according to claim 2, wherein the related disorder is obesity.

6. The method according to any one of claims 1 to 5, wherein the 4-epimerase inhibitor is a fluorinated N-acetyl-glucosamine derivative or a pharmaceutically acceptable salt, solvate, or hydrate thereof, or a stereoisomer thereof.

7. The method according to claim 6, wherein the 4-epimerase inhibitor is a compound of formula (I): or a pharmaceutically acceptable salt, solvate, or hydrate thereof, or a stereoisomer thereof, wherein: R 1 , R 3 and R 5 are independently selected from H or C(O)C 1-4 Alkyl; and R 4 and R 4' are independently selected from H and fluorine, where at least one of R 4 and R 4' is fluorine.

8. The method according to any one of claims 1 to 7, wherein the 4-epimerase inhibitor is a compound of formula (IA): or a pharmaceutically acceptable salt, solvate, or hydrate thereof, or a stereoisomer thereof, wherein: R 1 , R 3 and R 5 are independently selected from H or C(O)C 1-4 Alkyl; and R 4 and R 4' are independently selected from H and fluorine, where at least one of R 4 and R 4' is fluorine.

9. The method according to claim 7 or claim 8, wherein R 1 , R 3 and R 5 are independently selected from H or C(O)C 1-3 alkyl.

10. The method according to any one of claims 7 to 9, wherein R 1 , R 3 and R 5 are independently selected from H or C(O)C 1-2 alkyl.

11. The method according to any one of claims 7 to 10, wherein R 1 is H or C(O)C 1-2 alkyl, and both R 3 and R 5 are acyl groups.

12. The method according to any one of claims 7 to 11, wherein R 1 , R 3 and R 5 are each acyl groups.

13. The method according to claim 8, wherein the 4-epimerase inhibitor is selected from: or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof.

14. The method according to claim 13, wherein the 4-epimerase inhibitor is: or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof.

15. The method according to any one of claims 1 to 5, wherein the 4-epimerase inhibitor is: or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof.

16. The method according to any one of claims 1 to 5, wherein the 4-epimerase inhibitor is a compound of formula (II), formula (III) or formula (IV): or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof, wherein: R 6 Selected from: R 7 Selected from: and R 8 is selected from:

17. The method according to any one of claims 1 to 16, wherein the 4-epimerase inhibitor is administered intranasally.

18. Use of a 4-epimerase inhibitor for the preparation of a medicament for treating or preventing insulin resistance or related disorders in a subject.

19. A 4-epimerase inhibitor for treating or preventing insulin resistance or related disorders in a subject.

Images