Codon optimized oligonucleotides for inducing elastin de novo synthesis in mammals
By using codon optimization and nucleotide-modified oligonucleotide sequences, the de novo synthesis and expression efficiency of elastin in mammals is improved, the problems of low expression efficiency and RNA instability in the prior art are solved, and efficient elastin synthesis and safe therapeutic applications are achieved.
Patent Information
- Application Number
- CN202380080676.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2022-11-22
- Filing Date
- 2023-11-08
- Publication Date
- 2025-06-20
AI Technical Summary
The prior art in inducing de novo synthesis of elastin in mammals has low expression efficiency and requires a large amount of mRNA, and the biological instability and immunogenicity of the RNA limit its therapeutic application.
By providing an optimized oligonucleotide sequence that encodes the elastin precursor, elastin, prostate elastin (TE), improves expression efficiency using codon optimization, and enhances mRNA stability and reduces immunogenicity through modification of the 5'-cap structure and polyA tail and the use of nucleotide analogs.
The de novo synthesis of elastic proteins efficiently induces efficiencies in mammalian cells is achieved, reducing the risk of mutagenesis and immune response, and improving the effectiveness of treating diseases related to insufficient tissue elasticity.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
[0001] The present invention relates to oligonucleotides for inducing de novo synthesis of elastin in mammals, methods for treating diseases and medical conditions associated with insufficient tissue elasticity, the use of oligonucleotides in such treatments, and pharmaceutical and cosmetic compositions comprising such oligonucleotides. Technical Field
[0002] The present invention relates to the field of molecular medicine, and more particularly to protein expression for therapeutic or cosmetic purposes, and more specifically to inducing de novo synthesis of desired extracellular matrix proteins in mammals. Background Art
[0003] Elastin is a component of the extracellular matrix (ECM) of vertebrates and provides elasticity and flexibility to tissues. Elastin fibers are formed by covalently crosslinking lysine residues of the elastin precursor tropoelastin (TE). During ontogeny, soluble monomeric TE is secreted by cells such as smooth muscle cells, fibroblasts, and endothelial cells and assembled into highly stable, insoluble polymeric elastin fibers in the ECM by lysyl oxidase. The process of generating elastin fibers is referred to herein as elastogenesis.
[0004] Expression of TE is mainly restricted to the fetal and early postnatal years. From puberty onwards, elastin synthesis decreases and ceases in adulthood. Although the half-life of elastin is approximately 74 years, loss of elastin fibers is caused by age-related degradation, disease, or injury and may subsequently lead to loss of tissue elasticity, flexibility, integrity, and functionality.
[0005] Elasticity and thus elastin are very important in multiple organs such as the lung, heart, skin, or blood vessels, especially the aorta. Various genetic diseases such as Williams-Beuren syndrome (WBS) or cutis laxa result in impaired elastogenesis and lead to skin laxity and vascular defects such as supravalvular aortic stenosis. In the skin, damage to elastin fibers due to injury, disease, sunburn, and age-related degradation leads to irreversible loss of skin elasticity. After severe burns, loss of elastin in the dermis results in severe physical impairments such as scarring, wound contraction, and loss of skin extensibility. Therefore, regeneration of elastin fibers plays a crucial role in wound healing, scar formation, and restoration of skin function and elasticity.
[0006] In the above circumstances, it is interesting to be able to induce de novo synthesis of elastin. Various strategies have been applied to restore skin elasticity by inducing elastic fiber formation. Most prominent are the use of viral vectors (Xiong, J. et al., Elastic fibers reconstructed using adenovirus-mediated expression of tropoelastin and tested in the elastase model of abdominal aortic aneurysm in rats. J Vasc Surg, 2008. 48(4): p. 965-73) and the use of synthetic mRNA (DE102013005361A1, Lescan, M. et al., De Novo Synthesis of Elastin by Exogenous Delivery of Synthetic Modified mRNA into Skin and Elastin-Deficient Cells. Mol Ther Nucleic Acids, 2018. 11: p. 475-484).
[0007] The therapeutic application of synthetic mRNA has proven to be the most promising and has received great attention due to several advantages: First, it can be easily produced by in vitro transcription (IVT). Second, it does not integrate into the host genome and it is based on physiological decay. Therefore, compared with viral vectors, it only exists transiently in cells, greatly reducing the mutagenesis risk. In addition, other side effects associated with long-term overexpression of proteins are avoided. Third, compared with plasmid or viral vectors, it is easier to be delivered into cells due to its smaller size.
[0008] DE102013005361A1 discloses a synthetic mRNA encoding elastic fiber proteins (one of which is elastin) and containing nucleotide analogs. However, the enhancement of elastin expression is limited and a large amount of at least 5 µg of mRNA needs to be applied.
[0009] Lescan et al., 2018 discloses an increase in elastin synthesis in various types of human cells after transfection with synthetic TE mRNA and in ex vivo porcine skin after intradermal microinjection of synthetic TE mRNA.
[0010] The challenges faced by RNA in therapeutic applications are its biological instability and immunogenicity, which limit its bioavailability and applicability, respectively. Enzymes that degrade RNA are almost ubiquitous, especially in the extracellular space. Innate immune mechanisms involving Toll-like receptors (TLRs) recognize single-stranded RNA (TLR-7, TLR-8) or double-stranded RNA (TLR-3), subsequently inducing an inflammatory immune response.
[0011] Accordingly, an object of the present invention is to provide oligonucleotides that eliminate or at least mitigate the drawbacks of the prior art. In particular, oligonucleotides are to be provided that are capable of inducing de novo synthesis of elastin in mammalian cells and tissues by increasing the expression efficiency of synthetic mRNA encoding TE. The present invention fully achieves this object. Summary of the Invention
[0012] In one aspect of the present invention, the above drawbacks are overcome by providing an oligonucleotide comprising a nucleotide sequence encoding a TE protein, characterized in that the nucleotide sequence is codon-optimized for expression in mammalian cells.
[0013] Herein, as is commonly understood in the art, codon optimization should be understood as the replacement of at least one synonymous codon with a synonymous codon that is expected to result in a higher expression efficiency by synonymous codon exchange. Which codon is expected to have a higher expression efficiency depends on a variety of factors, the most common of which are the species, as well as the codon and the overall sequence GC content. Codon optimization can be parameterized as the codon adaptation index (CAI) (Sharp, P.M. and W.H. Li, The codon Adaptation Index--a measure of directional synonymous codon usage bias, and its potential applications. Nucleic Acids Res, 1987. 15(3): p. 1281-95). CAI represents the geometric mean of all amino acids, which involves the fraction of codons that are the same as one of the codons most commonly used in the reference genome to encode a particular amino acid among all synonymous codons encoding that amino acid.
[0014] As recognized by the inventors of the present application, codon optimization can positively impact the expression efficiency and stability of synthetic mRNAs encoding TEs, thereby increasing protein expression levels (Presnyak, V. et al., Codon optimality is a major determinant of mRNA stability. Cell, 2015. 160(6): p. 1111-24). This finding is particularly surprising for TEs and was not predictable for the following reasons.
[0015] During the design of synthetic mRNAs, one of the most important metrics is typically the GC content. It cannot be too low, or else the expression efficiency will be reduced due to enhanced degradation; nor can it be too high, or else the probability of secondary structures within the RNA molecule will increase, thereby limiting its accessibility to the translation machinery.
[0016] Codon-optimized synthetic mRNAs have been disclosed in studies of protein expression with low GC content in their coding wild-type nucleotide sequences. US10898584B2 discloses synthetic mRNAs relying on strongly increased GC content. Codon-optimized synthetic mRNAs are disclosed for non-fibrillar constructs, non-tissue structures, and non-ECM proteins (such as interferon (IFN)-α and erythropoietin (EPO)) (Kariko, K. et al., Increased erythropoiesis in mice injected with submicrogram quantities of pseudouridine-containing mRNA encoding erythropoietin. Mol Ther, 2012. 20(5): p. 948-53, and Hochmann, S. et al., Evaluation of modified Interferon alpha mRNA constructs for the treatment of non-melanoma skin cancer. Sci Rep, 2018. 8(1): p. 12954).
[0017] The prior art teaches the necessity of increasing the GC content to improve the expression efficiency of synthetic mRNA. To date, it has been thought impossible to improve the protein expression efficiency like TE because the GC content in the human wild-type sequence of TE is already as high as 64.3%. In other words, 76% of the amino acids in the human TE protein include glycine (29%), alanine (22%), valine (13%), and proline (12%). All these 4 amino acids have codons rich in GC. Therefore, at least 76% of those amino acids with corresponding codons are not optimizable in terms of GC content. Among the remaining 24% of the amino acids, some amino acids naturally do not have synonymous codons rich in GC, or if they do, those codons may not be convenient for expression in humans or other mammals.
[0018] Surprisingly, the inventors of the present application were able to codon-optimize the wild-type human nucleotide sequence encoding TE, which naturally has a high GC content, thereby improving the expression efficiency without adhering to the dogma of increasing the GC content. Advantageously, this adds an additional degree of freedom for generating such optimized sequences.
[0019] In an embodiment of the present invention, the oligonucleotide is an oligoribonucleotide, preferably mRNA.
[0020] By selecting the oligonucleotide as ribonucleic acid, the permanent introduction of the oligonucleotide into the genome of the corresponding cells is avoided, thereby greatly reducing the mutagenesis risk. In addition, due to the extremely long half-life of elastin, the transient presence of mRNA in the cell is advantageous because it allows the cells to return to their physiological state where they do not produce elastin. Thus, very specifically, the desired result of depositing additional elastin fibers in the ECM can be achieved without permanently changing the behavior of the corresponding cells.
[0021] In this context, the terms mRNA and synthetic mRNA are used interchangeably. The term "synthetic" should clearly indicate that the corresponding mRNA is artificially produced, preferably by in vitro transcription (IVT). There may or may not be structural or chemical differences between synthetic mRNA and mRNA.
[0022] In another aspect of the present embodiment, the oligonucleotide comprises a 5'-cap structure and / or a polyA tail. The 5'-cap structure is preferably selected from the group consisting of: 3'-O-Me-m7G(5')ppp(5')G, m7G(5')ppp(5')(2'-OMeA)pG, m7G(5')ppp(5')(2'-OMeA)pU, m7(3'-OMeG)(5')ppp(5')(2'-OMeA)pG. The polyA tail preferably consists of at least about 70 adenine nucleotides, more preferably about 120 adenine nucleotides. The 5'-cap structure can be of natural, synthetic or modified origin. Thus, the term "5'-cap structure" refers to any natural 5'-cap structure naturally used by eukaryotic cells, as well as any synthetic / modified non-naturally occurring 5'-cap structure that is suitable for replacing the natural 5'-cap structure in terms of function and cytotoxicity.
[0023] Such modifications mimic the natural structure of mammalian mRNA, thus advantageously providing a certain degree of stability to the oligonucleotide, causing the oligonucleotide to be degraded more slowly by the corresponding cells it is delivered to, allowing the oligonucleotide to induce TE synthesis.
[0024] Although the nucleotides can be naturally occurring nucleotides (i.e., unmodified nucleotides), in another embodiment of the present invention, at least one of the nucleotides is an analogue of a naturally occurring nucleotide. Advantageously, this further slows down the degradation of the synthetic mRNA and prevents the immune system from recognizing the synthetic mRNA, thus avoiding an inflammatory response. In this embodiment, a substantial portion of all nucleotides are analogues of the corresponding natural nucleotides. Natural nucleotides mean nucleotides containing nucleobases naturally present in mammalian DNA or RNA. Specifically, they include adenine, guanine, cytosine, thymine and uracil. Analogue should be understood to include a chemical structure similar to that of a natural nucleotide, allowing the cellular translation mechanism to translate the nucleotide sequence encoded by the oligonucleotide into the encoded protein, while slowing down the degradation of the corresponding oligonucleotide and / or reducing the immunogenicity of the corresponding oligonucleotide.
[0025] The term "substantial portion" means that not necessarily all natural nucleotides need to be replaced by analogues. At least 5% or more of one natural nucleotide is replaced by an analogue, preferably 25% or more, more preferably 100%.
[0026] In this embodiment, the analogue can be, for example, pseudouridine, N 1-Methylpseudouridine, 5-methylcytidine, phosphorothioate, phosphoroamidate, peptide nucleic acid, methylphosphonate, 7-deazaguanosine, 2-thiouridine, 5-methyluridine, 5-methyluridine-5'-triphosphate (m5U), 5-iodouridine-5'-triphosphate (15U), 4-thiouridine-5'-triphosphate (S4U), 5-bromouridine-5'-triphosphate (Br5U), 2'-methyl-2'-deoxyuridine-5'-triphosphate (U2'm), 2'-amino-2'-deoxyuridine-5'-triphosphate (U2'NH2), 2'-azido-2'-deoxyuridine-5'-triphosphate (U2'N3), 2'-fluoro-2'-deoxyuridine-5'-triphosphate (U2'F), inosine, 3-methylcytidine, 2-thiocytidine, 2'-methyl-2'-deoxycytidine-5'-triphosphate (C2'm), 2'-amino-2'-deoxycytidine-5'-triphosphate (C2'NH2), 2'-fluoro-2'-deoxycytidine-5'-triphosphate (C2'F), 5-iodocytidine-5'-triphosphate (15U), 5-bromocytidine-5'-triphosphate (Br5C) and 2'-azido-2'-deoxycytidine-5'-triphosphate (C2'N3), and preferably selected from the group consisting of: pseudouridine, N 1 -Methylpseudouridine and 5-methylcytidine. These analogs have proven to be very suitable for reducing the immunogenicity of the corresponding oligonucleotides while increasing the expression efficiency.
[0027] In another embodiment of the invention, the TE protein comprises the amino acid sequence of SEQ ID NO: 1.
[0028] Advantageously, using this human TE sequence allows the expression of TE in human cells, thereby enabling the oligonucleotides to be used in medical or cosmetic applications for humans.
[0029] In another embodiment of the invention, the oligonucleotide comprises the nucleotide sequence of any one of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5.
[0030] These sequences are codon-optimized variants of the wild-type sequences. Advantageously, these sequences exhibit low immunogenicity and high expression efficiency.
[0031] Hereinafter, the term "expression efficiency" shall be understood as the quotient of the amount of elastin synthesized by the corresponding mammalian cells or tissues within a certain time and the amount of the applied oligonucleotide. In this context, the term "applied" shall be understood as any type of method that can be adopted, resulting in or including the introduction of DNA or RNA into the cells.
[0032] In another embodiment of the present invention, oligonucleotides can be used to treat diseases and medical conditions associated with insufficient tissue elasticity. Such uses advantageously allow for the induction of transient de novo synthesis of elastic fibers within the ECM of mammalian tissues and thus enhance tissue elasticity. Preferably, such mammals are humans, mammals with human or domesticable mammalian characteristics, and more preferably, such mammals are humans.
[0033] As used herein, the term "disease" is generally understood in medicine to refer to any type of non-physiological condition of the corresponding mammal, which can be caused, for example, by genetic, neoplastic, microbial, bacterial, viral, or psychological factors. The term "medical condition" is to be understood to refer to any type of non-physiological condition, which can be caused, for example, by physical damage or aging of the mammalian body. However, as is commonly understood, a "medical condition" can also refer to a disease caused by such damage, and a "disease" can refer to a medical condition. Thus, the terms "disease" and "medical condition" can be used synonymously herein.
[0034] Diseases or medical conditions associated with "insufficient elasticity" are to be understood as any diseases or medical conditions that affect a mammal and for which the mammal can benefit from enhanced elasticity of any of its tissues. In this context, elasticity refers to the ability of a tissue to resist distorting influences and to return to its original size and shape when such influences are removed.
[0035] In this embodiment, the treatment is preferably selected from the group consisting of: therapies for genetic defects in elastin synthesis, therapies for arteriosclerosis, therapies for aortic stenosis, therapies for aortic and / or aneurysms, therapies for chronic obstructive pulmonary disease (COPD), therapies for eye diseases (such as AMD), therapies for aortic insufficiency, therapies for cutis laxa, therapies for Williams-Beuren syndrome, therapies for cutis verticis gyrata, therapies for ligament diseases, therapies for subvalvular congenital aortic stenosis (SVAS), therapies for scar tissue, and therapies for scarless wound healing. Mammals suffering from these diseases or medical conditions can benefit from enhanced tissue elasticity.
[0036] In another aspect, the present invention relates to a pharmaceutical composition comprising an oligonucleotide according to the present invention and a pharmaceutically acceptable carrier.
[0037] Those skilled in the art will clearly know the suitable carriers for specific treatments. Other publicly available pharmaceutically acceptable carriers for synthetic mRNA can be found, for example, in Ouranidis A et al., mRNA Therapeutic Modalities Design, Formulation and Manufacturing under Pharma 4.0 Principles. Biomedicines, 2021. Dec 27;10(1):50.
[0038] In one embodiment, the pharmaceutical composition is configured for systemic administration to a mammal, wherein preferably the systemic administration is via a parenteral administration route, more preferably intravenous injection. Systemic administration can be any enteral or parenteral administration route, preferably a parenteral administration route, more preferably intravenous injection. Advantageously, systemic administration allows treatment of the entire organism, which may be particularly advantageous for treating diseases or medical conditions associated with insufficient elasticity of vascular tissue.
[0039] In one embodiment, the pharmaceutical composition is configured for local administration by injection into or external application to the tissue of a mammal, wherein preferably the pharmaceutical composition is present in a formulation or delivery form selected from the group consisting of: cream, gel, liquid, paste, spray, plaster, microneedle, medical bandage, facial mask, implant, and stent.
[0040] Local administration is advantageous because it allows site-specific induction of de novo synthesis of elastin at the site of the disease or medical condition without unnecessarily affecting other areas of the body that do not require additional deposition of elastin fibers, which may cause harm to the corresponding mammal.
[0041] Any type of external application has a further advantage because it is less invasive and thus less stressful compared to other application methods.
[0042] The above-mentioned formulations or delivery forms of cream, gel, liquid, paste, spray, and plaster are advantageous because they allow the pharmaceutical composition to be applied to any area of the body, regardless of the size of the area.
[0043] Advantageously, the formulation or delivery form of plaster or microneedle allows the pharmaceutical composition to be applied to a very concise and defined area of the body where it is needed, where the corresponding area can be exposed to the pharmaceutical composition for a longer time and can be an area of the body that is usually covered by clothing, which may otherwise hinder the application of the pharmaceutical composition in daily life.
[0044] The formulation or delivery form of a bandage or a facial mask is advantageous as it allows the pharmaceutical composition to be distributed evenly and over a long period of time over the face or another large area of the body (e.g., a burn area).
[0045] The formulation or delivery form of an implant or a stent advantageously allows the application of the pharmaceutical composition to a vascular and / or local tissue area.
[0046] On the other hand, the present invention relates to a cosmetic composition comprising an oligonucleotide according to the present invention, which is used to enhance the elasticity of human tissues, preferably for treating or preventing the formation of wrinkles on human skin. The cosmetic composition can induce de novo synthesis of elastic fibers in human skin, which can restore or maintain sufficient elasticity of the skin to avoid the appearance of wrinkles and the like.
[0047] On the other hand, the present invention relates to a cosmetic method for inducing de novo synthesis of elastin in mammalian tissues, which comprises locally applying the cosmetic composition by injection into the tissue or external application to the tissue.
[0048] In one embodiment of the present invention, when performing the cosmetic method, it is applied at least once repeatedly. Repeatedly applying the cosmetic composition comprising the oligonucleotide allows the accumulation of elastic fibers in the corresponding tissue, which may be necessary or desirable since the oligonucleotide causes de novo synthesis of elastic fibers transiently and non-permanently.
[0049] In another embodiment of the present invention, the cosmetic composition exists in a formulation or delivery form selected from the group consisting of: creams, gels, liquids, pastes, sprays, plasters, microneedles, medical bandages and facial masks.
[0050] These formulations or delivery forms of creams, gels, liquids, pastes, sprays, microneedles and plasters are advantageous as they allow the cosmetic composition to be applied to any area of the body, regardless of the size of the area.
[0051] Advantageously, the formulation or delivery form of a plaster allows the cosmetic composition to be applied to a very concise and defined area of the body where it is needed, where the corresponding area can be exposed to the cosmetic composition for a longer time and can be on a body area that is usually covered by clothes, otherwise the clothes may hinder the application of the cosmetic composition in daily life.
[0052] The formulation or delivery form of a bandage or a facial mask is advantageous as it allows the cosmetic composition to be distributed evenly and over a long period of time over the face or another large area of the body (e.g., a scar area).
[0053] The characteristics, properties and advantages of the oligonucleotide mentioned according to the present invention equally apply to the pharmaceutical composition and the cosmetic composition according to the present invention.
[0054] Another aspect of the present invention is a method for treating a disease or medical condition associated with insufficient tissue elasticity. The treatment method includes administering the oligonucleotide and / or pharmaceutical composition according to the present invention to an organism suspected of being affected by the medical condition. The administration can be accomplished locally by injection into the desired tissue of a mammal or by topical application to the desired tissue of a mammal or by systemic administration.
[0055] In one embodiment, the method may include repeating the administration of the oligonucleotide and / or pharmaceutical composition at least once. Repeating the administration of the pharmaceutical composition containing the oligonucleotide allows the accumulation of elastic fibers within the corresponding tissue, which may be necessary or desirable since the oligonucleotide will transiently and non-permanently induce de novo synthesis of elastic fibers.
[0056] In another embodiment, the treatment method includes, prior to administering the oligonucleotide and / or drug administration, determining one or more areas on the patient's body that are suitable for administering the oligonucleotide and / or pharmaceutical composition and that are areas where the patient desires to change their visual appearance, wherein the desires of the patient involved can be recognized as a medical need.
[0057] It will be understood that the above features and those to be explained hereinafter can be used not only in the specific combinations given, but also in other combinations or alone, without departing from the scope of the present invention.
[0058] The present invention will now be described and explained in further detail with reference to the following non-limiting examples and drawings. Brief Description of the Drawings
[0059] Figure 1 : Detecting the production of elastin over time. The effect of different TE mRNA variants on elastin synthesis was detected by elastin ELISA. In OptiMEM, 3 × 10 5 EA.hy926 cells were transfected with 2.5 µg of TE mRNA complexed with 4 µl of Lipofectamine2000 for 4 h at 37 °C and 5% CO2. Thereafter, the transfection complex was replaced with cell medium, and the cells were incubated at 37 °C and 5% CO2 without further changing the medium. The concentration of elastin in the cell supernatant was measured at 24, 48, and 72 h. As a control, cells were treated with Lipofectamine2000 (L2000) or OptiMEM (medium) only. The concentration of elastin in the cell supernatant was measured at 24, 48, and 72 h. The results are shown as mean + SEM (n = 3).
[0060] Figure 2: Analysis of elastin synthesis after delivery of TE mRNA variants into cells. The effects of different TE mRNA variants on elastin synthesis were detected using an elastin ELISA. In OptiMEM, 3 × 10 5 EA.hy926 cells were transfected with 2.5 μg of TE mRNA complexed with 4 μl of Lipofectamine 2000 for 4 h at 37 °C and 5% CO2. Thereafter, the transfection complex was replaced with cell medium, and the cells were incubated for 48 h at 37 °C and 5% CO2. As a control, cells were treated with Lipofectamine 2000 (L2000) only. The elastin concentration in the cell supernatants transfected with (A) unmodified, (B) Ψ / m5C, (C) me 1 Ψ / m5C, (D) me 1 Ψ / C-modified TE mRNA variants was determined. Results are shown as mean + SEM (n = 3). Statistical differences were determined using one-way ANOVA and subsequent Bonferroni multiple comparison test. (*p < 0.05, **p < 0.01, ****p < 0.0001); + = statistical difference relative to the L2000 control (+p < 0.05, ++p < 0.01, +++p < 0.001, ++++p < 0.0001).
[0061] Figure 3 : Effects of TE sequence variants on cell viability. In OptiMEM, 3 × 10 5 EA.hy926 cells were transfected with 2.5 μg of TE mRNA complexed with 4 μl of Lipofectamine 2000 for 4 h at 37 °C and 5% CO2. Thereafter, the transfection complex was replaced with cell medium, and the cells were incubated at 37 °C and 5% CO2. With (A) unmodified, (B) Ψ / m5C, (C) me 1 Ψ / m5C and (D) me 1At 24 h after transfection with Ψ / C TE mRNA variants, cell viability was analyzed using Presto Blue assay. The cell viability treated with OptiMEM (culture medium) was set as 100%. Results are shown as mean + SEM (n = 3). Statistical differences were determined using one-way ANOVA and subsequent Bonferroni multiple comparison test. (ns = not significant; # = statistical difference relative to the medium control (#p < 0.05, ##p < 0.01, p < 0.001, #p < 0.0001); + = statistical difference relative to the L2000 control (+p < 0.05, ++p < 0.01, +++p < 0.001).
[0062] Figure 4 : Effect of nucleotide modification of TE mRNA variants on elastin synthesis. In OptiMEM, 3 × 10 5 EA.hy926 cells were transfected with 2.5 μg of TE mRNA complexed with 4 μl of Lipofectamine2000 for 4 h at 37 °C and 5% CO2. Thereafter, the transfection complex was replaced with cell culture medium, and the cells were incubated for 48 h at 37 °C and 5% CO2. As a control, cells were treated with Lipofectamine2000 (L2000) only. Elastin concentration in the cell supernatants transfected with TE mRNA variants (A) 1, (B) 3, (C) 4, (D) 14, and (E) native was measured. Results are shown as mean + SEM (n = 3). Statistical differences were determined using one-way ANOVA and subsequent Bonferroni multiple comparison test (*p < 0.05, **p < 0.01, ****p < 0.0001). + = statistical difference relative to the L2000 control (+p < 0.05, ++p < 0.01, +++p < 0.001, ++++p < 0.0001).
[0063] Figure 5: Effects of nucleotide modifications of TE mRNA variants on cell viability. Cells were transfected with 2.5 μg of TE mRNA complexed with 4 μl of Lipofectamine 2000 in OptiMEM. At 24 h after transfection with TE mRNA variants (A) 1, (B) 3, (C) 4, (D), and (E) native, cell viability was analyzed using Presto Blue assay. Cell viability treated with OptiMEM (medium) was set as 100%. Results are shown as + SEM (n = 3). Statistical differences were determined using one-way ANOVA and subsequent Bonferroni comparison test. (* p < 0.05, ** p < 0.01, *** p < 0.001, ns = not significant; # = statistical difference relative to medium control; + = statistical difference relative to L2000 control (+p < 0.05, ++p < 0.01, +++p < 0.001, ++++p < 0.0001).
[0064] Figure 6 : Analysis of the presence of TE mRNA in EA.hy926 cells after transfection with TE mRNA variants. The effects of different TE mRNA sequence variants and nucleotide modifications on mRNA decay were tested by qRT-PCR. Thus, in OptiMEM, 3 × 10 5 cells were transfected with 2.5 μg of TE mRNA complexed with 4 μl of Lipofectamine 2000 for 4 h at 37 °C and 5% CO2. Thereafter, the transfection complex was replaced with cell medium, and the cells were incubated for 2 h at 37 °C and 5% CO2, and RNA was isolated. Total TE mRNA content was determined by qPCR. Results are shown as mean ± SEM (n = 3).
[0065] Figure 7 : Representative photographic images of porcine skin after intradermal injection of TE mRNA variants. After injecting 9 × 10 μl of Ringer's lactate buffer containing no or 3, 10, or 30 μg of TE mRNA variants into a defined skin area of 1 × 1 cm, the injection side was marked with a tattoo pen. The injection sides of (A) unmodified TE mRNA variant and (B) me 1 Ψ / C-modified TE mRNA variant are shown 48 h later. No skin irritation or redness was observed.
[0066] Figure 8: Analysis of elastin expression in porcine skin after intradermal delivery of TE mRNA variants in vivo using ElaNIR staining. Selected TE mRNA variants were formulated only with Ringer's lactate (RL) buffer. Using a BD Micro-Fine TM insulin syringe, 9 × 10 µl was injected into a defined skin area marked with a tattoo ink pen. Injection of only buffer without mRNA was used as a control. Additionally, at the end of the experiment, biopsy tissues of untreated skin were collected. A-C): Unmodified or me 1 Ψ / C-modified TE mRNA variants 1, 3, 4, 14 and native were injected intradermally into porcine skin in the form of 90 µl of RL containing 3, 10, 30 µg of the TE mRNA variant. Each mRNA was applied five times in duplicate and tested in parallel in two pigs. 48 h after application, the pigs were euthanized and skin biopsy tissues were stained with ElaNIR to detect elastin content in the skin using IVIS. D) 30 µg of TE_mCherry mRNA in 90 µl of RL was injected intradermally into porcine skin in quadruplicate or quintuplicate. 48 h after application, the pigs were euthanized and skin biopsy tissues were fixed in 4% PFA and mCherry fluorescence signal was measured using IVIS. Fluorescence intensity was quantified as average radiance efficiency [p / s / cm 2 / sr] / [µW / cm 2 and normalized relative to the control of only the respective buffer. Results are shown as mean + SD. Statistical differences were determined using one-way ANOVA and subsequent Dunnett's multiple comparison test (* p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). E) Fluorescence microscopy analysis of paraffin sections of porcine skin biopsies 48 h after intradermal application of 30 µg TE_mCherry mRNA. Untreated skin biopsy tissues were used as negative controls. Arrows indicate TE-mCherry produced in the skin. BF: Bright field; DAPI: Blue; mCherry: Red. Scale bar: 100 µm.
[0067] Figure 9 : Detection of TE production after TE_mCherry transfection. In OptiMEM, 3 × 10 5EA.hy926 cells. After 4 h, the transfection complex was replaced with cell culture medium, and the cells were incubated for 24 h at 37 °C and 5% CO2. Thereafter, the concentration of TE in the cell culture supernatant was measured by ELISA. As a control, cells were treated with Lipofectamine2000 (L2000) or OptiMEM (culture medium) only. Results are shown as mean + SEM (n = 3). Statistical differences were determined using one-way ANOVA and subsequent Tukey's comparison test. (** p < 0.01).
[0068] Figure 10 : Representative images of IVIS detection of ElaNIR-stained porcine skin samples after intradermal in vivo injection of TE mRNA variants. Skin biopsies 48 h after injection of TE mRNA variant 14_me 1 Ψ / C and corresponding controls of only RL buffer and untreated. Biopsy tissues were collected from the injection site and using a biopsy punch. The untreated skin area was used as a control. The biopsy tissues were stained with 20 µM ElaNIR for 30 min. Photographic images including fluorescence heat maps were obtained to indicate fluorescence intensity and distribution area. The fluorescence emission of the defined region of interest (ROI) was normalized to the number of photons per steradian per square centimeter per second and expressed as mean radiant efficiency [p / s / cm 2 / sr] / [µW / cm 2 . w = with ElaNIR staining; wo = without ElaNIR staining.
[0069] Figure 11 : Cell viability and immune marker analysis after injection of TE mRNA variants into a human skin model. (A) 30 µg of TE mRNA variant 14_me in 90 µl RL (9 × 10 µl) 1 Ψ / C, 14_unmod, native_me 1Ψ / C and additional native Ψ / m5C were injected into the human Phenion® full-thickness (FT) skin model. According to the manufacturer's instructions, skin samples were placed on filter paper in growth medium and incubated at 37 °C and 5% CO2 for 24 h. Only RL-treated or untreated skin samples were used as controls. (B) At 24 h post-injection, cell viability in the skin samples was determined using the MTT assay. The viability of untreated skin samples was set as 100%. Results are shown as + SEM (n = 3). (C) At 24 h post-injection of the TE mRNA variants, immune activation was analyzed using qRT-PCR. RNA was isolated from untreated skin models or skin models injected only with RL buffer as controls. Gene expression levels were normalized relative to the expression level of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and expressed as fold induction relative to samples from untreated skin models. Results are shown as mean + SEM (n = 3). Statistical differences were determined using the Friedman test and subsequent Dunn's comparison test. Detailed Description of the Invention
[0070] Examples
[0071] 1. Materials and Methods
[0072] 1.1 In Vitro Synthesis of TE mRNA Variants
[0073] The TE coding sequence (CDS) of the TE mRNA variants was selected considering the GC content and the human codon adaptation index (CAI). The expression efficiency of four different modified TE mRNA variants was compared with that of native human elastin mRNA. A total of five candidate TE sequences were identified for in vitro analysis (Table 1).
[0074] As disclosed in Lescan et al. (2018), the synthesis of TE mRNA variants was performed by in vitro transcription (IVT). The TE-encoding DNA was amplified using pcDNA 3.3 or pUC57 plasmids containing different codon-optimized sequences of human TE. The plasmids were produced by Aldevron (Fargo, ND, USA). PCR was performed using the HotStar HiFidelity polymerase kit (Qiagen, Hilden, Germany) and forward primer (5'-TTGGACCCTCGTACAGAAGCTAATACG-3' (SEQ ID NO: 6)) and reverse primer (5'-T120-CTTCCTACTCAGGCTTTATTCAAAGACCA-3' (SEQ ID NO: 7)) at 0.7 mM each to amplify the plasmid insert. During the amplification, a poly-T tail of 120 thymines (T) was added to the plasmid insert. The primers were purchased from ELLA Biotech (Martinsried, Germany). PCR was performed using the following cycling protocol: initial activation at 94 °C for 3 min; denaturation at 94 °C for 45 s, annealing at 60 °C for 1 min and extension at 72 °C for 1 min, for 30 cycles. After a final extension at 72 °C for 5 min, the amplified PCR products were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions.
[0075] Then, 1.5 μg of each PCR product was in vitro transcribed using the MEGAscript T7 kit (Life Technologies, Darmstadt, Germany) according to the manufacturer's instructions. Different mRNA variants were generated (Table 1). To produce unmodified mRNA variants, 1.875 mM of GTP, 7.5 mM of ATP, 7.5 mM of CTP, and UTP were used. By using 7.5 mM Ψ or me 1Ψ was substituted for UTP, and 7.5 mM of m5CTP (m5C) was used instead of CTP to generate modified mRNA variants. CTP and UTP from the MEGAscript T7 kit were used, and the other nucleotides were purchased from TriLink BioTechnologies in San Diego, USA. In each IVT reaction, 2.5 mM of the 3'-O-Me-m7G(5')ppp(5')G RNA cap structure analog (New England Biolabs, Frankfurt, Germany) and 40 U of RiboLock RNase inhibitor (ThermoScientific, Waltham, MA, USA) were added. After incubation at 37 °C for 4 h, 1 μl of TurboDNase was added to remove the DNA template. After an additional 15 min of incubation at 37 °C, the mRNA was purified using the RNeasy Mini Kit (Qiagen, Hilden, Germany) and dephosphorylated at 37 °C for 30 min using 15 U of Antarctic phosphatase (New England Biolabs, Frankfurt, Germany). Subsequently, the mRNA was purified using the RNeasy Mini Kit. The concentrations of the DNA and mRNA products were determined using a BioPhotometer (Eppendorf, Hamburg, Germany). The purity and quality of the amplified DNA and synthesized mRNA were analyzed using 1% agarose gel electrophoresis (1 h, 100 V) and subsequent staining with GelRed (Biotium, Fremont, CA, USA) in 1× Tris-borate-EDTA (TBE) buffer.
[0076] Table 1: TE mRNA variants. Five different sequence variants were used to synthesize TE-encoding mRNAs and TE_mCherry mRNAs with different nucleotide modifications. unmod: unmodified, Ψ: pseudouridine triphosphate, m5C: 5-methyl-CTP, me 1 Ψ: N 1 -methylpseudouridine triphosphate.
[0077]
[0078] 1.2 Cell culture
[0079] EA.hy926 cells (ATCC, Manassas, VA, USA) were cultured in Dulbecco's Modified Eagle Medium (DMEM) containing high glucose and L-glutamine with 10% heat-inactivated fetal bovine serum (FBS) at 37 °C and 5% CO2. When reaching 80% confluence, the cells were passaged. Thus, the cells were washed with Dulbecco's Phosphate Buffered Saline (DPBS) and detached with 0.05% trypsin-EDTA. The cell medium was changed every 3 - 4 days. All cell culture reagents were obtained from Fisher Scientific.
[0080] 1.3 Transfect cells with TE mRNA
[0081] To transfect EA.hy926 cells, in each well of a 6-well plate, 3×10 5 cells were seeded in 2 ml of cell medium and cultured at 37 °C and 5% CO2 for 24 h. Liposomes were generated by complexing 2.5 μg of TE mRNA with 4 μl of Lipofectamine 2000 in 1 ml of OptiMEM I Reduced Serum Medium at room temperature (RT) for 20 min. The cells were rinsed once with DPBS and then incubated with the liposomes at 37 °C and 5% CO2 for 4 h. Then the transfection medium was replaced with 1 ml of cell medium and the cells were incubated at 37 °C and 5% CO2 for 24 to 72 h. As a control, the cells were also incubated with only OptiMEM (medium) or OptiMEM with 4 μl of Lipofectamine 2000 (L2000). All reagents were obtained from Thermo Fisher Scientific. After 24 and 72 h of culture, the expression of elastin in the supernatant was detected using ELISA.
[0082] 1.4 Elastin ELISA
[0083] Supernatants were collected 24, 48, and 72 h after transfection and centrifuged at 3,000 g for 10 min at RT. Then, 750 μl of the supernatant was transferred to a new protein low-binding tube, snap-frozen in liquid nitrogen, and stored at -80 °C until analysis. According to the manufacturer's instructions, the elastin concentration in the collected supernatants was determined using a human elastin ELISA kit (Biozol, Cloud-Clone Corp., Erkrath, Germany). The cell supernatants transfected with the TE mRNA variant containing the modified nucleoside were diluted 1:50 with DPBS. All other supernatants were used undiluted.
[0084] 1.5 Detection of cell viability by Presto Blue assay
[0085] The effect of different mRNA variants on cell viability was analyzed by Presto Blue assay. Thus, 3×10 5 EA.hy926 cells were seeded into 6-well plates, cultured at 37 °C and 5% CO2 for 24 h, and transfected with 2.5 μg of TE mRNA complexed with 4 μl of Lipofectamine 2000 in OptiMEM for 4 h at 37 °C and 5% CO2. After 4 h, the transfection medium was replaced with cell culture medium, and the cells were incubated at 37 °C and 5% CO2 for 24 h. Cells treated with Lipofectamine 2000 (L2000) or OptiMEM (medium) were used as controls. After 24 h, the cells were washed once with DPBS, and 500 μl of Presto Blue working solution (Invitrogen, Carlsbad, CA, USA) diluted 1:10 in cell culture medium was added to each well and incubated at 37 °C for 1.5 h. Using a multimode microplate reader (Mithras LB 940; Berthold Technologies), three measurements were taken at an excitation wavelength of 530 nm and an emission wavelength of 600 nm for 100 μl of each sample.
[0086] 1.6 Analysis of the presence of TE mRNA in cells
[0087] The amount of TE mRNA in EA.hy926 cells was detected 48 and 72 h after transfection with 2.5 μg of TE mRNA.
[0088] 1.7 RNA isolation and cDNA synthesis
[0089] The cells were washed with 1 ml of DPBS, detached with 0.05% trypsin-EDTA, and centrifuged at 1,000 g for 5 min at RT. Subsequently, the cells were washed once with 1 ml of DPBS and centrifuged at 1,000 g for 5 min at RT. The cell pellet was snap-frozen in liquid nitrogen and stored at -80 °C until the detection of synthetic TE mRNA in the cells. RNA was isolated using the standard Trizol protocol. Briefly, 1 ml of Trizol (Invitrogen, Carlsbad, CA, USA) was added to the frozen cell pellet and vortexed until the cells were completely lysed. Then, 0.2 ml of chloroform was added and centrifuged at 12,000×g for 15 min at 2-8 °C. The aqueous phase was transferred to a new tube and 0.5 ml of 2-propanol was added. After mixing and incubating for 15 min at RT, the mixture was centrifuged at 12,000×g for 10 min at 2-8 °C. The RNA pellet formed a pellet, which was washed with 95% EtOH and dissolved in RNase-free water after drying.
[0090] To synthesize cDNA, 1 µg of RNA was transcribed using the iScript cDNA Synthesis Kit (BioRad, Hercules, CA, USA) according to the manufacturer's instructions and then stored at -20 °C until use.
[0091] 1.8 Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR)
[0092] To determine the amount of TE mRNA by qRT-PCR, a cDNA standard with known TE mRNA content was used to generate a standard curve. A 100-fold serial dilution series of four template concentrations was used to generate the standard curve starting from 3 ng, and all reactions were repeated. After detecting the target in each standard sample, a standard curve of Cq versus the logarithm of the template concentration was plotted. The concentration of TE mRNA in the sample was within the concentration range covered by the standard curve, and the amount of TE mRNA in the cell pellet or skin biopsy tissue was determined using the standard curve. The amount was shown as ng TE mRNA / total RNA used for cDNA synthesis.
[0093] 1.9 In vivo studies in pigs
[0094] 1.9.1 Ethical statement
[0095] This study was conducted in accordance with the recommendations of the Federation of European Laboratory Animal Science Associations (FELASA) and the American Association for Laboratory Animal Science (AALAS) regarding the care and use of laboratory animals. The experiment was approved by the Institutional Animal Care Committee and Review Board and complied with Austrian law (BMBWF-68.205 / 0088-V / 3b / 2019).
[0096] 1.9.2 Animals and experimental setup
[0097] Six 12-week-old domestic pigs (Sus scrofa domestica) weighing approximately 30 kg were obtained from a local specific pathogen-free farm (Gutshof Medau / Schweineanlage, A-2560, Bernsdorf). The animal experiment was conducted at the University of Veterinary Medicine Vienna, and the animals were housed in the pigsty of the university hospital. After a one-week adaptation period, the experiment began and lasted for 48 h. The animals were clinically examined daily for 48 h before the start of the experiment until the end of the experiment.
[0098] A total of six pigs were used to test 11 mRNA variants. Each mRNA was administered in parallel to two pigs, and each pig was repeated three times. Different mRNA variants with different nucleotide modifications were administered under anesthesia by intramuscular injection of ketamine hydrochloride (Narketan®, 10 mg / kg body weight) and azaperone (Stresnil®, 1.3 mg / kg body weight), the application site was marked with a permanent marker, and euthanasia was performed. After intracardiac injection of T61® (1 ml / 10 kg body weight), biopsies of the marked tissues were taken after autopsy.
[0099] 1.9.3 In vivo application of TE mRNA
[0100] All unmodified and me 1After intradermal application of Ψ / C TE mRNA variants in porcine skin, their in vivo elastin expression efficiency was evaluated. In addition, to identify the newly generated exogenously expressed TE protein in the skin, a TE variant expressing mCherry-tagged TE (TE_mCherry) was also injected. Each mRNA was dissolved in Ringer's lactate (RL) buffer (Fresenius Kabi, Austria) at a total volume of 90 µl and concentrations of 3, 10, and 30 µg, respectively. For the application of TE_mCherry mRNA, 30 µg was used. Intradermal injection was performed using an insulin syringe BD Micro-FineTM (BD Franklin Lakes, NJ, USA), and 9 × 10 μl was injected into a defined skin area of 1 × 1 cm. As a control, only RL buffer without mRNA was injected. The animals were euthanized 48 h after injection, and biopsies were taken from all injection sites using a 10 mm biopsy punch. In addition, biopsies of untreated skin were taken at the end of the experiment. The biopsy tissues were snap-frozen in liquid nitrogen and stored at -80 °C until the elastin content was analyzed using elastin-specific ElaNIR staining.
[0101] 1.9.4 Staining and detection of skin biopsy tissues with ElaNIR
[0102] The fluorescent dye ElaNIR, which is more detailedly disclosed in Su, D. et al., Seeing Elastin: A Near-Infrared Zwitterionic Fluorescent Probe for In Vivo Elastin Imaging. Chem, 2018. 4(5): p. 1128 - 1138, was used to specifically stain elastin fibers in the skin. Therefore, 1 µmol of ElaNIR was dissolved in 1 ml of DMSO (Sigma-Aldrich, St. Louis, MO, USA), and the skin biopsy tissues were incubated overnight at 4 °C with 750 µl of DPBS containing 10% DMSO and 20 µM ElaNIR, and then washed 6 times with DPBS at RT for a total of 30 min. Near-infrared fluorescence signals (excitation: 745 nm, emission: 800 nm) were detected using an in vivo imaging system (IVIS Spectrum, PerkinElmer Inc.). Images were analyzed using Living Image 4.4 software (PerkinElmer Inc.). The fluorescence intensity of the defined region of interest (ROI) was quantified as the average radiant efficiency [p / s / cm 2 / sr] / [µW / cm 2 . The data were normalized relative to the corresponding control.
[0103] 1.9.5 Histological analysis of skin biopsy tissues injected with TE_mCherry mRNA
[0104] Skin biopsy tissues were collected, stored in 70% ethanol (PanReac AppliChem ITW Reagents; Darmstadt, Germany), transferred to embedding cassettes, and fixed overnight at 4 °C in 4% paraformaldehyde (PFA, Merck; Darmstadt, Germany). Samples were then dehydrated and infiltrated with paraffin in an automated tissue processor and embedded in paraffin blocks using a tissue embedding machine. Paraffin blocks were sectioned into 5-μm-thick slices using a microtome (Thermo Fisher Scientific), mounted on SuperFrost microscope slides (R. Langenbrinck, Emmendingen, Germany), and air-dried overnight in the dark at room temperature. Paraffin sections were dewaxed twice in 100% xylene (PanReac AppliChem ITW Reagents; Darmstadt, Germany) for a total of 2 min, then rehydrated in a graded ethanol series (100%, 80%, 70%, 60%) for 2 min each and washed in distilled deionized water for 1 min. Nuclei were stained using Vectashield mounting medium containing the fluorescent dye DAPI (Vector Laboratories, Burlingame, CA, USA). Fluorescent images were acquired using an Axiovert 135 fluorescence microscope (Zeiss) and analyzed using AxioVision Rel 4.8 software.
[0105] 1.10 Analysis of cytotoxicity and immunostimulatory potential of human skin models
[0106] 1.10.1 Application of TE mRNA in human skin models
[0107] The human Phenion® full-thickness (FT) skin model (Henkel AG & Co. KGaA, Düsseldorf, Germany) was used to analyze the potential toxic and immunogenic effects of synthetic TE mRNA variants after intradermal application. All components for culturing the FT skin model were purchased from Henkel AG & Co. KGaA. The skin model was placed in an air-liquid interface culture system in a culture dish and incubated in air-liquid interface (ALI) medium at 37 °C and 5% CO2 for 24 h. Then, a BD Micro-Fine TM insulin syringe was used to apply either no or 30 μg of TE mRNA variants 14_me 1 Ψ / C, 14_unmod, native_me 190 µl of RL buffer (9 × 10 µl) of Ψ / C or native_Ψ / m5C was injected into the FT skin model. The skin model was further cultured at 37 °C and 5% CO2 for 24 h. The untreated or RL buffer-only injected FT skin model was used as a control. For each treatment, 6 skin models were used, of which 3 skin models were used for immune activation analysis and 3 skin models were used for cytotoxicity analysis.
[0108] 1.10.2 In vitro skin toxicity analysis
[0109] According to the OECD 439 guideline, after injecting TE mRNA variants and the control group into the FT skin model, MTT assay was used to analyze skin toxicity. At 24 h post-injection, all skin samples were washed 8 times with 600 µl of DPBS, and then incubated for 3 h in each well of a 24-well plate containing 1 ml of DPBS with 0.5 mg / ml MTT working solution (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; Sigma, St. Louis, MO, USA) at 37 °C and 5% CO2. Then the skin model was dried and transferred to a 24-well plate with 1 ml of 2-propanol (VWR International; Radnor, USA) in each well, and incubated with shaking overnight at 4 °C to elute formazan in the skin model. The skin model was removed from the well, and the eluted formazan was diluted with 1 ml of 2-propanol at a ratio of 1:1. 200 µl of each sample was transferred to each well of a 96-well plate, and the absorbance was measured at 540 nm using a microplate reader (Mithras, Bad Wildbach, Germany).
[0110] 1.10.3 Isolation of RNA from skin models
[0111] Twenty-four hours after injecting the mRNA into the Phenion® FT skin model, RNA isolation was performed using the RNeasy Mini Kit (Qiagen, Hilden, Germany). Therefore, half of the skin tissue was cut into 8 pieces and transferred to 350 μl of RTL buffer supplemented with 10 μl of β-mercaptoethanol / ml buffer (Sigma, St. Louis, MO, USA) and incubated at 300 rpm for 35 min in a thermomixer. Then the tissue homogenate was mixed with 500 μl of RNase-free water and 10 μl of proteinase K (both from Qiagen), incubated at 55 °C for 40 min, and centrifuged at 8,000×g for 30 s. The supernatant was collected in a new reaction tube and gently mixed with 0.5 volume of 100% ethanol. Then 700 μl was transferred to the RNeasy Mini spin column and centrifuged at 8,000×g for 15 s, and the flow-through was discarded. The remaining tissue lysate was added to the spin column and the above procedure was repeated. The column was washed with 350 μl of RW1 buffer and centrifuged at 8,000×g for 15 s. To remove DNA, 80 μl of DNase was prepared from the RNase-free DNase Set (Qiagen) according to the manufacturer's instructions, added to each column, and incubated for 15 min. Then, 350 μl of RW1 buffer was added and the column was centrifuged at 8,000×g for 15 s. After discarding the flow-through, the column was washed twice with 500 μl of RPE buffer and centrifuged at 8,000×g for 30 s. The buffer was removed and the column was centrifuged at maximum speed for 4 min. RNA was eluted with 50 μl of RNase-free water and centrifuged at 8,000×g for 1 min. The isolated RNA was snap-frozen in liquid nitrogen and stored at -80 °C.
[0112] 1.10.4 qRT-PCR
[0113] Immune activation in tissues was studied by analyzing the expression of the markers IL-6, IL-8, CXCL-10, and IFN-β using qRT-PCR. Total RNA was isolated as described previously, and cDNA synthesis was performed using 900 ng of the isolated RNA and the iScript™ cDNA Synthesis Kit (Bio-Rad) under the following conditions: 5 min at 25 °C, 30 min at 42 °C, and 5 min at 85 °C. qRT-PCR was performed using 1:10 diluted cDNA and the iQ SYBR Green Supermix (Bio-Rad) according to the manufacturer's instructions. Reactions were performed in triplicate in an iCycler iQ real-time PCR detection system (Bio-Rad). Primers for the specific amplification of CXCL-10 (forward primer aagtggcatt caaggagtac c (SEQ ID NO: 10), reverse primer acgtggacaa aattggcttg c (SEQ ID NO: 11)), IFN-β (forward primer tacctgaagg ccaaggagtacag (SEQ ID NO: 12), reverse primer cggaggtaac ctgtaagtct gttaa (SEQ ID NO: 13)), IL-6 (forward primer cacacagaca gccactcacc tc (SEQ ID NO: 14), reverse primer ctgccagtgcctctttgctg (SEQ ID NO: 15)), IL-8 (forward primer gacttccaag ctggccgtg (SEQ ID NO:16)), reverse primer ctccttggca aaactgcacc (SEQ ID NO: 17)) and GAPDH (forward primer tcaacagcgacacccactcc (SEQ ID NO: 18), reverse primer tgaggtccac caccctgttg (SEQ ID NO: 19)) were purchased from Ella Biotech (Martinsried, Germany). The expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control and for normalizing the expression levels. Results were shown relative to the control mRNA levels of untreated samples.
[0114] 1.11 Statistics
[0115] Data are presented as mean ± SEM. Data were statistically analyzed using GraphPad Prism version 9.0.1. One-way analysis of variance with repeated measures, and Bonferroni or Tukey multiple comparisons or Friedman test, and subsequent Dunn's comparison test were applied. P < 0.05 was considered statistically significant.
[0116] 2. Results
[0117] 2.1 In silico optimization of the TE mRNA sequence
[0118] The CDS of TE was selected considering the GC content and the human CAI. The CAI value ranges from 0 to 1. It defines the relative adaptability of the codon usage of a gene to that of highly expressed genes. A higher value indicates a higher proportion of the most abundant codons, which in this case is most suitable for the human translation machinery, resulting in a higher expression level.
[0119] Here, four codon-optimized TE mRNA variants were selected from a large number of TE sequences and their expression was tested compared to native human TE mRNA (Table 2). Elastin is a particularly difficult protein to optimize because 76% of all its amino acids consist only of glycine (29%), alanine (22%), valine (13%) and proline (12%). All four of these amino acids have very GC-rich codons and thus the overall GC content of the mRNA is very high.
[0120] To analyze the effect of different codon-optimized TE mRNA variants (Table 2) and different nucleotide modifications on the expression efficiency, mRNAs were generated with unmodified nucleotide cytidine and uridine (CTP / UTP), with pseudouridine and 5-methylcytidine (Ψ / m5C), N1-methylpseudouridine (me 1 Ψ) and 5-methylcytidine (me 1 Ψ / m5C) as well as N 1 -methylpseudouridine and cytidine (me 1 Ψ / C) for 5 different TE mRNA variants (Table 1).
[0121] Table 2: Codon-optimized sequences of TE mRNA variants
[0122]
[0123] 2.2 Codon optimization of TE mRNA highly affects the expression efficiency but does not affect in vitro cell viability
[0124] To analyze the effect of TE codon sequence variation on elastin expression and cell viability, 2.5 µg of TE mRNA complexed with 4 µl of Lipofectamine2000 was transfected into 3×10 5 EA.hy926 cells in OptiMEM. After 24, 48, and 72 h, the supernatant was collected, and the elastin concentration was detected using ELISA. An increase in elastin production was detected after 24 h. However, the highest amount of elastin was measured quantitatively 48 h after transfection ( Figure 1 ). Cells treated with Lipofectamine2000 alone (L2000) were used as a control. Among all nucleotide modifications, TE mRNA variant 14 had the highest elastin expression ( Figure 2 ). After transfection of cells with unmodified TE mRNA (unmod), only a very small amount of elastin was detected in the supernatant ( Figure 2 A), which may be due to the high cytotoxic effect of unmodified mRNA in vitro ( Figure 3 A). Modifying TE mRNA variant 3 with Ψ / m5C ( Figure 2 B) or me 1 Ψ / m5C ( Figure 2 B) resulted in significantly higher elastin expression than the control (L2000). The highest protein expression was detected when mRNA variant 3 was modified with me 1 Ψ / m5C. When TE mRNA variant 14 was modified with Ψ / m5C ( Figure 2 B), me 1 Ψ / m5C ( Figure 2 B), me 1 Ψ / m5C ( Figure 2 C), or me 1 Ψ / C ( Figure 2 D), the elastin expression increased significantly, with the highest expression when modified with me 1 Ψ / m5C ( Figure 2 C). At the same time, compared with the control group, the elastin expression was significantly higher after modification of native mRNA with both Ψ / m5C ( Figure 2 B) and me1Ψ / C ( Figure 2 D), and me1Ψ / C modification produced the highest elastin expression.
[0125] The effect of mRNA variants on cell viability was examined 24 h after transfection using Presto Blue™ assay ( Figure 3) Cells treated with OptiMEM (medium) or Lipofectamine2000 (L2000) were used as controls. Compared with their nucleotide-modified variants, regardless of which sequence variant, unmodified mRNA showed high cytotoxicity to cells ( Figure 3 A). Surprisingly, when the same nucleotide modification was used, nucleic acid sequence changes did not affect cell viability. After transfecting cells with the Ψ / m5C-modified TE mRNA variant, the cell viability was the highest, reaching 79% ( 1 Ψ / m5C-modified TE mRNA variant transfection, the cell viability was the highest, reaching 79%( Figure 3 C), followed by the me 1 Ψ / C and Ψ / m5C-modified TE mRNA variants ( Figure 3 B and D).
[0126] 2.3 Nucleotide modification of codon-optimized TE mRNA variants can strongly regulate in vitro expression efficiency and reduce cytotoxicity
[0127] Modifying TE mRNA variants with modified nucleotides had a strong impact on the translation of mRNA variants, Figure 4 and the amount of elastin produced was described in. In particular, the incorporation of me 1 Ψ / m5C or me 1 Ψ / C nucleotides had a beneficial effect on elastin expression. For TE mRNA variant 1( Figure 4 A) and 4( Figure 4 C), compared with the control (L2000), only the incorporation of me 1 Ψ / C into the mRNA significantly increased elastin expression. Using the Ψ / m5C, me 1 Ψ / m5C, and me 1 Ψ / C-modified TE mRNA variant 3, a significant increase in elastin expression was also observed ( Figure 4 B). Compared with the control, the use of me 1 Ψ / m5C or me 1 Ψ / C to generate the native TE mRNA variant and TE mRNA variant 14 significantly increased the amount of elastin expressed ( Figure 4 D). The translation levels of TE variants 1, 4, and native modified by me 1 Ψ / C were the highest. In contrast, for TE variants 3 and 14, the highest elastin expression levels were detected by using me 1 Ψ / m5C. These data indicate that in addition to codon optimization, modifying each TE mRNA variant with modified nucleotides also has a great impact on translation.
[0128] The effect of nucleotide modification of TE mRNA variants on cell viability was also analyzed (Figure 5 ). For all TEmRNA sequence variants ( Figure 5 A-E), compared with TE mRNA variants modified with unmodified nucleotides or Ψ / m5C, the use of me 1 Ψ / m5CTP and me 1 Ψ results in the highest cell viability. Overall, cells transfected with TEmRNA containing the nucleotide modification me 1 Ψ / m5C showed the highest cell viability. Therefore, the incorporation of me 1 Ψ / m5CTP or me 1 Ψ increased cell viability by up to 30%. After transfection, the presence of transfected TE mRNA modified with these nucleotides could be detected in cells for up to 72 h ( Figure 6 ). No differences in mRNA decay were detected between different mRNA variants and nucleotide modifications.
[0129] In summary, TE mRNA variant 14 showed the highest elastin expression. Nucleotide modification of each TE mRNA variant led to increased protein expression, with the highest protein expression after transfection with 14_me 1 Ψ / m5C or 14_me 1 Ψ / C. Surprisingly, codon optimization did not affect cell viability, but nucleotide modification did. The highest cell viability was observed in cells modified with me 1 Ψ / m5C. In Table 3, the rankings of all 20 mRNA variants tested in vitro are shown. It is considered that high protein expression is desirable while toxicity should be as low as possible.
[0130] Table 3: Ranking table of TE mRNA variants tested in vitro
[0131]
[0132] 2.4 In vivo administration of TE mRNA to porcine skin significantly increased elastin expression
[0133] TE mRNA sequence variants modified with me 1 Ψ nucleotides showed reduced toxicity, increased protein expression efficiency, and stable mRNA presence as determined by mRNA decay analysis in cells. Therefore, unmodified or me 1 Ψ / C-modified TE mRNA variants, native, 1, 3, 4, and 14, and me 1 Ψ / C-modified native TE_mCherry were screened in porcine skin to analyze the in vivo protein expression efficiency.
[0134] At 48 h after injection, no skin irritation was observed at the injection site ( Figure 7 ). De novo synthesis of elastin in porcine skin was determined at 48 h after intradermal injection of TE mRNA. The amount of elastin in the whole skin biopsy was determined by elastin-specific ElaNIR staining. The ElaNIR-specific fluorescence signal was then measured using IVIS ( Figure 8 A, B, C, D).
[0135] Compared with injection of RL buffer only, injection of 10 and 30 μg of unmodified TE mRNA variant 14 (Figure 8A and B) resulted in significantly higher elastin expression. For the 1 Ψ / C-modified TE mRNA variant 14, application of 3 μg of 14_me 1 Ψ / C had already led to a significant increase in elastin levels, and increased elastin expression was also observed after intradermal injection of 10 and 30 μg of 14_me 1 Ψ / C ( Figure 8 B). Figure 10 Representative images of ElaNIR-stained porcine skin samples detected by IVIS at 48 h after intradermal injection of TE mRNA variants in vivo are shown. In addition, injection of 30 μg of native_me 1 Ψ / C resulted in a significant increase in the amount of elastin in the skin ( Figure 8 A).
[0136] To more easily distinguish endogenous elastin from de novo synthesized elastin expressed after TE mRNA administration, a TE mRNA construct with an N-terminal mCherry-encoding tag sequence was designed and administered in vivo. Production of TE protein was confirmed after transfection of EA.hy926 cells with 2.5 mg of TE-mCherry mRNA ( Figure 9 ).
[0137] After injection of 30 μg of TE_mCherry mRNA, the expressed mCherry-tagged elastin could be detected in skin biopsy tissues, and showed a significantly increased fluorescence intensity compared with untreated skin controls ( Figure 8 D). Fluorescence microscopy images of sections of biopsy tissues showed that mCherry-tagged elastin was mainly distributed in the dermis near the resident cells (nuclei stained with DAPI) ( Figure 8 E).
[0138] 2.5 No skin toxicity and immune activation were detected after administration of TE mRNA variants in the skin
[0139] After intradermal application in the human Phenion® FT skin model, the potential toxic and immunogenic effects of TE mRNA variants in the skin were analyzed. The TE mRNA variant 14_me with the highest in vivo protein expression efficiency 1 Ψ / C, 14_unmod, and native_me 1 Ψ / C, and additional native_Ψ / m5C were injected into the skin model ( Figure 11 A). Similar to the in vivo experiment, 30 µg of TE mRNA in 90 µl of RL buffer was injected. Skin models injected with only RL and untreated ones were used as controls. At 24 h after injection, the cell viability in the skin model was determined using the MTT assay. Injection of different TE mRNA variants did not show a negative impact on cell viability ( Figure 11 B). Similar conclusions were also drawn by analyzing the immune activation markers through qRT-PCR. At 24 h after injection, compared with the control group or between different TE mRNA groups, there was no significant increase in the expression of the immune activation markers IL-6, IL-8, CXCL-10, and IFN-β in the TE mRNA-treated groups ( Figure 11 C). The low immunogenicity of TE_mRNA is beneficial for the indicative use of TE_mRNA in pharmaceutical or cosmetic compositions.
[0140] 3. Conclusions
[0141] The oligonucleotides provided by the inventors of the present application allow for de novo synthesis of elastin with higher expression efficiency in mammalian cells and tissues.
Claims
1. An oligonucleotide comprising a nucleotide sequence encoding a tropoelastin protein, characterized in that, The nucleotide sequence is codon-optimized for expression in mammalian cells.
2. The oligonucleotide according to claim 1, characterized in that The oligonucleotide is an oligoribonucleotide, preferably mRNA.
3. The oligonucleotide according to claim 2, characterized in that, The mRNA comprises: - a 5'-cap structure, which is preferably 3'-O-Me-m7G(5')ppp(5')G, and / or - a polyA tail, which preferably consists of at least about 70 adenine nucleotides and more preferably consists of about 120 adenine nucleotides.
4. The oligonucleotide according to any one of claims 1 to 3, characterized in that, At least one nucleotide is an analogue of a naturally occurring nucleotide.
5. The oligonucleotide according to claim 4, characterized in that, The analogue is selected from the group consisting of: pseudouridine, N-methylpseudouridine, and 5-methylcytosine.
6. The oligonucleotide according to any one of claims 1 to 5, characterized in that, The tropoelastin protein comprises the amino acid sequence of SEQ ID NO:
1.
7. The oligonucleotide according to any one of claims 1 to 6, comprising a nucleotide sequence of any one of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO:
5.
8. The oligonucleotide according to any one of claims 1 to 7, which is used for treating diseases and medical conditions related to insufficient tissue elasticity.
9. The oligonucleotide for the use according to claim 8, characterized in that, The treatment is selected from the group consisting of: treatment of genetic defects in elastin synthesis, treatment of arteriosclerosis, treatment of aortic stenosis, treatment of aortic and / or cerebral aneurysms, treatment of chronic obstructive pulmonary disease (COPD), treatment of eye diseases, treatment of age-related macular degeneration (AMD), treatment of aortic insufficiency, treatment of cutis laxa, treatment of Weill-Marchesani syndrome, treatment of cutis hyperelastica, treatment of ligament diseases, treatment of subvalvular congenital aortic stenosis (SVAS), treatment of scar tissue, and treatment for scarless wound healing.
10. A pharmaceutical composition comprising the oligonucleotide according to any one of the foregoing claims and a pharmaceutically acceptable carrier.
11. The pharmaceutical composition according to claim 10, characterized in that, The pharmaceutical composition is configured for systemic administration to a mammal, wherein preferably the systemic administration is by a parenteral route of administration, more preferably by intravenous injection.
12. The pharmaceutical composition according to claim 10, characterized in that, The pharmaceutical composition is configured for local administration by injection into or external application to a tissue of a mammal, wherein preferably the pharmaceutical composition is present in a formulation or delivery form selected from the group consisting of: creams, gels, liquids, pastes, sprays, plasters, microneedles, medical bandages, face masks, implants, and scaffolds.
13. A cosmetic composition comprising the oligonucleotide according to any one of claims 1 to 7 for enhancing the elasticity of human tissues, preferably for treating or preventing wrinkles formed on human skin.
14. A cosmetic method for inducing de novo synthesis of elastin in mammalian tissues, which comprises topically applying the cosmetic composition according to claim 13 by injection into the tissue or external application to the tissue.
15. The cosmetic method according to claim 13, characterized in that, The application is repeated at least once, preferably the cosmetic composition is present in a formulation or delivery form selected from the group consisting of: creams, gels, liquids, pastes, sprays, plasters, microneedles, medical bandages, and face masks.
Citation Information
Patent Citations
Polyribonucleotid
DE102013005361A1
Modified RNA with decreased immunostimulatory properties
US10898584B2