Application of sparassis crispa extract in improving light sleep and dreaminess, promoting cell repair and tightening skin
By extracting the extract of hydrangea, compositions for improving sleep quality, mitochondrial manifestations, cell damage repair and skin firming were prepared, solving the difficulties in improving these aspects in the prior art, and achieving significant sleep quality and skin health improvement.
Patent Information
- Application Number
- CN202311721252.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-14
- Publication Date
- 2025-06-24
AI Technical Summary
The prior art is difficult to effectively improve sleep quality, mitochondrial manifestations, cell damage repair and skin firming, and traditional sleeping pills and sleep therapy methods have dependencies, tolerance and side effects.
By extracting the extract of hydrangea, using water as a solvent, extracting under specific temperature and time conditions, compositions for improving sleep quality, mitochondrial manifestations, cell damage repair or skin firming are prepared.
Hydrangea extract can increase the content of 4-aminobutyric acid (GABA), promote nerve relaxation, increase mitochondrial activity in cells, prolong cell lifespan, regulate mitochondrial autophagy in cells, and improve skin relaxation and dryness, significantly improve sleep quality and skin health.
Smart Images

Figure CN120189446A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to an extract of Sparassis crispa, and particularly to the use of the extract of Sparassis crispa for preparing a composition for improving sleep quality, improving mitochondrial performance, promoting cell damage repair or firming the skin of the recipient. Background Art
[0002] Most common mushrooms grow in shady areas, while Sparassis crispa requires more than ten hours of sunlight per day for growth and is the only known "sun mushroom" at present. The fruiting body of Sparassis crispa is tender, and has an aroma and a unique taste, and is a delicacy recognized by gourmet experts.
[0003] There are many causes of insomnia, which may be related to stress, emotions, lifestyle, diseases, medications or brain degeneration, etc. Insomnia not only harms physical and mental health, but also increases the risk of suffering from various diseases. However, sleeping pills may cause dependence, tolerance and side effects, sleep therapy may lead to serious anesthesia reactions, and sleep aids may cause allergies or breathing difficulties. Summary of the Invention
[0004] The growth environment of Sparassis crispa is different from that of common mushrooms, resulting in different active ingredients. In view of this, in order to develop more applications of Sparassis crispa, the present invention provides a use of an extract of Sparassis crispa for preparing a composition for improving sleep quality, improving mitochondrial performance, promoting cell damage repair or firming the skin of the recipient.
[0005] In some embodiments, the present invention provides a use of an extract of Sparassis crispa for preparing a composition for reducing the conditions of light sleep and / or frequent dreaming. The extract of Sparassis crispa is obtained by extracting from Sparassis crispa using water as a solvent.
[0006] In some embodiments, the extract of Sparassis crispa is used to increase the content of gamma-aminobutyric acid (GABA).
[0007] In some embodiments, the extract of Sparassis crispa helps to relax the nerves.
[0008] In some embodiments, the present invention provides a use of an extract of Sparassis crispa for preparing a composition for improving the performance of mitochondria. The extract of Sparassis crispa is obtained by extracting from Sparassis crispa using water as a solvent.
[0009] In some embodiments, the extract of Sparassis crispa is used to increase the activity of mitochondria in cells.
[0010] In some embodiments, the extract of Sparassis crispa is used to extend the lifespan of cells.
[0011] In some embodiments, Sparassis crispa extract is used to regulate autophagy in cells.
[0012] In some embodiments, Sparassis crispa extract is used to regulate the expression levels of genes related to mitochondrial performance in human cells, and the genes related to mitochondrial performance are at least one of the following: CCT5 gene, CCT7 gene, Pink1 gene, Parkin gene, SIRT1 gene, FOXO gene, PARP1 gene, and SOD3 gene.
[0013] In some embodiments, the present invention provides a use of Sparassis crispa extract, which is used to prepare a composition for promoting cell damage repair. The Sparassis crispa extract is obtained by extracting Sparassis crispa with water as a solvent.
[0014] In some embodiments, Sparassis crispa extract is used to regulate autophagy in cells.
[0015] In some embodiments, Sparassis crispa extract is used to increase the expression level of ATG1 gene and / or ATG8 gene.
[0016] In some embodiments, Sparassis crispa extract is used to increase the content of gamma-aminobutyric acid.
[0017] In some embodiments, the present invention provides a use of Sparassis crispa extract, which is used to prepare a composition for firming the skin of a receptor. The Sparassis crispa extract is obtained by extracting Sparassis crispa with water as a solvent.
[0018] In some embodiments, Sparassis crispa extract is used to improve the flabby state of the skin of the receptor.
[0019] In some embodiments, Sparassis crispa extract is used to improve the dry state of the skin of the receptor.
[0020] In some embodiments, the Sparassis crispa extract is extracted from the fruiting body of Sparassis crispa.
[0021] In some embodiments, the Sparassis crispa extract is obtained by leaching Sparassis crispa in water at 90 ± 5°C for 60 minutes.
[0022] In summary, the hydrangea extract of any embodiment can be used to prepare a composition for improving sleep quality, improving mitochondrial performance, promoting cell damage repair, or tightening the receptor skin. In some embodiments, the hydrangea extract can have at least one of the following effects: increasing the content of 4-aminobutyric acid (GABA), helping nerves relax, increasing the activity of mitochondria in cells, extending cell life, regulating the autophagy of mitochondria in cells, regulating the ATG1 gene, ATG8 gene, CCT5 gene, CCT7 gene, Pink1 gene, Parkin gene, SIRT1 gene, FOXO gene, PARP1 gene, and SOD3 gene of human cells, improving the relaxation state of the receptor skin, and improving the dry state of the receptor skin. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 This is a graph showing the test results of promoting GABA content by hydrangea extract according to an embodiment.
[0024] Figure 2 This is a graph showing the test results of regulating gene expression by hydrangea extract according to an embodiment of the present invention.
[0025] Figure 3 This is a graph showing the test results of regulating gene expression by hydrangea extract according to an embodiment of the present invention.
[0026] Figure 4 This is a graph showing the test results of regulating gene expression by hydrangea extract according to an embodiment of the present invention.
[0027] Figure 5 This is a graph showing the test results of regulating gene expression by hydrangea extract according to an embodiment of the present invention.
[0028] Figure 6 This is a graph showing the test results of regulating gene expression by hydrangea extract according to an embodiment of the present invention.
[0029] Figure 7 This is a graph showing the average skin laxity test results from a human experiment.
[0030] Figure 8 This is a graph showing the average blood GABA content in human experiments.
[0031] Figure 9 This is a statistical graph of the questionnaire results of human experiments.
[0032] Figure 10 This is a statistical graph of the questionnaire results of human experiments. DETAILED DESCRIPTION
[0033] As used herein, "hydrangea" refers to the fruiting body of hydrangea, which has a milky white to yellow appearance and presents a flat and curled leaf-like structure. The scientific name of hydrangea is Sparassia crispa.
[0034] In some embodiments, the Sparassis crispa used for extracting the Sparassis crispa extract may be fresh Sparassis crispa, dried Sparassis crispa, or frozen Sparassis crispa. In some embodiments, drying may be air drying, sun drying, shade drying, or freeze drying.
[0035] In some embodiments, the Sparassis crispa used for extracting the Sparassis crispa extract may be whole, or Sparassis crispa after physical processing procedures such as chopping, dicing, slicing, grinding, milling, or other methods that change the size and physical integrity of the raw material.
[0036] In some embodiments, the Sparassis crispa extract is obtained by a water extraction step to obtain a Sparassis crispa extract solution. The water extraction step uses water as a solvent and is carried out at a specific temperature for a specific time to obtain a Sparassis crispa extract solution. In some embodiments, the specific temperature refers to between 95°C and 85°C. In one embodiment, the specific temperature is 90 ± 5°C. In one embodiment, the specific temperature is 90°C. In some embodiments, the specific time refers to 60 minutes to 80 minutes. In some embodiments, the specific time refers to 60 minutes.
[0037] In some embodiments, the water extraction step further includes measuring the Brix value (Degrees Brix, °Bx) of the Sparassis crispa extract solution after a specific time. When the Brix value reaches 2.9 ± 0.5 °Bx, a Sparassis crispa extract solution is obtained. In some embodiments, the water extraction step further includes measuring the Brix value of the Sparassis crispa extract solution after a specific time. When the measured Brix value is less than 2.4 °Bx, the specific time is extended by 30 minutes. That is, the Sparassis crispa extract solution is taken as the acceptance standard with a Brix value of 2.9 ± 0.5 °Bx to obtain a Sparassis crispa extract solution. In some embodiments, the Sparassis crispa extract solution is the Sparassis crispa extract.
[0038] In some embodiments, in the water extraction step, the weight ratio of water to Sparassis crispa is 15 to 5:1. For example, water:Sparassis crispa is 10:1. Here, if the solvent is too little or the specific time is too short, the extraction efficiency will decrease significantly; if the specific time is too long, the active ingredients in the extract may degrade.
[0039] In some embodiments, the Sparassis crispa extract is obtained by a water extraction step and a filtration step to obtain a Sparassis crispa extract solution. Among them, the filtration step refers to the step of filtering the Sparassis crispa extract after the water extraction step by means of a sieve or centrifugation to remove the solids in the Sparassis crispa extract. For example, the Sparassis crispa extract solution is filtered through a 400-mesh sieve to obtain a Sparassis crispa extract solution.
[0040] In some embodiments, the Sparassis crispa extract is prepared into a Sparassis crispa extract solution through a water extraction step, a filtration step, and a concentration step. Among them, the concentration step refers to the step of removing excess water from the Sparassis crispa extract after the water extraction step or the water extraction step and the filtration step, so as to reduce the storage volume of the Sparassis crispa extract. For example, a concentrator (brand / model: BUCHI–Rotavapor R-100) can be used to perform vacuum concentration at 60±5°C until the Brix value of the solution reaches 10±0.5, and then stop the concentration to obtain the Sparassis crispa extract solution. In other embodiments, vacuum concentration can be performed at 50°C to 82°C.
[0041] In some embodiments, the Sparassis crispa extract is used to prepare a composition for reducing the conditions of light sleep and / or frequent dreaming. In some embodiments, the Sparassis crispa extract is used to increase the content of gamma-aminobutyric acid (GABA). In some embodiments, the Sparassis crispa extract helps with nerve relaxation.
[0042] In some embodiments, the present invention provides a use of a Sparassis crispa extract, which is used to prepare a composition for improving mitochondrial performance. The Sparassis crispa extract is obtained by extracting Sparassis crispa with water as a solvent. In some embodiments, the Sparassis crispa extract is used to increase the activity of mitochondria in cells. In some embodiments, the Sparassis crispa extract is used to extend cell lifespan. In some embodiments, the Sparassis crispa extract is used to regulate autophagy in cells. In some embodiments, the Sparassis crispa extract is used to regulate the expression level of genes related to mitochondrial performance in human cells, and the genes related to mitochondrial performance are at least one of the following: CCT5 gene, CCT7 gene, Pink1 gene, Parkin gene, SIRT1 gene, FOXO gene, PARP1 gene, and SOD3 gene.
[0043] In some embodiments, the Sparassis crispa extract is used to prepare a composition for promoting cell damage repair. The Sparassis crispa extract is obtained by extracting Sparassis crispa with water as a solvent. In some embodiments, the Sparassis crispa extract is used to regulate autophagy in cells. In some embodiments, the Sparassis crispa extract is used to increase the expression level of the ATG1 gene and / or the ATG8 gene.
[0044] In some embodiments, the Sparassis crispa extract is used to prepare a composition for tightening the skin of the recipient. In some embodiments, the Sparassis crispa extract is used to improve the flabby state of the skin of the recipient. In some embodiments, the Sparassis crispa extract is used to improve the dry state of the skin of the recipient.
[0045] In some embodiments, Sparassis crispa extract is used to promote the mitochondrial activity of skin cells. Herein, mitochondria are the energy production factories of cells. Mitochondrial activity may decline due to external environmental damage or natural degradation. Diabetes, heart disease, arthritis, etc. have also been found to be related to mitochondrial DNA mutations. For example, long-term exposure of the skin to UV light can cause mutations in mitochondrial DNA and reduce its activity. If mitochondrial activity can be promoted, the cell metabolism rate and growth rate can be increased, thereby repairing the skin, and the occurrence of skin aging can be slowed down as observed externally. In addition, there are many mitochondria in the brain. If the normal function of mitochondria can be maintained, the smooth operation of the brain can be maintained, and insomnia problems caused by brain degeneration can be avoided.
[0046] In some embodiments, Sparassis crispa extract is used to regulate the expression levels of mitochondrial-related genes to improve mitochondrial performance. In some embodiments, the mitochondrial-related genes are at least one of the following: CCT5 gene (Gene ID: 22948), CCT7 gene (Gene ID: 10574), Pink1 gene (Gene ID: 65018), Parkin gene (Gene ID: 5071), SIRT1 gene (Gene ID: 23411), FOXO gene (Gene ID: 2308), PARP1 gene, and SOD3 gene (Gene ID: 6649).
[0047] In some embodiments, Sparassis crispa extract is used to regulate the expression levels of autophagy-related genes to promote the repair of cell damage. In some embodiments, the autophagy-related genes to be regulated are at least one of the following: Atg1 gene (Gene ID: 8408) and Atg8 gene (Gene ID: 11345).
[0048] Among them, the CCT5 gene and the CCT7 gene regulate genes related to mitochondrial activity. The Pink1 gene and the Parkin gene regulate mitochondrial performance and degradation. That is, promoting the expression levels of the CCT5 gene, the CCT7 gene, the Pink1 gene, and the Parkin gene can activate the energy source of cells and delay the state of cell aging.
[0049] Among them, the ATG1 gene and the ATG8 gene participate in the autophagy of cells. By regulating autophagy, old and waste cell organelles are metabolized and recyclable substances are recovered. That is, promoting the expression levels of the ATG1 gene and the ATG8 gene can improve the cell repair ability.
[0050] Among them, when the PARP1 gene is expressed, it inhibits NAD +, thereby reducing mitochondrial activity and affecting cellular energy. That is, inhibiting the expression level of the PARP1 gene can enhance mitochondrial activity. Among them, the SIRT1 (sirtuin) gene enhances the cell's ability to balance oxidative stress by promoting mitochondrial activity. The FOXO gene is regulated by the SIRT1 gene, and then controls the expression of SOD3. The SOD3 gene is regulated by the FOXO gene, and then affects the extension of cell lifespan.
[0051] In some embodiments, the aforementioned composition can be a health product or a health food. In some embodiments, the aforementioned composition is a health product or a health food for non-medical purposes. In other words, this health product or health food contains an effective dosage of Sparassis crispa extract.
[0052] In some embodiments, the aforementioned health composition can be manufactured into a dosage form suitable for enteral or oral administration using techniques well-known to those of ordinary skill in the art. These dosage forms include, but are not limited to: tablets, troches, lozenges, pills, capsules, dispersible powders or granules, solutions, suspensions, emulsions, syrups, elixirs, slurries, and the like.
[0053] In some embodiments, the aforementioned health composition can be manufactured into a dosage form suitable for parenteral or topical administration using techniques well-known to those of ordinary skill in the art. These dosage forms include, but are not limited to: injections, sterile powders, external preparations, and the like. In some embodiments, the health composition can be administered by a parenteral route selected from the group consisting of: subcutaneous injection, intraepidermal injection, intradermal injection, and intralesional injection.
[0054] In some embodiments, the health care composition may further comprise a pharmaceutically acceptable carrier that is widely used in food manufacturing techniques. For example, the pharmaceutically acceptable carrier may comprise one or more of the following reagents: solvent, buffer, emulsifier, suspending agent, decomposer, disintegrating agent, dispersing agent, binding agent, excipient, stabilizing agent, chelating agent, diluent, gelling agent, preservative, wetting agent, lubricant, absorption delaying agent, liposome, and the like. The selection and amount of these reagents fall within the professional competence and routine techniques of those of ordinary skill in the art.
[0055] In some embodiments, the pharmaceutically acceptable carrier comprises a solvent selected from the group consisting of: water, normal saline, phosphate buffered saline (PBS), aqueous solution containing alcohol.
[0056] In some embodiments, the aforementioned health care composition may be an edible composition. In some embodiments, this edible composition can be made into a food product or can be a food additive, that is, obtained by adding during the preparation of food ingredients by existing technical methods, or added during the production process of food products. Herein, the food product can be a product formulated with edible materials for human or animal consumption.
[0057] In some embodiments, the food product may be, but is not limited to: beverages, fermented foods, bakery products, health foods, and dietary supplements.
[0058] Example 1: Preparation of Sparassis crispa Extract
[0059] First, use the dried fruiting bodies of Sparassis crispa produced in the high-altitude fir forests in China as raw materials.
[0060] Next, perform the water extraction step. Using water as the solvent, after heating the water to reach 90 ± 5 °C (i.e., the specific temperature), add the Sparassis crispa raw materials. Among them, the weight ratio of the Sparassis crispa raw materials to water is 1:10. That is, after mixing the Sparassis crispa with water, extract at 90 ± 5 °C for 60 minutes (i.e., the specific time) to obtain the Sparassis crispa extract.
[0061] Subsequently, perform the filtration step. After the Sparassis crispa extract is cooled to room temperature, then pass the Sparassis crispa extract through a 400-mesh sieve and take the filtrate.
[0062] After that, perform the concentration step. Take the above filtrate and use a concentrator (brand / model: BUCHI–Rotavapor R-100) to perform vacuum concentration at a set temperature of 60 ± 5 °C until the Brix value of the solution is 10 ± 0.5, and then stop the concentration to obtain the concentrated solution, which is the Sparassis crispa extract.
[0063] Example 2: Test on the Promotion of GABA Secretion by Sparassis crispa Extract
[0064] The full name of GABA is γ-aminobutyric acid (Gamma-Aminobutyric Acid). When entering the deep sleep state, the GABA content in brain nerve cells will increase. Stabilizing the GABA content in the brain also helps with anti-depression and sleep. However, due to the existence of the blood-brain barrier, the efficiency of directly consuming GABA is very low. If the self-synthesis of nerve cells can be promoted, it can be unaffected by the blood-brain barrier.
[0065] At the same time, GABA can regulate the autonomic nerves, relieve tension, reduce stress, improve sleep quality, and also has functions such as promoting the secretion of growth hormone, strengthening skeletal muscles, enhancing immunity, and reducing fat. In this test, human brain nerve cells SH-SY5Y are used, and then the GABA ELISA Kit is used to detect the GABA content secreted by the cells to evaluate whether the Sparassis crispa extract can help increase the GABA secretion amount of brain nerve cells.
[0066] Description of Materials and Equipment:
[0067] Cell line: Human neuroblastoma cell (SH-SY5Y), obtained from the American Type Culture Collection (abbreviation: ATCC), preservation number Cat.CRL-2266, hereinafter referred to as nerve cells.
[0068] Cell culture medium: Dulbecco's Modified Eagle Medium (hereinafter referred to as DMEM medium) (Gibco, catalog number 12100-046) supplemented with 10% fetal bovine serum (FBS; Thermo, catalog number 10437-028) and 1% Penicillin-Streptomycin (Thermo, Cat. 15240062).
[0069] The Gamma-Aminobutyric Acid Detection Kit (ELISA Kit for Gamma-Aminobutyric Acid (gABA) Kit (CEA900Ge)) contains GABA.
[0070] Solvents: 1X DPBS (Gibco, Cat. 14200-075), cell lysis buffer (Thermo, Cat. FNN0011).
[0071] Test procedure:
[0072] First, seed the neural cells at a density of 1×10 4 into a 24-well cell culture plate, with each well containing 0.5 mL of cell culture medium, and culture in a carbon dioxide incubator at 37°C for 24 hours.
[0073] Divide the neural cells into an experimental group and a blank group. Remove the cell culture medium from each group and replace it with 500 μl / well of test medium, and then continue to culture at 37°C for 24 hours respectively.
[0074] The test medium for the experimental group is the cell culture medium containing 0.0625% of the Sparassis crispa extract obtained in Example 1.
[0075] The experimental medium for the blank group is pure cell culture medium.
[0076] After removing the supernatant from each group, wash the culture plate twice with 1X DPBS, add cell lysis buffer to lyse the cells. Centrifuge at 13,000 rpm at 4°C for 5 minutes, and collect the supernatant and store it in a 1.5 mL microcentrifuge tube. And process with the Gamma-Aminobutyric Acid Detection Kit to obtain the GABA content in each group, and the test results are as Figure 1 shown.
[0077] The GABA content shown in the figures is presented as a relative ratio. The standard deviation was calculated using the STDEV formula in Excel software, and a one-tailed Student t-test was performed in Excel software to analyze whether there were statistically significant differences. In the figures, "*" represents a p-value less than 0.05, and "**" represents a p-value less than 0.01. The more "*" there are, the more significant the statistical difference is.
[0078] Please refer to Figure 1 . The value of the blank group was regarded as 100%. Compared with the blank group, the GABA content of the experimental group was 124.6%, and there was a statistically significant difference between the experimental group and the blank group. In other words, Sparassis crispa extract can significantly promote the secretion of GABA by human nerve cells. Thus, it can be seen that Sparassis crispa extract can improve the sleep quality of humans.
[0079] Example 3: Test on the expression of mitochondrial-related genes by Sparassis crispa extract
[0080] Materials and instruments:
[0081] Cell line: Human skin fibroblast CCD-966Sk, obtained from the American Type Culture Collection (abbreviated as ATCC), preservation number Cat.CRL-1881, hereinafter referred to as skin fibroblasts.
[0082] Cell culture medium: 90% minimum essential medium (Eagle) in Earle's balanced salt solution (Earle's BSS) with additional components to contain 0.1 mM non-essential amino acid solution, 1.5 g / L sodium bicarbonate, 1 mM sodium pyruvate, and 10% fetal bovine serum (hereinafter referred to as FBS) (purchased from Gibco).
[0083] RNA extraction reagent kit, purchased from Genemark.
[0084] III reverse transcriptase, purchased from Invitrogene.
[0085] ABI StepOnePlusTM Real-Time PCR system, purchased from Thermo Fisher Scientific.
[0086] KAPA SYBR FAST qPCR Master Mix(2X) Kit, purchased from KAPA Biosystems, product number KK4600.
[0087] Test procedure:
[0088] Inoculate dermal fibroblasts at a density of 1×10 5 cells per well into a 6-well culture plate containing 2 mL of medium per well and culture at 37 °C for 48 hours.
[0089] After culturing, divide the dermal fibroblasts into several blank groups and experimental groups to compare the differential gene expressions. Among them, the culture medium of the blank group does not contain any extract, and the culture medium of the experimental group contains 0.0625% Sparassis crispa extract prepared in Example 1. Each group is triplicated and cultured at 37 °C for 24 hours.
[0090] Remove the culture media of the blank and experimental groups after culturing and rinse with PBS.
[0091] After rinsing, break the cell membranes of HPEK-50 cells in each group with the cell lysate of the RNA extraction reagent kit to form cell solutions.
[0092] Use the RNA extraction reagent kit to extract RNA from the cell solutions of each group respectively.
[0093] Take 2000 nanograms (ng) of the extracted RNA from each group as a template and reverse transcribe the extracted RNA into the corresponding cDNA by III reverse transcriptase.
[0094] Use ABI StepOnePlus TM Real-Time PCR system, and perform quantitative real-time reverse transcription polymerase chain reaction on the cDNA with KAPA SYBR FAST qPCR Master Mix(2X) Kit and the primer combinations in Table 1 to observe the expression levels and melting curves of various target genes in HPEK-50 cells of the blank and experimental groups. The instrument settings for the quantitative real-time reverse transcription polymerase chain reaction are 20 seconds at 95 °C, 3 seconds at 95 °C, 30 seconds at 60 °C, and repeat 40 cycles.
[0095] Use 2 -ΔΔCtMethod for determining the relative expression level of a target gene. The so-called relative expression level is defined as the fold change of the RNA expression level of the target gene in the experimental group relative to the RNA expression level of the same gene in the blank group. 2 -ΔΔCt The method uses the cycle threshold of the TBP gene as the cycle threshold (Ct) of the reference gene for internal control, and calculates the fold change according to the following formula:
[0096] △Ct = Ct 实验组之目标基因 / 空白组之目标基因 - Ct GAPDH
[0097] △△Ct = △Ct 实验组之目标基因 - △Ct 空白组之目标基因
[0098] Fold change = 2 -ΔΔCt平均值
[0099] Table 1
[0100] Primer Name Sequence Number Sequence CCT5-F SEQ ID NO:1 CGGATAAGTGCCCCACCTTA CCT5-R SEQ ID NO:2 TCCAGTGCGTCGGCAAA CCT7-F SEQ ID NO:3 GTGGCATGGACAAGCTTATTGTAG CCT7-R SEQ ID NO:4 CAGAATTGTGGCCCCATCA Pink1-F SEQ ID NO:5 CTGTGGTGGCTAGTGCTCCT Pink1-R SEQ ID NO:6 TCCAGACGTGAGACAGTTGG Parkin-F SEQ ID NO:7 GCAGAGACCGTGGAGAAAAG Parkin-R SEQ ID NO:8 CTTTTCTCCACGGTCTCTGC Atg1-F SEQ ID NO:9 CAGGAGGACGAGAACACGGTGTC Atg1-R SEQ ID NO:10 GGAAGGTTCTTTGGCACCAGCAC Atg8-F SEQ ID NO:11 TATCCAGACCGTGTGCCCGTC Atg8-R SEQ ID NO:12 GTGGATGCGCTTGCGAATGAGG SIRT1-F SEQ ID NO:13 TAGCCTTGTCAGATAAGGAAGGA SIRT1-R SEQ ID NO:14 ACAGCTTCACAGTCAACTTTGT FOXO-F SEQ ID NO:15 CGGACAAACGGCTCACTCT FOXO-R SEQ ID NO:16 GGACCCGCATGAATCGACTAT PARP1-F SEQ ID NO:17 AGCGTGTTTCTAGGTCGTGG PARP1-R SEQ ID NO:18 CATCAAACATGGGCGACTGC SOD3-F SEQ ID NO:19 AGCTGGAAAGGTGCCCGA SOD3-R SEQ ID NO:20 CTTGGCGTACATGTCTCGGAT
[0101] Herein, the statistically significant difference between the measurement results of the blank group and the experimental group is obtained by statistical analysis of the student t-test. (In the figure, "*" represents that the p-value is less than 0.05 compared with the blank group, "**" represents that the p-value is less than 0.01 compared with the blank group, and "***" represents that the p-value is less than 0.001 compared with the blank group. The more "*", the more significant the statistical difference).
[0102] For the test results, please refer to Figure 2 . The skin fibroblasts in the blank group were not treated with anything, that is, under normal physiological metabolism, the gene expression level was set to 1.0. The expression level of the CCT5 gene in the CCT5 gene experimental group was 1.8 times that of the blank group, and the expression level of the CCT7 gene in the CCT7 gene experimental group was 2 times that of the blank group. It can be seen that after treatment with Sparassis crispa extract, the expression levels of the CCT5 gene and the CCT7 gene can be significantly increased, thereby promoting mitochondrial activity.
[0103] For the test results, please refer to Figure 3 . The skin fibroblasts in the blank group were not treated with anything, that is, under normal physiological metabolism, the gene expression level was set to 1.0. The expression level of the Pink1 gene in the Pink1 gene experimental group was 2.02 times that of the blank group, and the expression level of the Parkin gene in the Parkin gene experimental group was 2.05 times that of the blank group. It can be seen that after treatment with Sparassis crispa extract, the expression levels of the Pink1 gene and the Parkin gene can be significantly increased, thereby activating the cell energy source and delaying the state of cell aging.
[0104] Please refer to the test results Figure 4 The skin fibroblasts in the blank group were not treated at all. That is to say, under normal physiological metabolism, the expression level of its genes was set to 1.0. The expression level of the Atg1 gene in the Atg1 gene experimental group was 1.8 times that of the blank group, and the expression level of the Atg8 gene in the Atg8 gene experimental group was 1.6 times that of the blank group. It can be seen that after treatment with Sparassis crispa extract, the expression levels of the Atg1 gene and the Atg8 gene can be significantly increased, thereby enhancing the cell repair ability.
[0105] Please refer to the test results Figure 5 The skin fibroblasts in the blank group were not treated at all. That is to say, under normal physiological metabolism, the expression level of its genes was set to 1.0. The expression level of the SIRT1 gene in the SIRT1 gene experimental group was 3.5 times that of the blank group, the expression level of the FOXO gene in the FOXO gene experimental group was 2.6 times that of the blank group, the expression level of the PARP1 gene in the PARP1 gene experimental group was 0.8 times that of the blank group, and the expression level of the SOD3 gene in the SOD3 gene experimental group was 2.1 times that of the blank group. It can be seen that after treatment with Sparassis crispa extract, the expression levels of the SIRT1 gene, the FOXO gene and the SOD3 gene can be significantly increased to extend the cell lifespan, and the expression level of the PARP1 gene is inhibited to enhance mitochondrial activity.
[0106] It can be seen from this that Sparassis crispa extract can significantly increase the expression levels of the ATG1 gene, the ATG8 gene, the CCT5 gene, the CCT7 gene, the Pink1 gene, the Parkin gene, the SIRT1 gene, the FOXO gene and the SOD3 gene, and inhibit the expression level of the PARP1 gene.
[0107] Example 4: Human test of Sparassis crispa extract
[0108] Subjects: 8 subjects. Among them, each subject was an adult over 20 years old.
[0109] Test items: Skin laxity, expression levels of the SIRT1 gene, FOXO gene and SOD3 gene in blood, GABA content in blood, skin questionnaire, sleep questionnaire.
[0110] Among them, for skin laxity, a skin elasticity detection probe purchased from Courage+Khazaka electronic company in Germany was used MPA580 (C+K Multi Probe Adapter System, Germany) detects the facial skin of the same subject before and after drinking. The test principle is based on the suction and stretching principle. A negative pressure is generated on the surface of the tested skin to suck the skin into a test probe, and the depth of the skin sucked into the probe is detected through an optical test system, and the skin laxity is analyzed and calculated by software.
[0111] Among them, human peripheral blood mononuclear cells PBMC are separated from the blood of the subjects, and then the expression levels of SIRT1 gene, FOXO gene, and SOD3 gene are measured.
[0112] Among them, the content of GABA in the blood is detected by Dajiang Gene.
[0113] Among them, the skin questionnaire is a self-assessment for two items: skin laxity and skin dryness. The selection is made among five options: none, mild, obvious, severe, and very severe. Then the options are converted into scores for expression. None is 1 point, mild is 2 points, obvious is 3 points, severe is 4 points, and very severe is 5 points. Then the score after taking is subtracted from the score before taking, and then divided by the score before taking and converted into a percentage.
[0114] Among them, the sleep questionnaire is a self-assessment for two items: light sleep degree and dreaminess degree. The selection is made among five options: none, mild, obvious, severe, and very severe. Then the options are converted into scores for expression. None is 1 point, mild is 2 points, obvious is 3 points, severe is 4 points, and very severe is 5 points. Then the score after taking is subtracted from the score before taking, and then divided by the score before taking and converted into a percentage.
[0115] Test method:
[0116] Let 8 experimental group subjects eat the Sparassis crispa aqueous extract prepared in Example 1, including 0.35 grams, continuously for 4 weeks.
[0117] The data measured before eating (i.e., the 0th week) is called the blank group, and the data measured after 4 weeks of eating (i.e., the 4th week) is called the experimental group.
[0118] Test results:
[0119] The relative values of each group were calculated by taking the average of all subjects in the following figures and considering the data at week 0 as 100% or 1. Among them, the standard deviation was calculated using the STDEV formula in Excel software, and a one-tailed Student t-test was performed in Excel software to analyze whether there were statistically significant differences to obtain the p-value. And in the figure, "*" indicates that the p-value is less than 0.05.
[0120] Please refer to Figure 6 . In the blank group, it means that the subjects did not consume Sparassis crispa extract, that is, under normal physiological metabolism, the average gene expression level was set to 1.0. Among the 8 subjects, 3 had poor RNA extraction quality, resulting in experimental data errors, so they were excluded. Here, among the remaining 5 subjects, 3 had improved gene expression levels, that is, the proportion of improved subjects was 60%. After 4 weeks (experimental group) of consuming Sparassis crispa extract, the average SIRT1 gene expression level of the 5 experimental group subjects increased by 32.2 times compared to week 0 (blank group). After 4 weeks (experimental group) of consuming Sparassis crispa extract, the average FOXO gene expression level of the 5 experimental group subjects increased by 92.0 times compared to week 0 (blank group). After 4 weeks (experimental group) of consuming Sparassis crispa extract, the average SOD3 gene expression level of the 5 experimental group subjects increased by 111.3 times compared to week 0 (blank group).
[0121] Please refer to Figure 7 . After 4 weeks of daily consumption of Sparassis crispa extract, 2 subjects had severe skin peeling, resulting in experimental data errors due to blocked detection probes, so they were excluded. Here, among the remaining 6 subjects, 5 had reduced skin laxity, that is, the proportion of improved subjects was 83.3%. The average skin laxity of the 6 experimental group subjects decreased from 100% (blank group) at week 0 to 89.0% (experimental group). That is, Sparassis crispa extract can help tighten the skin.
[0122] Please refer to Figure 8 . After 4 weeks of daily consumption of Sparassis crispa extract, among the 8 subjects, 6 had increased GABA content in the blood, that is, the proportion of improved subjects was 62.5%. The average GABA content in the blood of the 8 experimental group subjects increased from 0.04 pg / mL (blank group) at week 0 to 0.16 pg / mL (experimental group), an average increase of four times.
[0123] Please refer to Figure 9 . After 4 weeks of daily consumption of Sparassis crispa extract, among the 8 subjects, 6 self-evaluated that their skin laxity had improved, that is, the proportion of improved subjects was 62.5%. Continue to refer to Figure 9The scores of the 8 subjects in the experimental group for self-assessing the severity of skin laxity were totaled and averaged. When this average score was divided by the average total score in the initial state (week 0) and converted into a percentage, it was found that the severity had decreased by 25.0%.
[0124] After 4 weeks of daily consumption of Sparassis crispa extract, 6 out of the 8 subjects self-assessed that their skin dryness had improved. That is, the proportion of subjects with improvement was 62.5%. Continue to refer to Figure 9 The scores of the 8 subjects in the experimental group for self-assessing the severity of skin dryness were totaled and averaged. When this average score was divided by the average total score in the initial state (week 0) and converted into a percentage, it was found that the severity had decreased by 29.2%.
[0125] Please refer to Figure 10 After 4 weeks of daily consumption of Sparassis crispa extract, 6 out of the 8 subjects self-assessed that their frequent dreaming at night had improved. That is, the proportion of subjects with improvement was 75.0%. Continue to refer to Figure 10 The scores of the 8 subjects in the experimental group for self-assessing the severity of frequent dreaming were totaled and averaged. When this average score was divided by the average total score in the initial state (week 0) and converted into a percentage, it was found that the severity had decreased by 31.3%.
[0126] After 4 weeks of daily consumption of Sparassis crispa extract, 6 out of the 8 subjects self-assessed that their light sleep at night had improved. That is, the proportion of subjects with improvement was 75.0%. Continue to refer to Figure 10 The scores of the 8 subjects in the experimental group for self-assessing the severity of light sleep were totaled and averaged. When this average score was divided by the average total score in the initial state (week 0) and converted into a percentage, it was found that the severity had decreased by 36.7%.
[0127] In summary, the Sparassis crispa extract of any embodiment can be used to prepare a composition for improving sleep quality, improving mitochondrial performance, promoting cell damage repair, or firming the skin of the recipient. In some embodiments, the Sparassis crispa extract may have at least one of the following effects: increasing the content of gamma-aminobutyric acid (GABA), helping with nerve relaxation, increasing the activity of mitochondria in cells, extending cell lifespan, regulating autophagy of mitochondria in cells, regulating the ATG1 gene, ATG8 gene, CCT5 gene, CCT7 gene, Pink1 gene, Parkin gene, SIRT1 gene, FOXO gene, PARP1 gene, and SOD3 gene in human cells, improving the loose state of the skin of the recipient, and improving the dry state of the skin of the recipient.
[0128] Of course, the present invention may have many other embodiments. Without departing from the spirit and essence of the present invention, those skilled in the art can make various corresponding changes and deformations according to the present invention. However, these corresponding changes and deformations should all fall within the protection scope of the claims of the present invention.
Claims
1. Use of a Sparassis crispa extract for preparing a composition for reducing light sleep and / or dreamy conditions, wherein the Sparassis crispa extract is obtained by extracting Sparassis crispa with water as a solvent.
2. The use according to claim 1, wherein the Sparassis crispa extract is used to increase the content of gamma-aminobutyric acid (GABA).
3. The use according to claim 1, wherein the Sparassis crispa extract helps to relax nerves.
4. Use of a Sparassis crispa extract for preparing a composition for improving mitochondrial performance, wherein the Sparassis crispa extract is obtained by extracting Sparassis crispa with water as a solvent.
5. The use according to claim 4, wherein the Sparassis crispa extract is used to increase the activity of mitochondria in cells.
6. The use according to claim 4, wherein the Sparassis crispa extract is used to extend cell lifespan.
7. The use according to claim 4, wherein the Sparassis crispa extract is used to regulate autophagy of mitochondria in cells.
8. The use according to claim 4, wherein the Sparassis crispa extract is used to regulate the expression levels of genes related to mitochondrial performance in human cells, and the genes related to mitochondrial performance are at least one of the following: CCT5 gene, CCT7 gene, Pink1 gene, Parkin gene, SIRT1 gene, FOXO gene, PARP1 gene, and SOD3 gene.
9. Use of a Sparassis crispa extract for preparing a composition for promoting cell damage repair, wherein the Sparassis crispa extract is obtained by extracting Sparassis crispa with water as a solvent.
10. The use according to claim 9, wherein the Sparassis crispa extract is used to regulate autophagy of cells.
11. The use according to claim 9, wherein the Sparassis crispa extract is used to increase the expression level of ATG1 gene and / or ATG8 gene.
12. The use according to claim 9, wherein the Sparassis crispa extract is used to increase the content of gamma-aminobutyric acid.
13. Use of a Sparassis crispa extract for preparing a composition for tightening the skin of a recipient, wherein the Sparassis crispa extract is obtained by extracting Sparassis crispa with water as a solvent.
14. The use according to claim 13, wherein the Sparassis crispa extract is used to improve the flabby state of the skin of the recipient.
15. The use according to claim 13, wherein the Sparassis crispa extract is used to improve the dry state of the skin of the recipient.
16. The use according to any one of claims 13 to 15, wherein the Sparassis crispa extract is obtained from the fruiting body of Sparassis crispa.
17. The use according to any one of claims 13 to 15, wherein the Sparassis crispa extract is obtained by leaching Sparassis crispa in the water at 90 ± 5°C for 60 minutes.