Nanometer material based on engineering probiotic loading as well as preparation method and application of nanometer material

Abstract

The invention belongs to the field of medicine, provides a bioglass nano material based on engineering probiotic loading, and particularly relates to an anti-tumor probiotic carrier modified nano material which has tumor microenvironment response to promote tumor cell ICD effect and enhance DC cell antigen presentation effect. The probiotic-loaded nano material is constructed on the basis of tumor acidic microenvironment response nano particles and an engineering probiotic carrier, a bioglass material is connected to probiotics through glycometabolism engineering and biological orthogonal coupling, the bioglass material is released in a slightly acidic environment and initiates a Fenton reaction, and the tumor acidic microenvironment response nano particles and the engineering probiotic carrier are combined to form the probiotic-loaded nano material, so that the tumor acidic microenvironment response nano particles and the engineering probiotic carrier are combined to form the probiotic-loaded nano material. The death of immunogenic cells in tumors is increased; and the antigens are released, so that efficient and lasting anti-tumor immunotherapy is finally realized.

Description

Technical Field

[0001] The present invention belongs to the field of medicine and provides a bioglass nanomaterial based on engineered probiotic loading, in particular, a nanomaterial modified with an anti-tumor probiotic carrier that has a tumor microenvironment response, promotes the ICD effect of tumor cells, and enhances DC cell antigen presentation, and further discloses its preparation method and application. Background Art

[0002] In recent decades, various tumor-targeting microorganisms, such as Bacillus Calmette-Guérin, anaerobic / facultative anaerobic bacteria, and oncolytic viruses, have been used as delivery vehicles for tumor-specific drugs or as direct therapeutic agents themselves. Based on the unique tumor microenvironment (TME) within solid tumors, these relatively safe bacteria (such as Bifidobacterium, Escherichia coli, and Salmonella typhimurium) are able to specifically colonize tumor tissue and exert tumor-specific therapeutic effects.

[0003] However, single-microbial therapies often result in various adverse side effects, such as severe infections, which limit further clinical research. Therefore, nanomedicines constructed by leveraging the natural hypoxia tropism of anaerobic or facultative anaerobic bacteria for tumor-targeted therapy have shown remarkable efficacy in multimodal cancer treatment. These composite nanomedicines, combining specific microorganisms with nanomaterials, exhibit the advantages of microbial therapy while minimizing adverse side effects and without damaging normal tissues. This novel "microbial nanomedicine" has broad application potential in tumor-specific treatment.

[0004] Currently, the main microorganisms used for tumor treatment include attenuated Escherichia coli, Bifidobacterium, Listeria monocytogenes, etc. However, attenuated microorganisms often show a reduced ability to colonize tumors, which reduces the concentration of drug delivery and increases the risk of infection. Currently, Lactobacillus is mostly used as an immunomodulator, which regulates the intestinal microbial environment after oral administration to assist in the treatment of tumors. However, this method of drug delivery may reduce the concentration through the first-pass effect in the liver, thereby reducing the therapeutic effect. Existing bacterial drug delivery methods all have a limited drug release period, require multiple administrations, and are prone to causing side effects such as infection.

[0005] Lactic acid bacteria (LAB) are facultative anaerobic bacteria that have long been used safely as probiotics in food production and processing. In recent years, the application of LAB has expanded beyond the food industry to include the chemical, pharmaceutical, and medical sectors. LAB can produce antimicrobial peptides or bacteriocins during metabolism, showing therapeutic potential in the treatment of intestinal infections, inflammation, liver disease, intestinal syndromes, and even cancer.

[0006] The development of tumor vaccines based on dendritic cells (DCs) has attracted considerable attention in recent years and has become a key branch of innovative tumor vaccine research and development with the greatest potential. DCs have the ability to regulate both innate and adaptive immunity, maintaining immune homeostasis while rapidly promoting robust immune responses within the tumor microenvironment (TME) and at sites of viral infection. In the anti-tumor immune response, circulating DCs capture tumor antigens, enter secondary lymphoid organs, and promote the proliferation and maturation of DCs, T cells, and B cells, thereby transforming "cold tumors" into "hot tumors."

[0007] The recruitment, maturation, differentiation, and activity of DCs within tumor tissues are important prerequisites for improving anti-tumor immunity and enhancing prognosis. Studies have shown that tumor-infiltrating NK cells can recruit cDC1s by secreting CCL5 and XC-type chemokine ligand 1 (XCL1); at the same time, tumor-infiltrating lymphocytes in the TME, such as NK cells, secrete FLT3L, which promotes the in situ proliferation and differentiation of cDCs and enhances their survival. Therefore, the distribution and activity of DCs chemokines in the TME, as well as the migration ability of DCs, are the basis for determining whether DCs can initiate innate and adaptive immunity and achieve multifunctional immune regulation. However, immunosuppressive factors in the TME and special immune escape mechanisms within tumor cells inhibit the recruitment, proliferation, differentiation, and survival of normal DCs into tumor tissues. For example, prostaglandin E2 (PGE2) secreted by tumor cells can inhibit NK cell activity and the secretion of proinflammatory chemokines, thereby inhibiting the recruitment of DCs into the tumor. Tumor-derived vascular endothelial growth factor (VEGF) can inhibit FLT3L activity and suppress DC differentiation, while IL-6 secreted by tumor cells and immune cells can inhibit the differentiation of cDCs into moDCs. Furthermore, overexpression of T cell immunoglobulin mucin receptor 3 (TIM3) inhibits the ability of HMGB1 to recruit tumor nucleic acids to DC endosomes. At the same time, tumor cells overexpress CD47 to evade recognition of tumor mitochondrial DNA by SIRPα protein in cDC2s, thereby hindering DC activity and antigen presentation capacity. Therefore, increasing tumor cell antigen release and enhancing the antigen presentation capacity of DCs within the tumor are prerequisites for improving anti-tumor immunity.

[0008] In recent years, studies have demonstrated the presence of bacteria in tumors and the immunomodulatory effects of the microbiome, indicating that tumor tissue is a complex of bacteria interacting with tumor cells and the host. With the in-depth understanding of TME by technicians and the rapid development of microbiology, nanotechnology and recombinant DNA technology, combined with the unique tumor targeting, immune activation characteristics and metabolic characteristics of bacteria, the acquisition of reprogrammed bacteria has made bacterial therapy a new hot spot in current cancer research and treatment. Based on the unique immunosuppressive microenvironment inside solid tumors, attenuated bacteria (Bifidobacterium, Escherichia coli, Salmonella typhimurium, etc.) can specifically colonize in tumor tissues and exert anti-tumor effects, while other tissues and organs outside the tumor will inhibit the survival of bacteria due to their normal immune microenvironment, thereby ensuring the safety of bacterial anti-tumor therapy. In recent years, the use of the hypoxic tropism of anaerobic or facultative anaerobic bacteria for tumor targeted therapy has attracted attention in multimodal cancer treatment. This new type of "microbial nanomedicine" has broad application potential in the development of tumor vaccines.

[0009] However, although DCs-based anti-tumor vaccines can induce significant T cell responses, they have not had significant clinical effects in most studies, and their clinical translation still faces urgent problems:

[0010] (1) Limited number of DCs and weak migration ability: In practical applications, autologous DCs transplantation immunotherapy involves isolating DCs and monocytes from the patient's peripheral blood, activating and amplifying them in vitro under the induction of exogenous cytokines (GM-CSF, IL-4 / MAFB, FLT3L, etc.), and then returning them to the patient. Although adoptive cell therapy of DCs loaded with adjuvants / antigens has advantages such as specific DCs subset targeting and controllable adjuvant / antigen co-delivery, the preparation process is cumbersome, time-consuming, and costly. In addition, DCs derived from tumor patients themselves have functional abnormalities, which limits the effective number of DCs cells delivered and their ability to home to lymphoid organs, thereby reducing the anti-tumor efficacy.

[0011] (2) Lack of effective antigens: Although immune adjuvants or antigen carrier delivery systems targeting DCs (such as antibody-coupled nanomaterials) have specific DC targeting and can enhance antigen cross-presentation ability, the effects of the carrier on DCs and the nonspecificity of the antigen limit their clinical application.

[0012] (3) In vitro induced DCs subtypes affect anti-tumor efficiency: naturally formed DC subpopulations have higher MHC molecule expression and functionalization than in vitro generated MoDCs, and therefore have stronger antigen presentation capabilities. Recent studies have shown that CD5 on the surface of DCs can promote the activation and proliferation of effector T cells, affecting the expression of CD5 on the surface of T cells, thereby affecting the effect of ICB therapy. However, the infusion of autologous MoDCs for anti-tumor therapy requires in vitro induction, and the limited DCs subtypes produced will limit its anti-tumor effect. Therefore, recruiting DCs and promoting their maturation, proliferation and differentiation through in situ stimulation of the tumor is an important strategy to improve DCs anti-tumor immunity.

[0013] (4) Tumor immunosuppressive microenvironment inhibits chemotaxis, proliferation and activation of DCs: The immune, metabolic and hypoxic characteristics of TME lead to the formation of immunosuppressive microenvironment, and the antigen presentation ability of DCs is affected by factors such as antigen loss or immunosuppressive mediators / cytokines. Immunosuppressive cells and cytokines in the immunosuppressive microenvironment, such as tumor-associated macrophages (TAMs), regulatory T cells (Tregs), myeloid-derived suppressor cells (MDSCs), TGF-β and PD-L1, inhibit NK cell function and reduce their ability to secrete DC chemokines, severely inhibiting tumor infiltration, maturation and activation of DCs.

[0014] Therefore, the main limitations of DCs-based anti-tumor vaccines for solid tumor treatment are insufficient tumor antigen content in the tumor's immunosuppressive microenvironment, insufficient DCs infiltration, and low survival. Therefore, the field is looking forward to constructing a class of naturally non-toxic Lactobacillus carriers that secrete cytokines and chemokines in response to the tumor microenvironment, and further developing more effective DCs-based in situ tumor vaccines. These have important application value in improving the efficacy of immunotherapy and provide a research foundation for promoting the clinical translation and application of DCs immunotherapy. Summary of the Invention

[0015] To this end, the technical problem to be solved by the present invention is to provide a bioglass nanomaterial based on engineered probiotic loading to achieve the release of nanoparticles in response to acidity in the tumor microenvironment. At the same time, the probiotics can express DC cell chemotactic factors under acid induction, thereby achieving the induction of tumor cell death in situ, enhancing DC cell antigen presentation, and enhancing the anti-tumor immune response effect in situ.

[0016] The second technical problem to be solved by the present invention is to provide a construction method and application of the above-mentioned bioglass nanomaterial modified by engineered probiotics;

[0017] The third technical problem to be solved by the present invention is to provide an engineered probiotic transformed by gene recombination technology so as to enable it to have the ability to secrete DC cell chemotactic factors.

[0018] To solve the above technical problems, the present invention provides a method for preparing a nanomaterial loaded with engineered probiotics, comprising the following steps:

[0019] (1) culturing the engineered probiotics in a culture medium containing N3-D-Ala to obtain N3-labeled probiotics;

[0020] (2) Collect the N3-labeled probiotics cultured above, add them into bioglass material for mixing reaction, and obtain.

[0021] Specifically, in the method for preparing nanomaterials modified with engineered probiotics, in step (1), the engineered probiotics include a Lactobacillus carrier that responds to the tumor microenvironment, and the Lactobacillus carrier expresses and secretes cytokines or chemokines;

[0022] Preferably, the lactobacillus vector contains a tumor microenvironment responsive expression plasmid lactobacillus vector;

[0023] Preferably, in the Lactobacillus vector, the tumor microenvironment response expression plasmid contains a specific promoter, a target gene and a secretory peptide;

[0024] Preferably, the specific promoter is selected from any one of a hypoxia-responsive promoter, a low pH-responsive promoter, a lactate promoter, and a H2O2-responsive promoter.

[0025] Specifically, in the method for preparing the nanomaterial modified by the engineered probiotics, in the step (1), in the bacterial cell culture step, the N3-D-Ala is added at a concentration of 30-80 nM based on the culture medium;

[0026] Preferably, the culture medium comprises MRS medium;

[0027] Preferably, the temperature of the bacterial cell culture step is 35-38°C.

[0028] Specifically, in the method for preparing nanomaterials modified by engineered probiotics, in step (2), the bioglass material is DBCO-Fe3O4_Au obtained by amide reaction using DBCO-NHS and Fe3O4_Au as raw materials;

[0029] Preferably, the molar ratio of DBCO-NHS to Fe3O4_Au is 1:1-2:1.

[0030] Specifically, in the method for preparing nanomaterials modified with engineered probiotics, in step (2), in the mixing reaction:

[0031] The concentration of the N3-labeled probiotics is 3-8×10 9 CFU / ml;

[0032] The concentration of the bioglass material is 0.2-0.3 mg / ml.

[0033] Specifically, in the method for preparing the nanomaterial modified by engineered probiotics, in the step (1), the Lactobacillus vector containing the tumor microenvironment response expression plasmid is selected from any one of plasmid pVE5523, plasmid pMG36e or plasmid pNZ8148;

[0034] Preferably, the hypoxia-responsive promoter includes the hypoxia-responsive promoter NirB, and the nucleic acid molecule encoding the NirB includes the sequence shown in SEQ ID NO.1;

[0035] SEQ ID NO.1:

[0036] caggtaaatttgatgtacatcaaatggtaccccttgctgaatcgttaaggtaggcggtataaggaggaaaaaac;

[0037] Preferably, the low pH responsive promoter includes pLipF or pCadC, and the nucleic acid molecule encoding the low pH responsive promoter pCadC includes the sequence shown in SEQ ID NO.2;

[0038] SEQ ID NO.2:

[0039] gtaactccgggttgatttatgctcggaaatatttgttgttgagtttttgtatgttcctgttggtataatatgttgcggcaatttatttgccgcataatttttattacataaatttaaccagagaatgtcacgcaatccattgtaaacattaa atgtttatcttttcatgatatcaacttgcgatcctgatgtgttaataaaaaacctcaagttctcacttacagaaacttttgtgttatttcacctaatctttaggattaatccttttttcgtgagtaatcttatcgccagtttggtctggtca;

[0040] Preferably, the lactic acid promoter includes pLldR or pLldP, and the nucleic acid molecule encoding the lactic acid promoter pLldP includes the sequence shown in SEQ ID NO.3;

[0041] SEQ ID NO.3:

[0042] ctttaccagacatctccccccacaagaattggccctaccaattcttcgcttatctgacctctggttcacaatttcccaattaaaactcacatcaatgttgccaatacataacatt tagttaaccattcattgtcattatccctacacaacacaattggcagtgccacttttacacaacgtgtgacaaggagatgagcaacagactcattacacgatgtgcgtggactcc;

[0043] Preferably, the H2O2 responsive promoter comprises PkatG;

[0044] Preferably, the secretory peptide is secretory peptide USP45, and the amino acid sequence encoding the secretory peptide USP45 includes SEQ ID NO.4;

[0045] SEQ ID NO.4: MVDSKKVLSVTAGFVGAAGLAALATGANTVSA;

[0046] Preferably, the target gene is a gene encoding a cytokine or chemokine, and a specific tag is fused to the C-terminus of the target gene;

[0047] Preferably, the specific tag includes any one of 3×Myc, 3×Flag, 6×His, EGFP or mCharry.

[0048] The types of cytokines or chemokines described in the present invention include: interleukins (Interleukins 1-12 (IL1-IL12)), tumor necrosis factors (Tumour necrosis factors α (TNF-α, TNF-β), interferons (Interferons α (IFN-α), IFN-β, IFN-γ), colony stimulating factors (Colony stimulating factors) G-CSF, GM-CSF, M-CSF, Erythropoietin), CC-type chemokines (CCL1-CCL28), C-type chemokines (XCL1, XCL2), CXC-type chemokines (CXCL1-CXCL17) CX3C-type chemokines (CX3CL1), etc.

[0049] The probiotics selected in the present invention, Lactobacillus, are used as drug delivery vehicles to reduce the risk of infection caused by the side effects of bacterial drug delivery. The plasmid selected in the present invention is transformable, and the method of the present invention can be applied to combine promoters of different responses and different functional cytokines or chemokines to achieve the expression and secretion of different functional genes under different driving environments. The lactobacillus in the present invention can colonize and proliferate in the tumor microenvironment, and can continuously express and secrete cytokines or chemokines under specific conditions, thereby achieving long-term release of drugs and avoiding the complexity and toxic side effects of multiple administrations.

[0050] Specifically, the method for preparing the nanomaterial modified with engineered probiotics, in step (1), further includes the step of constructing the Lactobacillus vector containing the tumor microenvironment-responsive expression plasmid, comprising the following steps:

[0051] (1) Constructing a tumor microenvironment-responsive expression plasmid according to the selected gene structure;

[0052] (2) introducing the plasmid constructed in step (1) into Lactobacillus by electroporation to obtain the Lactobacillus vector having tumor microenvironment response;

[0053] Preferably, in step (1), the nucleic acid molecule encoding the cytokine or chemokine and the nucleic acid molecule encoding the specific promoter and secretory peptide USP45 are constructed into a lactobacillus expression plasmid by homologous recombination;

[0054] Preferably, in step (2), the conditions for the electroporation are: electric shock intensity 7.5-12.5 kV / cm, electric shock times 6-10 times, and interval time 100-1000 ms.

[0055] The present invention provides a method for constructing a Lactobacillus vector that expresses and secretes specific cytokines or chemokines in response to the tumor microenvironment (including but not limited to hypoxia response, low pH response, lactate response, and H2O2 response, etc.), so as to achieve in situ expression and secretion of cytokines or chemokines in tumors.

[0056] The present invention provides an engineering construction method for the lactobacillus vector, which comprises first constructing the gene of a specific cytokine or chemokine, a specific promoter, and a secretory peptide into a lactobacillus expression plasmid by homologous recombination, and then introducing the constructed plasmid into the lactobacillus genome by electroporation to construct a lactobacillus strain that responds to the tumor microenvironment and stably expresses the specific cytokine or chemokine.

[0057] The plasmid provided by the present invention, which is constructed based on the lactobacillus vector and has tumor microenvironment-responsive expression and secretion of the target protein, can also be constructed with plasmids with specific expression of bacteria of other species by replacing the basic vector skeleton. Therefore, the construction of other species of tumor microenvironment-responsive engineered bacteria (attenuated Salmonella, Escherichia coli, Bifidobacterium, Lactococcus lactis and cyanobacteria, etc.) by replacing the basic plasmid skeleton is also within the scope of protection of the present invention.

[0058] The invention also discloses a nanomaterial modified based on engineered probiotics prepared by the method.

[0059] The present invention also discloses the use of the nanomaterial modified with engineered probiotics for preparing anti-tumor drugs, anti-inflammatory drugs, drugs for treating nervous system diseases and / or drugs for treating cardiovascular and cerebrovascular diseases.

[0060] The present invention also discloses a pharmaceutical composition, characterized in that the pharmaceutical composition comprises the nanomaterial modified based on the engineered probiotics.

[0061] The present invention utilizes the characteristics of natural lactobacillus "probiotics" to construct a class of "natural non-toxic" lactobacillus drug carriers, which utilizes its own immunogenic characteristics to promote immunogenic cell death (ICD) of tumor cells to achieve tumor antigen release; through gene editing, lactobacillus has the ability to express specific cytokines or chemokines in response to the tumor microenvironment, thereby achieving the in situ release of drugs on tumors and promoting DCs, CD4 + and CD8 + T lymphocyte maturation and proliferation enhance the anti-tumor immune response at the tumor site, reduce the toxic side effects of drugs, and reduce the risk of infection caused by the side effects of bacterial drug delivery.

[0062] The present invention utilizes the characteristics of natural lactobacillus "probiotics", combines the hypoxia characteristics in the tumor microenvironment, and uses DNA recombination technology to construct a probiotic that has hypoxia-responsive expression and secretion of DCs chemokine XCL-1. As a natural tumor-targeting carrier, the engineered probiotic can colonize in the tumor tissue and infiltrate the hypoxic zone in the center of the tumor under the drive of the hypoxia signal of the tumor tissue and the inhibitory immune microenvironment. The hypoxic environment in the tumor tissue can induce the engineered probiotic to express and secrete the DCs chemokine XCL1, induce DCs to enter the tumor tissue, and mature and proliferate under the stimulation of tumor antigens, thereby increasing their ability to present antigens. The activated DCs can present tumor antigens to T cells, promote T cell maturation and secrete proinflammatory factors, and enhance the anti-tumor immune response ability.

[0063] The Lactobacillus carrier constructed by the present invention can colonize and proliferate at the tumor site by utilizing its anaerobic tropism. It can also continuously express and secrete cytokines or chemokines under specific conditions. This expression and secretion of cytokines or chemokines in situ promotes the maturation and proliferation of DCs and T lymphocytes, enabling the function of an in situ tumor vaccine and achieving an anti-tumor immune response. It can also achieve long-term drug release, avoiding the complexity and toxic side effects of multiple drug administrations. The Lactobacillus carrier described in the present invention is also suitable for treating various inflammatory conditions, neurological diseases such as Alzheimer's disease, and cardiovascular and cerebrovascular diseases.

[0064] The lactobacillus vector constructed by the present invention introduces a tumor microenvironment responsive promoter (including but not limited to the hypoxia responsive promoter NirB, the lactic acid responsive promoter, the low pH responsive promoter, and the hydrogen peroxide responsive promoter, etc.), a secretory peptide USP45, and a coding sequence of a cytokine or chemokine (including but not limited to XCL-1, TNF-α or IL-10, etc.) into the expression plasmid. Under the action of the specific promoter and the secretory peptide, the target gene can be expressed and secreted in situ in the tumor microenvironment. The lactobacillus expression vector constructed in the present invention uses a lactobacillus-specific vector skeleton. It is also within the scope of protection of the present invention to construct a tumor microenvironment responsive gene expression plasmid based on a plasmid vector of other species of bacteria (such as Escherichia coli, Bifidobacterium, Listeria monocytogenes, etc.) using a similar method.

[0065] The probiotic-modified nanomaterials of the present invention are constructed based on nanoparticles that respond to the acidic microenvironment of tumors and engineered probiotic carriers to achieve the release of nanoparticles in response to acidity in the tumor microenvironment. At the same time, probiotics can express DC cell chemotactic factors under acid induction to achieve the induction of tumor cell death in situ, enhance DC cell antigen presentation, and enhance the effect of anti-tumor immune response in situ. The scheme of the present invention transforms probiotics through genetic recombination technology to enable them to secrete DC cell chemotactic factors, and performs N3 modification through the sugar metabolism pathway; by connecting Fe3O4 to the borosilicate bioglass material, it enables it to release Fe in an acidic environment. 3+ At the same time, DBCO is modified on the bioglass material, and the bioglass material is attached to the bacteria through bioorthogonal click chemistry reaction. The tumor targeting of bacteria is used to achieve synchronous transport of nanoparticles and bacteria, thereby enhancing the targeted anti-tumor immune response.

[0066] The probiotic-loaded nanomaterial described in the present invention is constructed based on nanoparticles that respond to the acidic microenvironment of tumors and engineered probiotic carriers. The bioglass material is connected to the probiotics using sugar metabolism engineering and bioorthogonal coupling. The bioglass material is released in a slightly acidic environment and triggers a Fenton reaction, increasing the death of immunogenic cells in the tumor and releasing antigens, ultimately achieving efficient and long-lasting anti-tumor immunotherapy.

[0067] The probiotic-loaded nanomaterials described herein, combined with genetically engineered bacteria, utilize a bioorthogonal click chemistry pairing group, N3-DBCO, to connect the bacteria to the bioglass material. This metabolically labels the bacteria with N3, minimizing the impact on the bacteria's own functions. The reaction conditions are mild, simple, efficient, and reproducible, making them suitable for loading diverse nanomaterials onto bacterial surfaces. The bioorthogonal click chemistry pairing group, N3-DBCO, stabilizes the connection between the bacteria and the material, increasing the delivery efficiency of the bioglass material and its targeting to lesions.

[0068] The probiotic-loaded nanomaterials of the present invention are constructed with bacterial carriers based on cell membrane surface metabolites. Utilizing this feature, the design concept can be applied to the engineering connection and modification of nanoparticles in other cells, viruses, and other organisms. Compared with more complex biological systems such as blood and human tissue, the construction method of this bacterial carrier has significant reaction specificity, which can greatly avoid the false signals caused by traditional non-specific labeling based on amino and carboxyl reactions; at the same time, compared with positive and negative charge adsorption methods, this labeled product is more stable. The construction method of the bacterial carrier-biomaterial of the present invention is simple and easy to operate and promote.

[0069] The present invention is based on the tumor in situ vaccine development strategy of DCs, and utilizes DNA recombination technology, sugar metabolism engineering and bioorthogonal means to construct a new type of engineered probiotic that can simultaneously promote the immunogenic cell death (ICD) of tumor cells to achieve tumor antigen release and increase the antigen presentation ability of DCs, thereby achieving efficient and rapid anti-tumor immunotherapy. This anti-tumor vaccine system can increase the ICD effect at the tumor site and achieve the in situ expression and secretion of DCs chemokines, thereby enhancing the antigen presentation ability of the tumor site and promoting the expression of DCs and CD4 + and CD8 + T lymphocyte maturation and proliferation enhance the anti-tumor immune response at the tumor site and reduce the toxic side effects of drugs, providing a research basis for promoting the clinical translation and application of DCs immunotherapy, and also providing a new strategy for the development of in situ anti-tumor vaccines based on DCs.

[0070] The probiotic-loaded nanomaterials of the present invention, under the carrier of probiotics, simultaneously transport the bioglass material to the lesion site (including but not limited to tumors, such as inflammation, Alzheimer's disease and other cardiovascular and cerebrovascular diseases). Under the stimulation of the microenvironment of the lesion site, the probiotics can secrete DC cell chemotactic factors, and at the same time, the bioglass nanoparticles can release metal ions (including but not limited to Fe2 + , Cu2 + The bacteria-loaded nanoparticles described herein can effectively promote the accumulation and activation of nanoparticles at the lesion site, enhancing their therapeutic efficacy. BRIEF DESCRIPTION OF THE DRAWINGS

[0071] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below based on specific embodiments of the present invention in conjunction with the accompanying drawings, wherein:

[0072] Figure 1 Schematic diagram of the construction of engineered lactic acid bacteria LAB_XCL1

[0073] Figure 2 This is the map of the hypoxia-responsive expression plasmid in Example 1;

[0074] Figure 3 Schematic diagram of the construction of XCL1@LAB and the in vitro chemotactic ability detection of DCs in Example 5;

[0075] Figure 4 The effect of XCL1@LAB on tumor treatment in vivo and its regulation on the immune microenvironment in Example 6;

[0076] Figure 5 The performance test results of the probiotic-nanomaterial described in Example 7 are shown; (A) shows that the LAB bacteria successfully metabolized N3; (B) is a transmission electron microscopy (TEM) image of the bioglass material; (C) is a normal, unmodified LAB bacteria; and (D) is a transmission electron microscopy (TEM) image of the bioglass material carried by the LAB bacteria.

[0077] Figure 6 Schematic diagram of the Fenton effect produced by the bioglass material Fe3O4_Au in a slightly acidic environment in Example 7;

[0078] Figure 7 Schematic diagram of IVIS in vivo imaging of the accumulation of bioglass material @LAB in tumors in Example 11;

[0079] Figure 8 This is the therapeutic effect of the bioglass material @LAB on tumors in Example 12. DETAILED DESCRIPTION

[0080] In the following examples of the present invention, if specific techniques or conditions are not specified, the experiments were carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. All reagents or instruments used, if the manufacturer is not specified, are conventional products that can be purchased through regular channels.

[0081] In the following examples of the present invention, the sources of the materials involved are as follows:

[0082] The composition of MRS medium is as follows: peptone 10 g / L, beef extract powder 8 g / L, yeast extract powder 4 g / L, glucose 20 g / L, Tween-80 1 mL, KHPO4 2 g / L, sodium acetate.3H2O 5 g / L, ammonium citrate tribasic 2 g / L, MgSO4·7H2O 0.2 g / L, MnSO4·5H2O 0.05 g / L, purified water 1000 mL, pH 6.2 ± 0.2;

[0083] Lactobacillus 1: Lactobacillus rhamnosus Probio M9;

[0084] Lactobacillus 2: Lactobacillus rhamnosus GG;

[0085] Plasmid pVE5523: Hunan Fenghui Biotechnology Co., Ltd.;

[0086] Plasmid pMG36: Hunan Fenghui Biotechnology Co., Ltd.;

[0087] Plasmid pNZ8148: Hunan Fenghui Biotechnology Co., Ltd.;

[0088] Elisa kit: Beijing Sino Biological Technology Co., Ltd.

[0089] In the following examples of the present invention, combined with the hypoxia characteristics in the tumor microenvironment, DNA recombination technology is used to construct a probiotic that has hypoxia-responsive expression and secretion of the DCs chemokine XCL-1. As a natural tumor-targeting vector, the engineered probiotic can colonize in the tumor tissue and infiltrate the hypoxic zone in the center of the tumor under the drive of the hypoxia signal of the tumor tissue and the inhibitory immune microenvironment. The hypoxic environment in the tumor tissue can induce the engineered probiotic to express and secrete the DCs chemokine XCL1, induce DCs to enter the tumor tissue, and mature and proliferate under the stimulation of tumor antigens, thereby increasing their ability to present antigens. The activated DCs can present tumor antigens to T cells, promote T cell maturation and secrete proinflammatory factors, and enhance the anti-tumor immune response ability.

[0090] like Figure 1 The procedure shown in the figure first retrieved the mouse XCL1 sequence (NM_008510.3), the lactic acid bacteria NirB promoter sequence, and the lactic acid bacteria secretory peptide UPS45 sequence from the NCBI database and synthesized them through BGI. Using DNA homologous recombination, the NirB promoter, secretory peptide, and XCL1 sequences were constructed into the pVE5523 plasmid backbone. A 3×myc tag was fused to the C-terminus of the XCL1 gene to generate the recombinant plasmid XCL1-NirB-USP45-3×myc. A control plasmid, NirB-USP45-3×myc, was also constructed. Anaerobic induction was then performed to obtain a lactic acid bacteria strain capable of expressing and secreting XCL1.

[0091] Example 1 Construction of Lactobacillus vector with tumor microenvironment response

[0092] Construction of tumor microenvironment response expression plasmid

[0093] In this example, a Lactobacillus-specific promoter sequence was obtained through genomic sequence alignment, and the CDs sequence of the target gene was obtained from the mouse (Mus musculus) genome. Specific primers were designed using the NCBI database (https: / / www.ncbi.nlm.nih.gov / ). High-fidelity PCR enzyme (2×Taq Plus Master Mix) was used to amplify the specific promoter sequence NirB and the secretory peptide USP45 fragment from the Lactobacillus genome, and the CDs sequence of the target gene XCL1 was amplified from the mouse (Mus musculus) genome. The specific tag 3×Myc was fused to the C-terminus of the target gene.

[0094] In this example, the promoter sequence, USP45 peptide, and target gene were connected by PCR to form a "promoter-USP45-gene" fragment, and the fragment was ligated into the plasmid pVE5523 by homologous recombination to obtain the target plasmid (the hypoxia-responsive expression plasmid map is shown in FIG. Figure 2 ). The specific promoter in the promoter-USP45-gene fragment is NirB, the gene is XCL1, and the nucleotide sequence of the promoter-USP45-gene fragment is shown in SEQ ID NO.5.

[0095] SEQ ID NO.5:

[0096] aggtaaatttgatgtacatcaaatggtaccccttgctgaatcgttaaggtaggcggtataaggaggaaaaaacgtcgacatgaagaagaagattattagtgcgattttgatgagtacggtgattttgtcc gctgccgcccctttgtctggtgtttatgccgatacagttgatgtcgacatgagacttctcctcctgactttcctgggagtctgctgcctcaccccatgggttgtggaaggtgtggggactgaagtcctag aagagagtagctgtgtgaacttacaaacccagcggctgccagttcaaaaaatcaagacctatatcatctgggagggggccatgagagctgtaatttttgtcaccaaacgaggactaaaaatttgtgctga tccagaagccaaatgggtgaaagcagcgatcaagactgtggatggcagggccagtaccagaaagaacatggctgaaactgttcccacaggagcccagaggtccaccagcacagcgataaccctgactggg.

[0097] In this example, the target plasmid was transformed with competent E. coli DH5α, identified by sequencing, expanded, and then subjected to plasmid extraction.

[0098] Preparation of competent Lactobacillus

[0099] After culturing Lactobacillus 1 overnight in MRS medium, inoculate the cells at a ratio of 1:50 into MRS medium containing 1% glycine and 0.5M sucrose. Cultivate at 37°C until the OD600 reaches 0.2-0.3. Collect the culture medium and centrifuge at 6500 rpm for 10 minutes at 4°C. Discard the supernatant. Wash the cells three times with a washing solution (5 mM KH2PO4, 2 mM MgCl2, 10% glycerol (v / v), 0.3 M sucrose). Resuspend the cells in the washing solution at a ratio of 1:100 and use directly for electroporation or freeze at -80°C for later use.

[0100] Lactobacillus electroporation

[0101] 2 μL of plasmid was mixed with 80 μL of competent Lactobacillus 1 (plasmid concentrations of 25 ng / μL, 50 ng / μL, 500 ng / μL, 750 ng / μL, and 1000 ng / μL) and added to a 0.2 cm cuvette. Electroporation was performed using a BioRad GenePulser electroporator at varying electric shock intensities (10 kV / cm), number of shocks (10 times), and intervals (500 ms). After electroporation, Lactobacillus 1 was resuspended in MRS medium containing 0.3 M sucrose, 20 mM MgCl2, and 2 mM CaCl2 and incubated at 37°C for 2.5 hours. The culture was then plated onto selective MRS plates containing chloramphenicol (3 μg / mL, 5 μg / mL, and 10 μg / mL) and incubated for 2-3 days. Single clones were identified by sequencing, and successfully identified strains were labeled gene@LAB.

[0102] Identification of gene expression and secretion under anaerobic conditions

[0103] The Lactobacillus vector, successfully identified by sequencing, was designated XCL1@LAB. XCL1@LAB was cultured in MRS medium under anaerobic conditions, and the supernatant was collected at different times to analyze the expression and secretion of the target gene using an ELISA kit. Elisa assays of the bacteria and culture fluid demonstrated that under anaerobic conditions, LAB was able to express XCL1 and secrete it extracellularly.

[0104] Example 2 Construction of Lactobacillus vector with tumor microenvironment response

[0105] Construction of tumor microenvironment response expression plasmid

[0106] In this example, the specific promoter sequence pLldP and the secretory peptide USP45 fragment were amplified from the Lactobacillus genome, and the CDs sequence of the target gene TNF-α was amplified from the mouse (Mus musculus) genome, and the specific tag 6×His was fused to the C-terminus of the target gene.

[0107] In this example, the promoter sequence pLldP, the USP45 peptide, and TNF-α were linked by PCR to form a "promoter-USP45-gene" fragment. This fragment was then ligated into the lactic acid bacteria plasmid pMG36e by homologous recombination to obtain the target plasmid. The specific promoter of the promoter-USP45-gene fragment is pLldP, and the gene is TNF-α. The nucleotide sequence of the promoter-USP45-gene fragment is shown in SEQ ID NO. 6.

[0108] SEQ ID NO.6:

[0109] gcgccccagctggcaattccgacgtcaattggccctaccaattcttcgcttatctgacctctggttcacaatttcccaattaaaactcacatcaatgttgacagctagctcagtcctagggattgtgctagctcattatccctacacaacacaattggcagtgccacttgaattcattaaagaggagaaaggtaccatgaagaagaagattattagtgcgattttgatgagtacggtgattttgtccgctgccgcccctttgtctggtgtttatgccgatacagttgatatgacactgctcggccgtctccacctcttgagggtgcttggcacccctcctgtcttcctcctggggctgctgctggccctgcctctaggggcccagggactctctggtgtccgcttctccgctgccaggacagcccatccactccctcagaagcacttgacccatggcatcctgaaacctgctgctcaccttgttgggtaccccagcaagcagaactcactgctctggagagcaagcacggatcgtgcctttctccgacatggcttctctttgagcaacaactccctcctgatccccaccagtggcctctactttgtctactcccaggtggttttctctggagaaagctgctcccccagggccattcccactcccatctacctggcacacgaggtccagctcttttcctcccaataccccttccatgtgcctctcctcagtgcgcagaagtctgtgtatccgggacttcaaggaccgtgggtgcgctcaatgtaccagggggctgtgttcctgctcagtaagggagaccagctgtccacccacaccgacggcatctcccatctacacttcagccccagcagtgtattctttggagcctttgcactgtag。

[0110] In this embodiment, after the target plasmid was transformed into Escherichia coli competent DH5α and identified by sequencing, it was expanded in culture and plasmid extraction was carried out.

[0111] Preparation of competent Lactobacillus

[0112] After culturing Lactobacillus 2 overnight in MRS medium, inoculate at a 1:100 ratio into MRS medium containing 1% glycine and 0.5M sucrose. Cultivate at 37°C until the OD600 reaches 0.2-0.3. Collect the culture medium and centrifuge at 6500 rpm for 10 minutes at 4°C. Discard the supernatant. Wash the cells three times with a washing solution (5mM KH2PO4, 2mM MgCl2, 10% glycerol (v / v), 0.3M sucrose). Resuspend the cells in the washing solution at a 1:100 ratio and use directly for electroporation or freeze at -80°C for later use.

[0113] Lactobacillus electroporation

[0114] 2 μL of plasmid was mixed with 80 μL of competent Lactobacillus 2 (plasmid concentrations of 25 ng / μL, 50 ng / μL, 500 ng / μL, 750 ng / μL, and 1000 ng / μL) and added to a 0.2 cm cuvette. Electroporation was performed using a BioRad GenePulser electroporator at varying electric shock intensities (10 kV / cm), number of shocks (8 times), and intervals (500 ms). After electroporation, Lactobacillus 2 was resuspended in MRS medium containing 0.3 M sucrose, 20 mM MgCl2, and 2 mM CaCl2 and incubated at 37°C for 2.5 hours. The culture was then plated onto selective MRS plates containing chloramphenicol (3 μg / mL, 5 μg / mL, and 10 μg / mL) and incubated for 2-3 days. Single clones were identified by sequencing, and successfully identified strains were labeled gene@LAB.

[0115] Identification of gene expression and secretion under anaerobic conditions

[0116] The Lactobacillus vector, successfully identified by sequencing, was designated TNF-α@LAB. TNF-α@LAB was cultured in MRS medium under anaerobic conditions, and the supernatant was collected at different times to analyze the expression and secretion of the target gene using an Elisa kit. Elisa assays of the bacteria and culture fluid demonstrated that, in a lactic acid-responsive environment, LAB was able to express TNF-α and secrete it extracellularly.

[0117] Example 3 Construction of Lactobacillus vector with tumor microenvironment response

[0118] This embodiment provides a Lactobacillus vector with tumor microenvironment response. The construction method of the Lactobacillus vector refers to Example 1, with the only difference being that the specific promoter is pCadC; the gene is IL-10; the resulting "promoter-USP45-gene" fragment is connected to the plasmid pNZ8148; the nucleotide sequence of the promoter-USP45-gene fragment is shown in SEQ ID NO.7.

[0119] SEQ ID NO.7:

[0120] gtaactccgggttgatttatgctcggaaatatttgttgttgagtttttgtatgttcctgttggtataatatgttgcggcaatttatttgccgcataatttttattacataaatttaaccagagaatgtcacgcaatccattgtaaacattaaatgtttatcttttcatgatatcaacttgcgatcctgatgtgttaataaaaaacctcaagttctcacttacagaaacttttgtgttatttcacctaatctttaggattaatccttttttcgtgagtaatcttatcgccagtttggtctggtcaatgaagaagaagattattagtgcgattttgatgagtacggtgattttgtccgctgccgcccctttgtctggtgtttatgccgatacagttgatatgcctggctcagcactgctatgctgcctgctcttactgactggcatgaggatcagcaggggccagtacagccgggaagacaataactgcacccacttcccagtcggccagagccacatgctcctagagctgcggactgccttcagccaggtgaagactttctttcaaacaaaggaccagctggacaacatactgctaaccgactccttaatgcaggactttaagggttacttgggttgccaagccttatcggaaatgatccagttttacctggtagaagtgatgccccaggcagagaagcatggcccagaaatcaaggagcatttgaattccctgggtgagaagctgaagaccctcaggatgcggctgaggcgctgtcatcgatttctcccctgtgaaaataagagcaaggcagtggagcaggtgaagagtgattttaataagctccaagaccaaggtgtctacaaggccatgaatgaatttgacatcttcatcaactgcatagaagcatacatgatgatcaaaatgaaaagctaa。

[0121] Example 4 Construction of Lactobacillus vector with tumor microenvironment response

[0122] This embodiment provides a Lactobacillus vector with tumor microenvironment response. The construction method of the Lactobacillus vector refers to Example 1, with the only difference being that the specific promoter is NirB; the gene is IL-10; the resulting "promoter-USP45-gene" fragment is connected to the plasmid pVE5523; the nucleotide sequence of the promoter-USP45-gene fragment is shown in SEQ ID NO.8.

[0123] SEQ ID NO.8:

[0124] .

[0125] Example 5: Detecting the Chemotactic Effect of Target Genes on Immune Cells Using XCL1@LAB as an Example

[0126] In this example, a transwell experiment was performed using spleen cells DC2.4. The culture supernatant of LAB and XCL1@LAB (Example 4) was taken and added to the lower culture chamber after concentration determination. After incubation for 4 h, 6 h, 12 h, and 24 h, the cells were stained with CD86 and CD80, and the migration of DCs to the bottom of the transwell cavity was observed by flow cytometry. The flow cytometry results are shown in the figure. Figure 3 As shown. Figure 3 It can be seen that XCL1@LAB can recruit DCs and promote the maturation of DCs.

[0127] Furthermore, the same experimental method was used to detect the effect of the tumor microenvironment-responsive Lactobacillus vector obtained in Example 2-5 on immune cells. The experimental results were consistent with the results of XCL1@LAB. The Lactobacillus vector in Example 2-4 was also able to recruit DCs and promote the maturation of DCs.

[0128] Example 6: Using XCL-1@LAB as an example to explore the effect evaluation of modified lactobacilli in treating tumors in vivo

[0129] Using 4T1 tumor-bearing mice as a model, PBS, LAB, and XCL1@LAB (100 μL) were injected into the tail vein three times (d1, d3, and d7). Tumor growth was continuously assessed, and the survival rate of mice in each group was measured. Mice were sacrificed on day 8 after the last injection (d15), and tumor and spleen tissues were collected for detection of surface markers of DCs, effector T cells, memory T cells, macrophages, etc. Pathological evaluation of tumors and important organs (heart, liver, spleen, lungs, kidneys, etc.) was also performed. The results are shown in Figure 2. Figure 4 shown.

[0130] from Figure 4 It can be seen that tumor-targeted delivery can be achieved by intravenous injection of XCL1@LAB, and XCL1 is expressed and released in response to the tumor microenvironment, recruiting DCs into the tumor site, promoting DCs maturation, increasing antigen presentation, and promoting CD4 + 、CD8 + Cell activation ultimately achieves the regulation of the tumor immune microenvironment and achieves the effect of inhibiting tumor growth.

[0131] The same experimental method was used to test the in vivo tumor treatment effect of the Lactobacillus vectors with tumor microenvironment response obtained in Examples 2-5 using 4T1 tumor-bearing mice as a model. After the Lactobacillus vectors were injected through the tail vein, tumor-targeted delivery was achieved, and cytokines or chemokines were expressed and secreted in response to the tumor microenvironment, recruiting DCs into the tumor site, promoting DCs maturation, increasing antigen presentation, and promoting CD8+ 、CD4 + The maturation and activation of T lymphocytes achieves the effect of inhibiting tumor growth.

[0132] It can be seen that the present invention utilizes the characteristics of natural lactobacillus "probiotics" to construct a class of "natural non-toxic" lactobacillus drug carriers, which utilizes its own immunogenic characteristics to promote the immunogenic cell death of tumor cells and achieve the release of tumor antigens; through gene editing, lactobacillus has the ability to express specific cytokines or chemokines in response to the tumor microenvironment, thereby achieving the in situ release of drugs on tumors and promoting the proliferation of DCs, CD4 + and CD8 + T lymphocyte maturation and proliferation enhance the anti-tumor immune response at the tumor site and reduce the toxic side effects of drugs.

[0133] Example 7 Preparation of Probiotics-Nanomaterials

[0134] Preparation of N3-bacteria

[0135] The lactic acid bacteria constructed in Example 1 were cultured overnight in MRS medium and diluted 1:100 into fresh MRS medium supplemented with 50 mM N3-D-Ala. The culture was incubated overnight at 37°C. The culture was harvested, centrifuged at 4000 rpm for 5 minutes, washed three times with 1× PBS, and resuspended in 1 ml of PBS. 5 μM DBCO-Cy5.5 was added to the culture solution and stained on a 360-degree rotary mixer for 2 hours in the dark.

[0136] The cultured bacteria were collected, washed three times with 1×PBS, and resuspended in 1 ml PBS. The fluorescence intensity of the bacteria was detected by flow cytometry. The results of flow cytometry are shown in the attached figure. Figure 5 As shown in A, it shows that LAB bacteria successfully metabolize N3.

[0137] Preparation of bioglass materials

[0138] In this example, DBCO-NHS and Fe3O4_Au (5 mg / ml) were mixed in an amide reaction at a molar ratio of 1:1 to obtain a final concentration of 27×10 -6 The reaction was carried out at 4°C overnight to obtain DBCO-Fe3O4_Au. The reactants were collected, centrifuged and filtered to obtain lyophilized powder. Figure 5 Middle (B) is the morphology of the material under transmission electron microscopy.

[0139] In this embodiment, the bioglass material Fe3O4_Au produces a Fenton effect in a slightly acidic environment as shown in the attached figure. Figure 6As shown. It can be seen that the bioglass material Fe3O4_Au releases Fe in a slightly acidic environment. 2+ and H2O2, the generated Fe 2+ Can react with H2O2 to produce hydroxyl radicals - OH, thereby destroying tumor cells and releasing tumor antigens.

[0140] Construction of living bacteria-bioglass materials

[0141] After counting the above-mentioned cultured bacteria, the bacterial concentration was adjusted to 5×10 9 CFU / ml: Resuspend 1 ml of the above bacteria in 5 ml of PBS. Prepare the bioglass material at a concentration of 0.25 mg / ml and sonicate for 15 minutes to disperse the material. Slowly add 1 ml of the 0.25 mg / ml material to the bacteria, stirring while adding. Incubate at room temperature for 6 hours. Collect the reaction material, centrifuge, wash three times with PBS, resuspend in 1 ml of PBS, and store at 4°C until needed.

[0142] The nanomaterial prepared above was dropped onto a copper mesh, stained with phosphotungstic acid, and examined under a transmission electron microscope. The results are shown in the attached figure. Figure 5 As shown in (CD), (C) is a normal LAB bacteria without modification; (D) is a transmission electron microscope (TEM) image of LAB bacteria carrying bioglass material, indicating that the bacteria and bioglass material are successfully connected.

[0143] Example 8

[0144] The preparation method of the probiotic-nanomaterial described in this example is the same as that in Example 7, the only difference being that the probiotic is the engineered lactobacillus constructed in Example 2.

[0145] Example 8

[0146] The preparation method of the probiotic-nanomaterial described in this example is the same as that in Example 7, the only difference being that the probiotic is the engineered lactobacillus constructed in Example 3.

[0147] Example 9

[0148] The preparation method of the probiotic-nanomaterial described in this example is the same as that in Example 7, the only difference being that the probiotic is the engineered lactobacillus constructed in Example 4.

[0149] Example 10

[0150] The preparation method of the probiotic-nanomaterial described in this example is the same as that in Example 7, the only difference being that the probiotic is the engineered lactobacillus constructed in Example 4.

[0151] Example 11 In vivo imaging of live bacteria-bioglass materials

[0152] Take 1ml 5×10 9 The prepared live bacteria loaded onto the bioglass material (Example 7) were placed in a 1.5 ml EP tube, and 5 μM DBCO-Cy5.5 was added. The tube was protected from light and stained on a 360-degree rotating mixer for 2 hours. The tube was then washed three times with 1×PBS and resuspended in 100 μl PBS. The 100 μl bacterial solution was injected into 4T1 tumor-bearing mice via microintravenous injection, and the fluorescence intensity of Cy5.5 in the tumor was observed at different time points. The results are shown in the attached figure. Figure 7 As shown, bioglass material-live bacteria have good tumor targeting ability.

[0153] Example 12 Evaluation of the in vivo anti-tumor effect of live bacteria-bioglass materials

[0154] Using 4T1 tumor-bearing mice as a model, PBS, LAB, and bioglass material @LAB (Example 7) (100 μL) were injected into the tail vein three times (d1, d3, and d7). The growth of the tumor was continuously evaluated, and the survival rate of each group of mice was detected; the mice were killed on the 8th day after the last injection (d15), and the tumor tissue and spleen tissue were taken to detect the surface markers of DCs, effector T cells, and memory T cells; and the tumor and important organs (heart, liver, spleen, lungs, kidneys, etc.) were pathologically evaluated. The therapeutic effect of the bioglass material @LAB on tumors described in this example is shown in the figure. Figure 8 shown.

[0155] from Figure 8 It can be seen that intravenous injection of bioglass material @LAB can enhance the enrichment of DCs in tumors and increase antigen presentation. Bioglass material @LAB can significantly enhance the maturation of DC cells in tumors and enhance and promote CD3 + CD4 + 、CD3 + CD8 + Activation of T cells can enhance anti-tumor immunity, ultimately regulating the tumor immune microenvironment and inhibiting tumor growth.

[0156] In summary, the nanomaterials of the present invention transform probiotics through gene recombination technology to enable them to secrete DC cell chemotactic factors, and perform N3 modification through the sugar metabolism pathway; by attaching Fe3O4 to the borosilicate bioglass material, it can release Fe in an acidic environment. 3+At the same time, DBCO is modified on the bioglass material, and the bioglass material is attached to the bacteria through bioorthogonal click chemistry reaction. The tumor targeting of bacteria is used to achieve synchronous transport of nanoparticles and bacteria, thereby enhancing the targeted anti-tumor immune response.

[0157] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will readily appreciate that other variations or modifications based on the above descriptions are possible. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the present invention.

Claims

1. A preparation method of a nanomaterial based on engineered probiotic loading, characterized in that, It includes the following steps: (1) Cultivate the constructed engineered probiotics in a medium containing N3-D-Ala to obtain N3-labeled probiotics; (2) Collect the above-cultured N3-labeled probiotics, add a bioactive glass material (BG) and carry out a mixing reaction to obtain the product.

2. The preparation method of the nanomaterial modified by engineered probiotics according to claim 1, characterized in that, In the step (1), the engineered probiotics include a Lactobacillus vector with a tumor microenvironment response, and the Lactobacillus vector expresses and secretes cytokines or chemokines; Preferably, the Lactobacillus vector contains a tumor microenvironment-responsive expression plasmid Lactobacillus vector; Preferably, in the Lactobacillus vector, the tumor microenvironment-responsive expression plasmid contains a specific promoter, a target gene, and a secretion peptide; Preferably, the specific promoter is selected from any one of a hypoxia-responsive promoter, a low pH-responsive promoter, a lactate promoter, or a H2O2-responsive promoter; 3. The preparation method of the nano-material modified based on engineered probiotics according to claim 1 or 2, characterized in that, In the step (1), in the step of culturing the bacteria, the addition concentration of N3-D-Ala in the medium is 30-80 nM; Preferably, the medium includes MRS medium; Preferably, the temperature of the step of culturing the bacteria is 35-38 °C.

4. The preparation method of the nanomaterial modified based on engineered probiotics according to any one of claims 1-3, characterized in that, In the step (2), the bioactive glass material is DBCO-Fe3O4_Au obtained by an amide reaction using DBCO-NHS and Fe3O4_Au as raw materials; Preferably, the molar ratio of DBCO-NHS to Fe3O4_Au is 1:1 - 2:

1.

5. The preparation method of the nano-material modified based on engineered probiotics according to any one of claims 1-4, characterized in that, In the step (2), in the mixing reaction: The concentration of the probiotics labeled with N3 is 3 - 8×10 9 CFU / ml; The concentration of the bioactive glass material is 0.2-0.3 mg / ml.

6. The preparation method of the nanomaterial modified based on engineered probiotics according to any one of claims 1-5, characterized in that, In the step (1), in the Lactobacillus vector containing the tumor microenvironment-responsive expression plasmid, the tumor microenvironment-responsive expression plasmid is selected from any one of plasmid pVE5523, plasmid pMG36e, or plasmid pNZ8148; Preferably, the hypoxia-responsive promoter includes the hypoxia-responsive promoter NirB, and the nucleic acid molecule encoding NirB includes the sequence shown in SEQ ID NO.1; Preferably, the low pH-responsive promoter includes pLipF or pCadC, and the nucleic acid molecule encoding the low pH-responsive promoter pCadC includes the sequence shown in SEQ ID NO.2; Preferably, the lactate promoter includes pLldR or pLldP, and the nucleic acid molecule encoding the lactate promoter pLldP includes the sequence shown in SEQ ID NO.3; Preferably, the H2O2-responsive promoter includes PkatG; Preferably, the secretion peptide is the secretion peptide USP45, and the amino acid sequence encoding the secretion peptide USP45 includes SEQ ID NO.4; Preferably, the target gene is a gene encoding a cytokine or a chemokine, and the C-terminus of the target gene is fused with a specific tag; Preferably, the specific tag includes any one of 3×Myc, 3×Flag, 6×His, EGFP, or mCharry.

7. The preparation method of the nanomaterial modified based on engineered probiotics according to claim 6, characterized in that, In the step (1), it further includes the step of constructing the tumor microenvironment-responsive expression plasmid Lactobacillus vector, which includes the following steps: (1) Construct a tumor microenvironment-responsive expression plasmid according to the selected gene structure; (2) Introduce the plasmid constructed in step (1) into Lactobacillus by electroporation to obtain the Lactobacillus vector with tumor microenvironment responsiveness; Preferably, in the step (1), the nucleic acid molecule encoding a cytokine or chemokine and the nucleic acid molecule encoding a specific promoter and the secretion peptide USP45 are constructed onto the Lactobacillus expression plasmid by homologous recombination; Preferably, in the step (2), the conditions for electroporation are: electric shock intensity 7.5 - 12.5 kV / cm, number of electric shock times 6 - 10 times, and interval time 100 - 1000 ms.

8. A nanomaterial modified by engineered probiotics prepared by the method according to any one of claims 1 - 7.

9. Use of the nanomaterial modified by engineered probiotics according to claim 8 for the preparation of anti-tumor drugs, anti-inflammatory drugs, drugs for the treatment of nervous system diseases, and / or drugs for the treatment of cardiovascular and cerebrovascular diseases.

10. A pharmaceutical composition, characterized in that, The pharmaceutical composition includes the nanomaterial modified by engineered probiotics according to claim 8.

Images