System and method for detecting areca yellowing related viruses based on RPA-LFD technology

Abstract

The invention relates to the technical field of plant virus detection, in particular to a system and a method for detecting areca yellowing related viruses based on an RPA-LFD technology. The primer group for detecting the areca yellows virus APV1 is characterized by comprising a specific primer pair, the nucleotide sequence of an upstream primer in the specific primer pair is as shown in SEQ ID No.1 in a sequence table, and the nucleotide sequence of a downstream primer is as shown in SEQ ID No.2 in the sequence table; the device further comprises a probe. The probe is labeled and modified by biotin or FAM fluorophore; the nucleotide sequence of the modified probe is as shown in SEQ ID No.3 in the sequence table. The kit has the advantages that the kit has higher specificity and lower detection limit in the aspect of detection, and has no cross reaction with other viruses such as areca necrotic ringspot virus; the primer probe combination is suitable for RPA-LFD detection, and the time required by an amplification reaction is short; the reaction result is shown on the test strip and can be observed by naked eyes.

Description

Technical Field

[0001] The present invention relates to the technical field of plant virus detection, and in particular to a detection system and method for betel nut yellowing-related viruses based on RPA-LFD technology. Background Art

[0002] Betel nut Areca catechu L.) is a species of Areca genus in the family Palmae. Areca ) is a tropical perennial evergreen tree and the largest specialty economic crop in Hainan Province. Currently, yellow leaf disease (YLD) is a bottleneck problem restricting the betel nut planting industry. Areca palm velarivirus 1 (APV1) is highly correlated with YLD and can be transmitted by two-striped mealybugs ( Ferrisia virgata ) and Pseudococcus citrinum ( Pseudococcus cryptus ) was transmitted to areca nut in a non-cyclic semi-persistent manner and caused YLD symptoms. The infectious clone of APV1 was successfully inoculated into areca nut and caused YLD yellowing symptoms, completing the Koch's postulate verification of APV1 as the pathogen of yellowing disease, proving that APV1 is one of the key pathogens that infect areca nut and cause YLD.

[0003] The spread of betel nut chlorosis has seriously hindered the development of the betel nut industry. The construction of a healthy seedling guarantee system is insufficient, especially the lack of fast, accurate and portable betel nut chlorosis detection products in the field. Many farmers are very enthusiastic about betel nut planting, but due to the lack of corresponding detection products for betel nut chlorosis on the market, the cultivated betel nut seedlings have not been tested, and it is impossible to prove whether the cultivated betel nut seedlings are healthy, which brings hidden dangers to the outbreak and spread of betel nut chlorosis.

[0004] Traditional detection methods rely on laboratory PCR platforms, which have defects such as strong equipment dependence and long detection cycle (>4 hours), making it difficult to meet the needs of real-time field detection. The detection accuracy of traditional immunocolloidal gold method is limited (detection limit is 10 4 -10 5 The detection accuracy of samples with low virus titer is low, but the detection by RPA-LFD method does not require large equipment, the detection time can be controlled within half an hour, and the detection limit can reach 100 copies / reaction, which can achieve accurate, fast and convenient detection in the field.

[0005] Recombinase Polymerase Amplification (RPA) technology is a new type of nucleic acid isothermal amplification technology developed in recent years based on recombinant polymerase. The recombinase first binds to the primer to form a complex, scans the double-stranded DNA and mediates the denaturation of the target region, so that the primers are accurately paired. Subsequently, the single-stranded DNA binding protein (SSB) stabilizes the single-stranded structure, and the polymerase extends along the template to synthesize a new chain. The reaction is carried out at a constant temperature (usually 37~42℃), without the need for thermal cycling equipment, and amplification can be completed within 10-30 minutes. It has the advantages of being fast, portable and low in resource consumption, and is especially suitable for on-site instant testing.

[0006] Lateral flow dipstick (LFD) is an endpoint detection technology for visual observation of amplification products. The double-labeled product amplified by RPA forms a "fluorescein antibody-double-labeled nucleic acid amplification product-colloidal gold complex" at the detection line through antigen-antibody binding. The result can be directly observed with the naked eye after 10 minutes.

[0007] RPA-LFD combines nucleic acid amplification with immunoassay to achieve highly sensitive target identification. In the specific detection process, RPA primers are pre-labeled with molecules such as biotin or FAM, and the amplified products carry dual labels. The detection line of the LFD test strip is coated with streptavidin (to capture biotin), and the quality control line contains anti-FAM antibodies. The amplified product is diluted and added to the sample, and the double-labeled product is captured and colored by the detection line, and the unbound material continues to migrate to the quality control line. This combined technology can also extract the sample, and the whole process can be completed within half an hour, which is suitable for on-site screening. Summary of the invention

[0008] In order to solve the above problems, the present invention provides a detection system and method for betel nut yellowing-related viruses based on RPA-LFD technology.

[0009] The present invention aims to provide a method for rapidly detecting betel nut yellowing virus APV1 based on RPA-LFD technology, using a detection system for rapidly detecting betel nut yellowing virus APV1, which specifically comprises the following steps: S1. Crude sample extraction: Take 50-100 mg of betel nut leaf tissue in a mortar, add sample slow-release solution and grind to obtain crude extract, and crudely extract viral RNA from the sample to be tested; S2. Isothermal amplification: Using the RNA obtained in step S1 as a template, add an RPA reaction system containing a specific primer pair, insert the centrifuge tube into the centrifuge tube rack in the constant temperature amplification device, adjust the temperature by the temperature adjustment button, and perform isothermal amplification reaction at 37-44°C; S3. Chromatographic detection: Dilute the amplified product with pure water and then drop it onto the sample application area of the test strip. Observe the color development result within 10 - 15 minutes. Among them, the judgment criteria for the test result are as follows: When the control line of the test strip shows color and the test line does not show color, it is determined to be negative for APV1; When both the control line and the test line of the test strip show color, it is determined to be positive for APV1.

[0010] Preferably, the detection system includes a specific primer pair. The nucleotide sequence of the upstream primer in the specific primer pair is as shown in SEQ ID No.1 in the sequence listing, and the nucleotide sequence of the downstream primer is as shown in SEQ ID No.2 in the sequence listing; It also includes a probe. The probe is labeled and modified with a biotin or FAM fluorophore. The fluorophore is selected from one of FAM, HEX, TET, cyanine dyes, ROX, and Texas Red. The alkyl carbon spacer in the probe is selected from one of C2 Spacer, C3 Spacer, and C4 Spacer.

[0011] Preferably, the 5' end of the downstream primer is modified with a Biotin group; The nucleotide sequence of the modified probe is as shown in SEQ ID No.3 in the sequence listing.

[0012] In the detection system, each 50 μL reaction system contains 21 ± 3 pmoL of the upstream primer, 21 ± 3 pmoL of the downstream primer, and 6 ± 1 pmoL of the probe; Reaction conditions: The reaction temperature of the RPA reaction is a constant temperature of 37 - 44 °C, and the reaction time is 10 ± 2 min. The temperature for detection using a lateral flow immunoassay test strip is room temperature, and the time is 10 ± 1 min.

[0013] Preferably, the reaction system includes the following components and dosages:

[0014] The reaction time of the RPA - LFD reaction is 10 min.

[0015] Preferably, the constant temperature amplification device has a split - type cavity structure, including an upper cavity and a lower cavity. The upper cavity is provided with a heat - preservation inner liner and a centrifuge tube rack, and the lower cavity is provided with a heating plate for heating the upper cavity. The constant temperature amplification device is externally provided with a temperature display screen and temperature adjustment buttons. The constant temperature amplification device is provided with a charging interface and can achieve wireless temperature - controlled heating after charging.

[0016] Compared with the prior art, the present invention can achieve the following beneficial effects: The present invention optimizes the described RPA primer pair and RPA primer-probe combination based on a conserved sequence of the capsid protein-coding gene of Areca palm virus 1 (APV1). It has high specificity and a low detection limit in detection, has no cross-reaction with other viruses such as Areca palm necrotic ringspot virus, and the detection limit can reach a template amount of 100 copies. The detection system and detection method of the present invention have a detection sensitivity 3 orders of magnitude higher than that of the traditional immunogold method. At the same time, this primer pair and primer-probe combination are suitable for RPA-LFD detection. The reaction temperature can be set using a small constant-temperature device, and the amplification reaction takes a short time; the reaction result will be shown on the test strip and can be observed with the naked eye, which is very suitable for rapid on-site detection of pathogens. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 It is the RPA-LFD detection result of Areca palm yellowing disease (APV1) virus provided by an embodiment of the present invention; in the figure, N is the negative control; P is the positive control, that is, the total RNA of an Areca palm yellowing disease plant.

[0018] Figure 2 It is the specificity determination result provided by an embodiment of the present invention; in the figure, N is the negative control; 1 is ANRSV; 2 is ANSSV.

[0019] Figure 3 It is the detection limit determination result provided by an embodiment of the present invention; in the figure, N: negative control; 1: template amount 10 1 copies; 2: template amount 10 2 copies; 3: template amount 10 3 copies; 4: template amount 10 4 copies; 5: template amount 10 5 copies; 6: template amount 10 6 copies; 7: template amount 10 7 copies; 8: template amount 10 8 copies.

[0020] Figure 4 It is the performance comparison result between the RPA-LFD detection system of the present invention and RT-PCR detection; (A) is the result of RT-PCR detecting 32 samples; (B) is the result of RPA-LFD detecting 32 samples in the present invention.

[0021] Figure 5 It is the detection limit test result provided by the comparative example of the present invention; in the figure, (A) represents the detection limit detection result of the eliminated primer set 1; (B) represents the detection limit detection result of the eliminated primer set 2; N: negative control; 1: template amount 10 1 copies; 2: template amount 102 copies; 3: Template amount 10 3 copies; 4: Template amount 10 4 copies; 5: Template amount 10 5 copies; 6: Template amount 10 6 copies; 7: Template amount 10 7 copies; 8: Template amount 10 8 copies. Specific implementation manners

[0022] In the following, embodiments of the present invention will be described with reference to the accompanying drawings. In the following description, the same modules are denoted by the same reference numerals. In the case of the same reference numerals, their names and functions are also the same. Therefore, their detailed descriptions will not be repeated.

[0023] In order to make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and do not constitute a limitation to the present invention.

[0024] The present invention provides a primer set for rapidly detecting Areca palm yellowing virus APV1 based on the RPA-LFD technology, including a specific primer pair and a probe; The nucleotide sequences of the specific primer pair are: Forward primer: 5'-CTGCTGGAACTAACATTGATAGATCATTTT-3' (as shown in Sequence Listing SEQ ID No.1); Reverse primer: 5'-ACATCAGCAGCAGTTGGTCGATTTGCGGAA-3' (as shown in Sequence Listing SEQ ID No.2); The nucleotide sequence of the probe is: (as shown in Sequence Listing SEQ ID No.3).

[0025] In some embodiments, the 5' end of the reverse primer is modified with a Biotin group.

[0026] The probe is labeled and modified with biotin or FAM fluorophore, enabling specific capture and visualization detection of the amplification product; in some embodiments, the fluorophore is selected from one of FAM (Fluorescein amidite), HEX (Hexachloro-fluorescein), TET (Tetrachlorofluorescein), cyanine dye, ROX (Carboxy-X-rhodamine), and Texas Red; in a specific embodiment, the fluorophore is FAM; In some embodiments, the alkyl carbon spacer in the probe is selected from one of C2 Spacer, C3 Spacer, and C4 Spacer; in a specific embodiment, the alkyl carbon spacer is C3 Spacer.

[0027] In a specific embodiment, the nucleotide sequence of the probe after modification is as follows: (as shown in Sequence Listing SEQ ID No. 3).

[0028] A kit for rapid detection of Areca palm yellowing virus APV1, including the primer set for rapid detection of Areca palm yellowing virus APV1 based on RPA-LFD technology.

[0029] A detection system for rapid detection of Areca palm yellowing virus APV1, the RPA-LFD reaction system includes: Upstream primer 21 ± 3 pmoL Downstream primer 21 ± 3 pmoL Probe 6 ± 1 pmoL Template 2 μL Activator 2 μL Water balance Total reaction system 50 μL; The reaction temperature of the RPA reaction is a constant temperature of 37 - 44 °C, and the reaction time is 10 ± 2 min; The temperature for detection using a lateral flow immunoassay strip is room temperature, and the time is 10 ± 1 min; As a preferred embodiment, the final concentrations of the upstream primer and the downstream primer in the RPA-LFD reaction are 0.4 μM respectively; As a preferred embodiment, the final concentration of the probe in the RPA-LFD reaction is 0.12 μM; As a preferred embodiment, the reaction time of the RPA-LFD reaction is 10 min; The detection system also contains: freeze-dried microspheres of RPA enzyme; the freeze-dried microspheres of RPA enzyme contain recombinase, single-stranded binding protein (SSB) and DNA polymerase. These are the core components of the RPA reaction well-known in the art. In some embodiments, the individual components in the RPA enzyme mixture can also be provided separately.

[0030] The detection system also contains: a nucleic acid test strip; In a specific embodiment, the nucleic acid test strip is a lateral flow chromatography test strip; In a specific embodiment, the detection system also contains a stabilizer and a preservative; to ensure the stability of the detection system during storage and use; In a specific embodiment, the detection system also contains a detergent; to help reduce inhibitors in the sample and improve the amplification efficiency; In a specific embodiment, the detection system also contains a positive control and / or a negative control, used to verify the accuracy and specificity of the RPA reaction; In a specific embodiment, the detection system also contains an instruction manual, used to provide detailed operation steps, reaction conditions, usage guidelines and precautions.

[0031] Other components in the detection system mentioned in the present invention can all be obtained through commercial channels, and they can be provided in multiple or one reagent alone or in combination.

[0032] A method for rapid detection of Areca palm yellowing virus APV1 based on RPA-LFD technology specifically includes the following steps: S1. Sample crude extraction: Take 50 - 100 mg of areca palm leaf tissue in a mortar, add sample release solution and grind to obtain a crude extract, and crude extract viral RNA from the sample to be tested; S2. Isothermal amplification: Using the RNA obtained in step S1 as a template, add it to the RPA reaction system containing a specific primer pair, insert the centrifuge tube into the centrifuge tube rack in the constant temperature amplification device, and adjust the temperature through the temperature adjustment button to perform an isothermal amplification reaction at 37 - 44 °C; S3. Chromatographic detection: Dilute the amplification product with pure water and then drop it onto the sample addition area of the test strip, and observe the color development result within 10 - 15 minutes; among them, the judgment criteria for the detection result are: When the quality control line (C line) of the test strip shows color and the test line (T line) does not show color, it is determined to be negative for APV1; When the quality control line (C line) and the test line (T line) of the test strip show color simultaneously, it is determined to be positive for APV1.

[0033] The isothermal amplification device has a split cavity structure, including an upper cavity and a lower cavity; there is a heat preservation inner container and a centrifuge tube rack in the upper cavity, and a heating plate is provided in the lower cavity to heat the upper cavity; a temperature display screen and temperature adjustment buttons are set outside the device; after charging the isothermal amplification device, wireless temperature control heating can be realized, which is suitable for field detection.

[0034] The method of the present invention can achieve better amplification results in 10 minutes. The upper limit mentioned here is more based on the consideration of detection efficiency. In actual detection, the reaction time here can also be extended.

[0035] By optimizing the reaction system and reaction conditions, the specificity of the method of the present invention is enhanced, there is no cross-reaction with other viruses, and there is no non-specific amplification; the detection limit is reduced, and the template amount can reach 100 copies; the target gene can be detected in only 20 minutes, while traditional nested PCR takes about 3 to 4 hours, and fluorescence PCR also takes 1 to 1.5 hours.

[0036] The application of a primer set for rapidly detecting Areca palm yellowing virus APV1 based on RPA-LFD technology or a kit for rapidly detecting Areca palm yellowing virus APV1 in detecting or assisting in detecting Areca palm yellowing virus APV1.

[0037] Example 1 Using a conserved sequence (SEQ ID No. 4) of the coat protein coding gene of Areca palm APV1 virus as a template, a set of primer sets for rapidly detecting Areca palm yellowing virus APV1 based on RPA-LFD technology was designed and screened, including a specific primer pair and a probe; Forward primer: 5’-CTGCTGGAACTAACATTGATAGATCATTTT-3’ (SEQ ID No. 1); Reverse primer: 5’-ACATCAGCAGCAGTTGGTCGATTTGCGGAA-3’ (SEQ ID No. 2); Probe: (SEQ ID No. 3); Its target gene (542bp): ATGGATAGACTTAACTTACTTAGAAACGACTTAGCTGCAATTCGCACTGCTCTTGCAAAAGCTGAAAATGTTAGGACAACTACAGAGCGAGTTGCTTTAGAAACTTTTCAAGATAATCTTGATACCTATCTTGAGGCTGCTGGAACTAACATTGATAGATCATTTTTAGATTCAATAAAAGATCTACAATTCCCACGACCTGCTATAAACACTCGGATTGCTTCCGCAAATCGACCAACTGCTGCTGATGTTGATTCTCAAAATCCTGCATTAGAAGATGACATCGTCAATCTAAATGCATTATCTGGAAGTGTTGATTTCGTTTGTCAAGCGCCGGATGAACTATCACCAGAACAAAAACAATTAGTTACACAACATTTTAAGATATTCTTTGCAAAGAAAGTGTTTGGTCTACAATCTGAAAATGAATTGTCAACTAAGATGTGGGCTAATGCATTCGCATCATTATGCATTTCCATTTCTGAGCAATGGACGTCGAAAACTAACGCTAGCAATCCCGATACGCACAACAGTTTCAAA(SEQ ID No.4).

[0038] After further optimization and exploration, the reaction system and specific detection method are as follows: A method for rapid detection of Areca palm yellowing virus APV1 specifically includes the following steps: S1. Crude extraction of sample: Take 50 - 100 mg of areca palm leaf tissue in a mortar, add sample slow-release liquid and grind to obtain a crude extract, and crudely extract viral RNA from the sample to be tested; S2. Isothermal amplification: Using the RNA obtained in step S1 as a template, add it to the RPA reaction system containing specific primer pairs, insert the centrifuge tube into the centrifuge tube rack in the constant temperature amplification device, and adjust the temperature through the temperature adjustment button to carry out isothermal amplification reaction at 37 - 44 °C; S3. Chromatographic detection: Dilute the amplification product with pure water and then drop it onto the sample addition area of the test strip, and observe the color development result within 10 - 15 minutes; The isothermal amplification device has a split cavity structure, including an upper cavity and a lower cavity. There is a heat preservation inner container and a centrifuge tube holder in the upper cavity, and a heating plate in the lower cavity, which can heat the upper cavity. A temperature display screen and temperature adjustment buttons are set outside the device. After charging the isothermal amplification device, wireless temperature control heating can be realized, which is suitable for field detection. Prepare the reaction system using the test strip type nucleic acid amplification kit (ERA method) of Suzhou Xianda Technology Co., Ltd., as shown in Table 1 specifically: Table 1 Reaction System

[0039] Use a metal bath device, reaction conditions: constant temperature at 37 - 44 °C, reaction time 10 min.

[0040] After the reaction is completed, extract 5 μL of the reaction product, add pure water to dilute and mix evenly, with a dilution factor of 40 - 120 times; aspirate 80 μL of the diluted reaction product and drop it on the sample addition area of the test strip, incubate at room temperature for 10 min, and observe the results. If only the C line (control band) appears on the test strip, the test result is negative for APV1 nucleic acid; if both the C line and the T line (test band) appear, the test result is positive for APV1 nucleic acid.

[0041] Using water as the negative control and the APV1 virus as the template (positive control), the test results are shown in Figure 1 . From this result, it can be seen that the reaction system and reaction method of the present invention can better detect the betel nut APV1 virus.

[0042] Example 2 Adopt the reaction system and detection method in Example 1, respectively using the nucleic acids of betel nut necrosis ring spot virus (ANRSV) and betel nut necrosis fusiform spot virus (ANSSV) as templates for RPA - LFD amplification, using the APV1 virus nucleic acid as the positive control and water as the negative control; conduct a specificity experiment.

[0043] The test results are shown in Figure 2 , and this result shows that the detection method established by the present invention only shows positive when the APV1 virus RNA is used as the template, and there is no cross - reaction with other viruses.

[0044] Example 3 Dilute the crude extract containing the APV1 virus by 10 - fold gradient, use the crude extract at each dilution as the template for RPA - LFD amplification, and use water as the negative control; conduct a detection limit experiment.

[0045] The test results are shown in Figure 3, the results showed that when the template amount was 100 copies, the test result was still positive; when the template amount was 10 copies, the T line could not be seen and it was determined to be negative. Therefore, the detection limit of the RPA-LFD detection method for Areca yellowing disease-related APV1 virus established by the present invention was 100 copies of the template amount.

[0046] Example 4 The performance of the detection system for rapid detection of Areca yellowing virus APV1 (RPA-LFD detection system) of the present invention was compared with that of the traditional RT-PCR detection system. 32 samples were taken from the Zhongyuan Agricultural Experiment and Demonstration Base in Zhongyuan Town, Qionghai City, Hainan Province and were detected by RT-PCR and the detection system of the present invention respectively. The results showed that the detection results of the present invention were all consistent with those of RT-PCR. The results are shown in Figure 4 .

[0047] Comparative Example 1 In this comparative example, some primers screened and eliminated by the present invention and the data of their detection limit effects were provided. The specific primer and probe sequences are shown in Table 2; the specific determination method of the detection limit was the same as that in Example 3, and the detection results of the detection limit are shown in Figure 5 shown. The results showed that the primer pair screened by the present invention had the best detection effect.

[0048] Table 2 Eliminated primer sets

[0049] It should be understood that various forms of the processes shown above can be used, steps can be reordered, added or deleted. For example, the steps recorded in the disclosure of the present invention can be executed in parallel, sequentially or in different orders, as long as the desired results of the technical solution disclosed by the present invention can be achieved, which is not limited herein.

[0050] The above specific embodiments do not constitute a limitation to the protection scope of the present invention. Those skilled in the art should understand that various modifications, combinations, sub-combinations and substitutions can be made according to design requirements and other factors. Any modifications, equivalent substitutions and improvements made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A method for rapid detection of Areca palm yellowing virus APV1 based on RPA-LFD technology, using a detection system for rapid detection of Areca palm yellowing virus APV1, characterized in that: Specifically, it includes the following steps: S1. Coarse extraction of the sample: Take 50 - 100 mg of areca nut leaf tissue in a mortar, add the sample slow-release solution and grind to obtain a crude extract, and coarsely extract viral RNA from the sample to be tested; S2. Isothermal amplification: Using the RNA obtained in step S1 as a template, add it to the RPA reaction system containing a specific primer pair and a probe, insert the centrifuge tube into the centrifuge tube rack in the constant temperature amplification device, adjust the temperature through the temperature adjustment button, and perform an isothermal amplification reaction at 37 - 44 °C; The nucleotide sequence of the upstream primer in the specific primer pair is as shown in Sequence Listing SEQ ID No.1, and the nucleotide sequence of the downstream primer is as shown in Sequence Listing SEQ ID No.2; the nucleotide sequence of the modified probe is as shown in Sequence Listing SEQ ID No.3; S3. Chromatographic detection: Dilute the amplification product with pure water and then drop it onto the sample application area of the test strip, and observe the color development result within 10 - 15 minutes; among them, the judgment criteria for the detection result are: When the control line on the test strip shows color and the test line does not show color, it is determined to be negative for APV1; When both the control line and the test line on the test strip show color, it is determined to be positive for APV1.

2. The method for rapidly detecting Areca palm yellowing virus APV1 based on the RPA-LFD technology according to claim 1, wherein: The 5' end of the downstream primer is modified with a Biotin group.

3. A method for rapid detection of Areca palm yellowing virus APV1 based on RPA-LFD technology according to claim 1 or 2, characterized in that: In the detection system, each 50 μL reaction system contains 21 ± 3 pmoL of the upstream primer, 21 ± 3 pmoL of the downstream primer, and 6 ± 1 pmoL of the probe; Reaction conditions: The reaction temperature of the RPA reaction is a constant temperature of 37 - 44 °C, and the reaction time is 10 ± 2 min; the temperature for detection using a lateral flow immunoassay test strip is room temperature, and the time is 10 ± 1 min.

4. A method for rapidly detecting Areca palm yellowing virus APV1 based on the RPA-LFD technology according to claim 3, characterized in that: The reaction system includes the following components and dosages: The reaction time of the RPA-LFD reaction is 10 min.

5. A method for rapidly detecting Areca palm yellowing virus APV1 based on the RPA-LFD technology according to claim 1, characterized in that: The constant temperature amplification device has a split cavity structure, including an upper cavity and a lower cavity; the upper cavity is provided with a heat preservation inner liner and a centrifuge tube rack, and the lower cavity is provided with a heating plate for heating the upper cavity; a temperature display screen and a temperature adjustment button are arranged outside the constant temperature amplification device; the constant temperature amplification device is provided with a charging interface, and wireless temperature control heating can be achieved after charging.

Images