MiRNA markers for diagnostic assessment of cardiac muscle aging, kits and uses thereof

Abstract

The application discloses a kind of detection miRNA marker's material and application, including one or more of the following applications: A1) in the application in preparation diagnosis myocardial senescence product;A2) in the application in preparation screening myocardial senescence product;A3) in the application in preparation treatment myocardial senescence product;A4) in the application in preparation myocardial senescence prognosis evaluation product;A5) in the application in preparation myocardial senescence and other diseases product in product of differential distinction;miRNA marker is hsa-miR-186-5p, nucleotide sequence is as shown in SEQ ID No.1.The hsa-miR-186-5p marker provided by the application is significantly increased in the expression amount in the plasma of myocardial senescence patient compared with healthy control, indicating that hsa-miR-186-5p is a potential myocardial senescence biomarker.The ROC curve of the efficiency of hsa-miR-186-5p in diagnosing myocardial senescence patient shows that hsa-miR-186-5p has good diagnostic efficiency.

Description

Technical Field

[0001] This invention relates to a biomarker for diagnosing myocardial aging, specifically a miRNA biomarker, and also to a kit for detecting the miRNA biomarker and its application, belonging to the field of medical molecular diagnostics. Background Technology

[0002] Aging is a continuous process that accompanies an individual throughout their life; unlike disease, it affects everyone. Although aging is determined by genetic programming, environmental factors have a significant impact, leading to considerable differences in the rate of aging among individuals. Therefore, an individual's physiological aging may be faster or slower than their chronological age. With increasing age, physiological aging causes a gradual decline in the function of multiple organ systems, while the incidence of cardiovascular diseases (CAD), including myocardial disease and coronary artery disease, also increases. In an era of population aging, improving the diagnosis and treatment of myocardial aging-related diseases has become an important research direction, requiring in-depth research into the key etiological factors and molecular biological causes of myocardial aging.

[0003] Aging leads to increased left ventricular (LV) wall thickness and decreased diastolic function; these pathological changes are considered endogenous cardiac aging and are independent of traditional cardiovascular disease risk factors such as smoking, hypertension, high blood lipid levels, and diabetes. To compensate for reduced LV filling due to increased LV wall thickness, atrial contractions and atrial pressure gradually increase with age, which promotes atrial hypertrophy and increases the incidence of atrial fibrillation. Impaired early diastolic filling and increased atrial contractions gradually lead to diastolic dysfunction, which is very common in the elderly. However, early diastolic dysfunction cannot be fully detected with existing instruments, thus requiring a new diagnostic approach to identify pathophysiological changes caused by myocardial aging.

[0004] MicroRNAs (miRNAs) are highly conserved, small ribonucleic acids with regulatory functions, approximately 22 nucleotides in length. By binding to messenger RNA (mRNA), miRNAs can inhibit translation. Due to their short seed sequences (approximately 6 nt), some miRNAs have been hypothesized and experimentally demonstrated to regulate signaling pathways and their downstream targets. Due to their multifunctionality, miRNA dysregulation is associated with a variety of diseases, including cancer and cardiovascular disease. Numerous studies have confirmed the importance of miRNA regulation, and therapeutic silencing is underway. However, because miRNAs are widely distributed in organisms (e.g., in blood circulation) and a single miRNA may have multiple target mRNAs, precisely elucidating the specific mechanisms of each miRNA remains challenging. There is an urgent need to apply miRNAs to clinical diagnosis and treatment, especially when considering them as potential therapeutic targets. The use of miRNAs as diagnostic and therapeutic targets for myocardial aging is still relatively rare; further research in this area will have significant implications for the clinical diagnosis and treatment of myocardial aging. Summary of the Invention

[0005] The primary technical problem this invention aims to solve is to provide a novel application of miRNA biomarkers. These miRNA biomarkers can not only be used to prepare substances for diagnosis, screening, disease assessment, and differentiation of myocardial aging from other heart diseases, but also serve as new therapeutic targets for diseases related to myocardial aging.

[0006] Another technical problem to be solved by this invention is to provide a kit for detecting this miRNA biomarker. This kit can be used for the diagnosis, screening, assessment, and differentiation of myocardial aging from other heart diseases.

[0007] The third technical problem to be solved by this invention is to provide a primer for detecting this miRNA marker. This primer can be used for diagnosis, screening, assessment, and differentiation of myocardial aging from other heart diseases.

[0008] To achieve the above-mentioned technical objectives, the present invention adopts the following technical solution:

[0009] According to a first aspect of the present invention, an application of a substance for detecting miRNA biomarkers is provided, comprising one or more of the following applications:

[0010] A1) Application in the preparation of diagnostic products for myocardial aging;

[0011] A2) Application in the preparation of products for screening myocardial aging;

[0012] A3) Application in the preparation of products for treating myocardial aging;

[0013] A4) Application in the preparation of prognostic assessment products for myocardial aging;

[0014] A5) Application in the preparation of products for differentiating and distinguishing myocardial aging from other diseases;

[0015] The miRNA marker is hsa-miR-186-5p, and its nucleotide sequence is shown in SEQ ID No. 1.

[0016] The "products" described above can be products used to diagnose myocardial aging by detecting the expression level of hsa-miR-186-5p through RT-PCR, real-time quantitative PCR, in situ hybridization, microarray or high-throughput sequencing platforms.

[0017] In the above applications, hsa-miR-186-5p expression was significantly upregulated in plasma samples from patients with myocardial aging; the expression level of hsa-miR-186-5p in healthy individuals was significantly lower than that in patients with myocardial aging.

[0018] Preferably, the substance is a reagent for detecting the expression level of hsa-miR-186-5p, or for specifically recognizing hsa-miR-186-5p, or for detecting the content of hsa-miR-186-5p.

[0019] Preferably, the substance is a substance used to detect hsa-miR-186-5p, specifically a), b), or c) below.

[0020] a) Primers used for detecting or specifically recognizing hsa-miR-186-5p;

[0021] b) A reagent group containing the reagents described in a);

[0022] c) A kit containing either a) or b).

[0023] Preferably, the primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0024] According to a second aspect of the present invention, a kit for detecting miRNA biomarkers is provided, the kit comprising one or more of the following applications:

[0025] A1) Application in the preparation of diagnostic products for myocardial aging;

[0026] A2) Application in the preparation of products for screening myocardial aging;

[0027] A3) Application in the preparation of products for treating myocardial aging;

[0028] A4) Application in the preparation of prognostic assessment products for myocardial aging;

[0029] A5) Application in the preparation of products for differentiating and distinguishing myocardial aging from other diseases;

[0030] The miRNA marker is hsa-miR-186-5p, and its nucleotide sequence is shown in SEQ ID No. 1. The kit includes reagents for detecting or specifically recognizing hsa-miR-186-5p, or reagents for detecting the expression level of hsa-miR-186-5p.

[0031] Using the kit provided by this invention, the expression of the hsa-miR-186-5p characteristic gene sequence shown in SEQ ID NO.1 in the peripheral blood of the subject can be detected. Then, based on the information of upregulation or downregulation of these gene expressions, the probability of myocardial aging in the subject can be determined, thereby realizing the diagnosis of myocardial aging.

[0032] The kit provided by this invention may include appropriate packaging and instructions for use in the methods disclosed herein. Preferably, the detection kit provided by this invention is a nucleic acid detection kit, including reagents required for RNA extraction and quantitative real-time PCR (qRT-PCR). The kit may further include appropriate buffers and polymerases, and may also include control primers and / or probes.

[0033] Preferably, the reagent used for detecting or specifically recognizing hsa-miR-186-5p is a specific primer, wherein the specific primer is the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0034] According to a third aspect of the present invention, a primer for detecting miRNA markers is provided, the primer comprising one or more of the following applications:

[0035] A1) Application in the preparation of diagnostic products for myocardial aging;

[0036] A2) Application in the preparation of products for screening myocardial aging;

[0037] A3) Application in the preparation of products for treating myocardial aging;

[0038] A4) Application in the preparation of products for assessing myocardial aging;

[0039] A5) Application in the preparation of products for differentiating and distinguishing myocardial aging from other diseases;

[0040] The primers are used to detect the expression level of hsa-miR-186-5p or to specifically recognize hsa-miR-186-5p.

[0041] Preferably, the primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0042] Compared with the prior art, the present invention has the following technical effects:

[0043] (1) The miRNA hsa-miR-186-5p provided by this invention can serve as a novel biomarker for the diagnosis of myocardial aging. The expression level of hsa-miR-186-5p in the plasma of patients with myocardial aging is significantly higher than that in the plasma of healthy controls, indicating that hsa-miR-186-5p is a potential biomarker for myocardial aging and can be used for the diagnosis, screening, assessment and / or differentiation of myocardial aging from other diseases in product applications.

[0044] (2) The ROC curve of hsa-miR-186-5p in diagnosing patients with myocardial aging shows that hsa-miR-186-5p has good sensitivity and specificity and good diagnostic efficacy.

[0045] (3) In clinical trials, the expression levels of human plasma BNP and hsa-miR-186-5p showed a positive correlation. BNP is a peptide hormone synthesized by the heart when the ventricular wall is expanded or stretched. It reflects the heart's compensatory function and is a marker for evaluating cardiac function, mainly used to diagnose heart failure. hsa-miR-186-5p was positively correlated with BNP levels. These results indicate that the level of hsa-miR-186-5p in plasma can reflect the severity of myocardial aging, suggesting that hsa-miR-186-5p can be used to prepare products for assessing myocardial aging.

[0046] (4) The expression levels of galactosidase, a marker of cardiomyocyte aging, and hsa-miR-186-5p showed a good correlation and a positive correlation, indicating that hsa-miR-186-5p is definitely related to cell aging and has good diagnostic efficacy.

[0047] (5) In in vitro cell validation experiments, the expression level of hsa-miR-186-5p in D-gal-treated AC16 cells was higher than that in the normal control; indicating that the level of hsa-miR-186-5p increases during cardiomyocyte aging, which is the cellular and molecular basis for hsa-miR-186-5p as a diagnostic biomarker for myocardial aging. This experiment further verified the relationship between hsa-miR-186-5p and myocardial aging. Knockdown of hsa-miR-186-5p in the D-gal-induced cell aging model alleviated the aging condition, which also proves that hsa-miR-186-5p is expected to become a new diagnostic biomarker and therapeutic target for myocardial aging. Attached Figure Description

[0048] Figure 1 A heatmap showing the differential expression of miRNAs in senescent cardiomyocytes and normal controls obtained through sequencing.

[0049] Figure 2 To determine the hsa-miR-186-5p content in the plasma of patients with myocardial aging and normal controls using qRT-PCR;

[0050] Figure 3 ROC curve for hsa-miR-186-5p in patients with myocardial aging;

[0051] Figure 4 To further determine the hsa-miR-186-5p content in the plasma of patients with myocardial aging and normal controls in the external validation population using qRT-PCR;

[0052] Figure 5 ROC curves for diagnosing hsa-miR-186-5p in an external validation population of patients with myocardial aging;

[0053] Figure 6 The relationship between human plasma BNP and hsa-miR-186-5p expression levels;

[0054] Figure 7 The relationship between the positive rate of galactosidase, a marker of aging, in D-gal-induced cardiomyocytes and the expression level of hsa-miR-186-5p;

[0055] Figure 8A The graph shows the expression level of hsa-miR-186-5p after transfection of cardiomyocytes with hsa-miR-186-5p small interfering RNA.

[0056] Figure 8B This is a graph showing the expression level of mRNA in cardiomyocytes after transfection with hsa-miR-186-5p small interfering RNA.

[0057] Figure 9A To determine the expression of D-gal-induced P21 mRNA in cardiomyocytes after knocking down hsa-miR-186-5p in s iRNA;

[0058] Figure 9B To determine the expression of D-gal-induced IL-1β mRNA in cardiomyocytes after knocking down hsa-miR-186-5p with siRNA;

[0059] Figure 10 To determine the expression of BNP in the supernatant of cardiomyocytes after D-gal treatment in patients with knockdown of hsa-miR-186-5p and control group.

[0060] Figure 11A A diagram illustrating the cell cycle of cardiomyocytes after senescence induced by the inducer D-gal, as determined by flow cytometry.

[0061] Figure 11B This figure shows the cell cycle of cardiomyocytes after senescence induction with the inducer D-gal following hsa-miR-186-5p knockdown, as determined by flow cytometry. Detailed Implementation

[0062] The technical content of the present invention will be described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or as recommended by the manufacturer. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of skill in the art. Furthermore, any methods and materials similar to or equivalent to those described herein can be applied to the methods provided by the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0063] The research and development process and approach of this invention: First, total RNA was extracted from three naturally aging cardiomyocytes (AC 16) and three normal control cells and sent to Guangzhou Epigenetics Co., Ltd. for miRNA sequencing. miRNAs with significantly different expression levels (Fo ld change ≥ 2.0, P < 0.05) were screened. Then, the levels of the top 10 miRNAs in the patient's plasma were measured using qRT-PCR, and the most significantly elevated miRNA was used for subsequent experiments. The inventors then further verified the relationship between hsa-miR-186-5p expression and myocardial aging using in vitro cellular experiments. Specific data are as follows: Example 1: Myocardial Failure Screening and Correlation Study of Old miRNA Biomarkers

[0064] 1. Clinical Samples:

[0065] Venous blood was collected upon admission from 50 patients aged 60-90 years who were hospitalized at the General Hospital of the Chinese People's Liberation Army between 2020 and 2023, excluding other heart diseases. Venous blood was also collected from 50 healthy individuals aged ≤30 years during physical examinations. The participants were divided into a control group and an aging group for subsequent measurement of plasma miRNA levels.

[0066] The external validation population consisted of 52 inpatients aged 60-90 years who were hospitalized at Fuwai Hospital, Chinese Academy of Medical Sciences, between 2022 and 2023, excluding those with other heart diseases. Additionally, 44 healthy individuals aged ≤30 years were included. Venous blood samples were collected upon admission, and the participants were divided into a control group and an aging group. Clinical data were recorded for all participants.

[0067] Inclusion criteria:

[0068] (1) Inpatients aged 60 to 90 years;

[0069] (2) Healthy individuals aged ≤30 years undergoing physical examinations;

[0070] (3) Complete blood sample data is available.

[0071] Exclusion criteria: malignant tumors, severe liver and kidney dysfunction, severe autoimmune diseases, severe hematologic disorders or other cardiovascular diseases such as coronary heart disease, valvular heart disease, cardiomyopathy and peripheral vascular disease, etc.

[0072] 2. Plasma extraction:

[0073] Human peripheral blood was collected using EDTA anticoagulant blood collection tubes. The tubes were centrifuged at 2500g for 15 minutes, and the supernatant plasma was transferred to a 2ml sterile tube and stored at -80℃.

[0074] 3. RNA extraction and quantitative real-time PCR (qRT-PCR):

[0075] Total RNA was extracted from AC 16 using the RNA-simple Total RNA Kit (DP419, TIANGEN, Beijing, China).

[0076] 3.1 RNA Extraction

[0077] RNA was extracted from plasma samples according to the TRIZOL Reagent (Invitrogen) instructions. 1 ml of TRIZOL Reagent (Invitrogen) and 200 μL of chloroform were added to the plasma, vortexed for 20 seconds, and incubated at room temperature for 10 minutes. The plasma was then centrifuged at 13000 rpm for 15 minutes at 4°C. The supernatant was carefully aspirated, and 800 μL of isopropanol was added. The mixture was gently mixed by inverting the container and incubated at -20°C for 1 hour. The supernatant was then discarded. 1 ml of 75% ethanol was added to gently wash the precipitate. The precipitate was centrifuged at 4°C for 13000 rpm for 5 minutes, and the supernatant was removed. The precipitate was dried. An appropriate amount of enzyme-free water was added, and the precipitate was dissolved at 65°C for 10 minutes. The OD value and concentration of the RNA were then measured. The RNA was stored at -80°C for later use.

[0078] 3.2 RNA reverse transcription to synthesize cDNA

[0079] 500 ng of RNA was reverse transcribed into cDNA using a reverse transcription kit (Takara RR037A).

[0080] 3.3 Reverse transcription of miRNAs:

[0081] Perform on ice, with 20 μL for each reaction system, as shown in the table below:

[0082] Table 1

[0083]

[0084] 3.4 Reverse transcription of mRNA:

[0085] Perform on ice, with 20 μL for each reaction system, as shown in the table below:

[0086] Table 2

[0087]

[0088] The reaction procedure was: 37℃ for 45 min, 85℃ for 5 min, and maintained at 4℃.

[0089] 3.5 qRT-PCR

[0090] miRNA primer sequences were designed based on miRNA primer design principles.

[0091] The cDNA obtained from the reverse transcription reaction was diluted 1:10 and then subjected to the following qRT-PCR reaction:

[0092] Perform the operation on ice, using 20 μL for each reaction system, as shown in the table below:

[0093] Table 3

[0094]

[0095] After mixing the reaction solution, the Real-time PCR instrument reaction program is as follows:

[0096] Stage 1: 95℃ for 2 minutes;

[0097] Stage 2: Cycle 35, 94℃ for 5s, 60℃ for 1min;

[0098] Stage 3: 95℃15s, 60℃1min, 95℃5s;

[0099] The relative levels of each mRNA were quantified using GAPDH and expressed as relative ratios.

[0100] 4. miRNA sequencing analysis:

[0101] Total RNA was extracted from three naturally aging AC 16 cardiomyocytes and three normal control cells and sent to Guangzhou Epigenetics Co., Ltd. for miRNA sequencing. miRNAs with significantly different expression levels (Fold change ≥ 2.0, P value < 0.05) were screened. The content of the top 10 miRNAs in the patient's plasma was then measured by qRT-PCR. The marker with the highest expression level was used for the following experiments.

[0102] The results are as follows Figure 1 As shown in Table 4. Figure 1 This is a heatmap showing the difference in miRNA expression between senescent cardiomyocytes and normal controls obtained from sequencing. Table 4 lists the top 10 upregulated miRNAs obtained from sequencing data.

[0103] Table 4 shows the top 10 upregulated miRNAs obtained from sequencing data.

[0104]

[0105] 5. ROC curve plotting:

[0106] The receiver operating characteristic (ROC) curve is a curve obtained by plotting the true positive rate and false positive rate, and it can be used to reflect the relationship between sensitivity and specificity. It is plotted with sensitivity on the ordinate and 1-specificity on the abscissa, using a series of cutoff values ​​based on the measurements of the experimental and control groups. Sensitivity and specificity are calculated separately for each cutoff value, and the lines connecting these points form the ROC curve. The ROC curve was plotted using GraphPad Prism software. The ROC curve reflects the diagnostic efficacy of the biomarker for the disease.

[0107] 6. Statistical Analysis:

[0108] For normally distributed variables, t-tests and ANOVA were used; for non-normally distributed variables, Mann-Whitney U tests and Kruskal-Wallis tests were used. Statistical analysis was performed using R software (v 3.4.2) and GraphPad Prism software (v 8.00). Biological replicates were displayed as single data points superimposed on the bar chart. P < 0.05 was considered statistically significant.

[0109] 7. Experimental Results:

[0110] like Figure 2 As shown, the hsa-miR-186-5p content in the plasma of patients with myocardial aging was determined using qRT-PCR. The results showed that the expression of hsa-miR-186-5p in the plasma of patients with myocardial aging was significantly higher than that in healthy controls, indicating that hsa-miR-186-5p is a potential biomarker for myocardial aging.

[0111] like Figure 3 As shown in the ROC curve, hsa-miR-186-5p has excellent specificity and sensitivity in diagnosing patients with myocardial aging, indicating that hsa-miR-186-5p has good diagnostic efficacy.

[0112] like Figure 4 As shown, after selecting an external validation population, the hsa-miR-186-5p level in the plasma of patients with myocardial aging was measured by qRT-PCR. The results showed that the expression level of hsa-miR-186-5p in the plasma of patients with myocardial aging was significantly higher than that in the plasma of healthy controls, verifying the reliability of hsa-miR-186-5p as a biomarker of myocardial aging.

[0113] like Figure 5 As shown in the ROC curve, hsa-miR-186-5p has excellent specificity and sensitivity in diagnosing patients with myocardial aging in the external validation set, indicating that hsa-miR-186-5p also has good diagnostic efficacy in the external validation set.

[0114] Example 2: Experiment on the relationship between BNP and hsa-miR-186-5p expression levels

[0115] 1. Experimental objective:

[0116] B-type natriuretic peptide (BNP) and its N-terminal precursor (N-terminal BNP) (in patients with median levels or higher) are biomarkers of cardiac function and are the preferred biomarkers for the diagnosis and differential diagnosis of heart failure, as well as for assessing disease severity and prognosis. In healthy adults, the normal BNP level should be <100 ng / L. BNP levels gradually increase with age and decline in cardiac function, and are generally considered abnormal when greater than 100 ng / L. The diagnostic criteria are based on the 2004 American College of Cardiology (ACC) expert consensus: if BNP <100 ng / L, the likelihood of heart failure is extremely low (90% negative predictive value); if BNP >500 ng / L, the likelihood of heart failure is extremely high (90% positive predictive value). A normal BNP level should be <100 ng / L; BNP levels within the normal range can rule out acute heart failure.

[0117] BNP is mainly found in the left and right atria of the heart, with the right atrium containing more than three times the amount in the left atrium. The ventricular BNP content is low because BNP precursors are not stored in the ventricles. Only when the ventricular wall tension increases will it rapidly stimulate the high expression of the BNP gene, resulting in the synthesis and secretion of large amounts into the blood. In other words, the increase in plasma BNP indicates that the heart's systolic or diastolic function is impaired, which prevents the heart from fully expelling venous blood, causing ventricular traction. Moreover, the increase in BNP exhibits a dynamic pattern.

[0118] Myocardial aging is the process by which the heart muscle gradually loses function and efficiency with age. This process may lead to weakened cardiac pumping function and poor blood circulation, thereby increasing the release of BNP. Therefore, BNP levels can serve as an important indicator for assessing myocardial aging and the risk of heart failure.

[0119] 2. Experimental Methods:

[0120] BNP assay: Whole blood from the collection tubes is allowed to stand at room temperature for at least half an hour. Then, the tubes are centrifuged at 3500–4000 rpm for 5–10 minutes to obtain plasma. The plasma or cell supernatant is measured using the ZC-34225 Brain Natriuretic Peptide (BNP) EILSA assay kit. First, 100 μL of sample is added to each well. The kit is allowed to equilibrate at room temperature for 30 minutes. Then, the required strips are removed from the foil pouch, and the remaining strips are sealed in a resealable bag and returned to 4°C. 50 μL of different concentrations of standard are added to each standard well. 50 μL of the sample to be tested is added to each sample well; no sample is added to the blank wells. Except for the blank wells, 100 μL of horseradish peroxidase (HPP)-labeled detection antibody is added to each standard and sample well. The reaction wells are sealed with sealing film and incubated at 37°C in a water bath or incubator for 60 minutes. Discard the liquid, blot dry on absorbent paper, add 350 μL of washing buffer to each well, let stand for 1 minute, shake off the washing buffer, blot dry on absorbent paper, and repeat this washing process 5 times (or a plate washer can be used). Add 50 μL each of substrate A and B to each well, and incubate at 37°C in the dark for 15 minutes. Add 50 μL of stop solution to each well, and within 15 minutes, measure the OD value of each well at a wavelength of 450 nm.

[0121] 3. Experimental Results:

[0122] like Figure 6 The figure shows the relationship between plasma BNP and hsa-miR-186-5p expression levels. The figure reveals a positive correlation between BNP and hsa-miR-186-5p expression. BNP is a marker protein of heart failure, and hsa-miR-186-5p is positively correlated with BNP levels. These results indicate that plasma hsa-miR-186-5p levels can reflect the severity of the disease.

[0123] Example 3 uses galactosidase staining to verify the relationship between hsa-miR-186-5p and myocardial aging.

[0124] 1. Experimental objective:

[0125] Normal cells cease dividing after a finite number of divisions, exhibiting irreversible growth arrest, at which point the cell enters a senescent state, and senescence-related galactosidases are activated. Galactosidases are hydrolytic enzymes within lysosomes, but their activity is upregulated in senescent cells. Based on this phenomenon and principle, using galactosides as substrates, senescent cell-specific galactosidases catalyze the substrate to produce a blue product, manifested as blue deposits in the cytoplasm. Cells or tissues expressing galactosidase, turning blue, can be easily observed under a light microscope. Galactosidase staining is the gold standard for determining cellular senescence in cell and molecular experiments.

[0126] 2. Cell culture:

[0127] Human cardiomyocyte line (AC16) was purchased from Wuhan Pronosai. The cells were cultured in RPMI-1640 medium with 10% fetal bovine plasma in a 37°C 5% carbon dioxide incubator.

[0128] 3. Cell-induced senescence treatment:

[0129] Cultured AC 16 cardiomyocytes were exposed to 10 mM D-galactose to induce cellular senescence. D-galactose (D-gal) is a well-established senescence model inducing agent, a more potent glycation agent than glucose, and capable of inducing oxidative stress. D-gal concentrations induced cytotoxicity and senescence-like changes, leading to increased BNP secretion levels in AC16 cells. Further analysis was performed after 24 hours of treatment.

[0130] 4. Galactosidase staining:

[0131] Cells were stained using the Beyotime galactosidase staining kit (C0602). In 6-well plates, the cell culture medium was aspirated, and the cells were washed once with PBS. 1 mL of galactosidase staining fixative was added, and the plates were fixed at room temperature for 15 minutes. The cell fixative was then aspirated, and the cells were washed three times with PBS for 3 minutes each time. PBS was then aspirated, and 1 mL of staining working solution was added to each well. The staining working solution was prepared as follows: 10 μL of galactosidase staining solution a, 10 μL of galactosidase staining solution b, 930 μL of galactosidase staining solution c, and 50 μL of X-Gal solution. The plates were incubated overnight at 37°C, and the 6-well plates were sealed with plastic wrap to prevent evaporation. Note: Incubation at 37°C cannot be performed in a CO2 incubator. Cells were observed under a regular optical microscope.

[0132] 5. Statistical Analysis:

[0133] Cells stained blue under an optical microscope were considered positive cells. The number of positive cells per 100 cells in a randomly selected field of view was counted to determine the percentage of positive cells (%). Correlation analysis was performed between the percentage of positive cells in each sample and hsa-miR-186-5p.

[0134] 6. Experimental Results:

[0135] like Figure 7 As shown, the expression levels of galactosidase and hsa-miR-186-5p, markers of cardiomyocyte aging, are well correlated and positively correlated, indicating that the relationship between hsa-miR-186-5p and cellular senescence is conclusive and has good diagnostic efficacy.

[0136] Example 4: In vitro experiments further validated the relationship between hsa-miR-186-5p expression and myocardial aging at the cellular level. Relationship

[0137] 1. Cell culture:

[0138] The cell culture method is the same as in Example 3.

[0139] Small interfering RNA (siRNA) knockdown method: siRNA was ordered from Thermo Fisher Scientific. According to the instructions, it was added when the cell confluence reached 70%, and the knockdown effect was measured by qRT-PCR after 24 hours of induction.

[0140] 2. Cell-induced senescence treatment is the same as in Example 3.

[0141] 3. The method for measuring BNP in myocardial cell supernatant is the same as in Example 3.

[0142] 4. The qRT-PCR method is the same as in Example 1.

[0143] 5. Flow cytometry experiments:

[0144] Remove the culture medium and wash the cells once with PBS. Digest the cells with trypsin until they can be gently pipetted off with a pipette or pipette tip. Add the previously collected cell culture medium, pipet off all adherent cells, and gently disperse the cells. Collect the cells again into a centrifuge tube. Centrifuge at approximately 1000g for 3-5 minutes to pellet the cells. For specific cell types, if cell pelleting is insufficient, the centrifugation time can be appropriately extended or the centrifugation force slightly increased. Carefully aspirate the supernatant, leaving approximately 50μL of culture medium to avoid aspirating cells. Add approximately 1ml of ice-cold PBS, resuspend the cells, and transfer to a 1.5ml centrifuge tube. Centrifuge again to pellet the cells, carefully aspirate the supernatant, leaving approximately 50μL of PBS. Add 1ml of ice-cold 70% ethanol, gently mix, and fix at 4°C for 30 minutes. Centrifuge at approximately 1000g for 5 minutes to pellet the cells. Add approximately 1ml of ice-cold PBS, resuspend the cells. Centrifuge the cell pellet again, carefully aspirating the supernatant, leaving approximately 50 μL of PBS to avoid removing cells. Gently tap the bottom of the centrifuge tube to disperse the cells appropriately, preventing clumping. Add 0.5 ml of propidium iodide staining solution to each cell sample tube, thoroughly resuspend the cell pellet, and incubate at 37°C in the dark for 30 minutes. Then store at 4°C in the dark. Detect red fluorescence at an excitation wavelength of 488 nm using flow cytometry, while simultaneously assessing light scattering.

[0145] 6. Experimental Results:

[0146] Figure 8A The graph shows the expression level of hsa-miR-186-5p after transfection of AC16 cardiomyocytes with siRNA. As can be seen from the graph, the expression level of hsa-miR-186-5p decreased after transfection. Figure 8BThe graph shows the expression level of mRNA. It can be seen that the total expression level of mRNA remains unchanged after transfection of AC16 cardiomyocytes with siRNA, indicating that the transfection knockdown of hsa-miR-186-5p was successful. Subsequent experiments were carried out based on this.

[0147] Figure 9A and Figure 9B To detect the mRNA expression of two cell senescence markers in AC16 cardiomyocytes after transfection with siRNA. Figure 9A This diagram shows the mRNA expression of P21 cell senescence protein markers in AC16 cardiomyocytes. Figure 9B The figure shows the mRNA expression of IL-1β, a key marker of cellular senescence-related phenotypes, in AC16 cardiomyocytes. It can be seen that after knocking down hsa-miR-186-5p, the expression of P21 and IL-1β mRNA decreased, indicating that knocking down hsa-miR-186-5p can slow down cellular senescence, and hsa-miR-186-5p may serve as a therapeutic target for myocardial senescence.

[0148] Figure 10 The image shows the expression levels of hsa-miR-186-5p and BNP in the cardiomyocyte supernatant after D-gal treatment in AC16 cardiomyocytes with knockdown and control groups. The results indicate that D-gal-induced senescence significantly increases BNP levels. D-gal-induced senescence leads to increased hsa-miR-186-5p expression, while knockdown of hsa-miR-186-5p results in decreased BNP expression. This provides the molecular basis for hsa-miR-186-5p as a treatment for cardiomyocyte senescence.

[0149] Figure 11A and Figure 11B To determine the cell cycle status of knockdown hsa-miR-186-5p and normal AC16 cardiomyocytes after senescence induction with the senescence-inducing reagent D-gal using flow cytometry. Figure 11A As can be seen, when cells age, their DNA loses its ability to divide, and the proportion of cells in the S phase (stationary phase) increases, characterized by an increased proportion of cells in the S phase in cell images. Figure 11B As can be seen, knocking down hsa-miR-186-5p reduced the proportion of cells in the G2 phase compared to D-gal, decreasing it to 12.5%. Cellular experiments showed that knocking down hsa-miR-186-5p reduced the proportion of D-gal-induced senescent cells, indicating that reducing hsa-miR-186-5p effectively antagonized cellular senescence. Therefore, hsa-miR-186-5p may serve as a therapeutic target for myocardial aging.

[0150] The above results indicate that hsa-miR-186-5p is significantly correlated with myocardial aging, making it a novel biomarker for myocardial aging. ROC curves show that hsa-miR-186-5p has good diagnostic capabilities for patients with myocardial aging. hsa-miR-186-5p expression is upregulated in cardiomyocytes treated with the aging-inducing agent D-gal, suggesting that hsa-miR-186-5p may be involved in the D-gal-induced senescence effect on cardiomyocytes. Flow cytometry analysis of the cell cycle in hsa-miR-186-5p-knockout cardiomyocytes after D-gal-induced senescence showed that knocking down hsa-miR-186-5p can alleviate D-gal-induced cellular senescence. In conclusion, hsa-miR-186-5p holds promise as a novel diagnostic biomarker and therapeutic target for myocardial aging.

[0151] Example 5: Composition of the sequences, primers, and reagent kits involved in this invention.

[0152] The nucleotide sequence of the myocardial aging biomarker hsa-miR-186-5p provided by this invention is shown in SEQ ID No.1, source: miRBase database, number: MIMAT0000456.

[0153] SEQ ID No.1: CAAAGAATTCTCCTTTTGGGCT

[0154] The primer pair specifically recognizing hsa-miR-186-5p provided by this invention includes the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3:

[0155] SEQ ID No.2:ATGCGCGCCAAAGAATTCTCC

[0156] SEQ ID No.3: GTCGTATCCAGTGCAGGGTCC

[0157] The reagent kit provided by this invention consists of:

[0158] 5x primer buffer, reaction enzyme combination I, Random 6mers, Oligo dT primer, RNase-free purified water, SYBR probe II (Tli RNaseH Plus) (2x), PCR Primer (F+R) (10μM), ROX Reference dye (50x).

Claims

1. The application of a substance for detecting miRNA biomarkers, characterized in that... Including one or more of the following applications: A1) Application in the preparation of diagnostic products for myocardial aging; A2) Application in the preparation of products for screening myocardial aging; The miRNA marker is hsa-miR-186-5p, and its nucleotide sequence is shown in SEQ ID No.

1.

2. The application as described in claim 1, characterized in that: The product is designed to diagnose myocardial aging by detecting the expression level of hsa-miR-186-5p using RT-PCR, real-time quantitative PCR, in situ hybridization, microarray, or high-throughput sequencing platforms.

3. The application as described in claim 1, characterized in that: The substance is a reagent used to detect the expression level of hsa-miR-186-5p, or to specifically identify hsa-miR-186-5p, or to detect the content of hsa-miR-186-5p.

4. The application as described in claim 1, characterized in that: The substance is used to detect hsa-miR-186-5p, specifically a), b), or c) below. a) Primers used for detecting or specifically recognizing hsa-miR-186-5p; b) A reagent group containing the reagents described in a); c) A kit containing either a) or b).

5. The application as described in claim 4, characterized in that: The primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

Images