An indel molecular marker related to effective right teat number trait on pig chromosome 11 and application thereof
By detecting the InDel molecular marker on pig chromosome 11 and selecting dominant alleles for marker-assisted breeding, the problem of unclear genetic mechanism of effective teat number in sows has been solved, and the weaning survival rate and economic benefits of piglets have been improved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-18
- Publication Date
- 2026-05-29
AI Technical Summary
In existing technologies, the genetic mechanism of the number of effective teats in sows is unclear, which makes it difficult to meet the suckling needs of piglets, affecting weaning survival rate and economic benefits.
This invention provides an InDel molecular marker located on pig chromosome 11, its primer pair, and a kit for detecting the number of effective right teats in pigs. By selecting dominant alleles for molecular marker-assisted breeding, the number of effective teats can be increased generation by generation.
It improved the weaning survival rate and lactation ability of piglets, enhanced the economic benefits of breeding pigs, and shortened the breeding process.
Smart Images

Figure CN120193096B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of molecular biotechnology and molecular marker technology, specifically relating to an InDel molecular marker located on pig chromosome 11 that is associated with the trait of the number of effective right nipples and its application. Background Technology
[0002] The survival rate of piglets from birth to weaning has always been a key concern in the pig farming industry, as it affects both the profitability of the enterprise and the health of the animals, making it a significant economic indicator. In recent years, although the number of piglets per litter has increased annually, a portion of piglets still die within five days of birth due to not consuming colostrum or consuming insufficient amounts, highlighting the continued significant challenge to piglet survival after birth.
[0003] Based on whether pig teats possess normal physiological morphology, lactation, and nursing function, the number of pig teats can be divided into functional teat number (FTN) and non-functional teat number (NFTN). Functional teat number refers to the number of teats in a sow that can normally secrete milk and effectively nurse piglets during lactation; it is one of the important indicators for measuring sow reproductive performance and lactation capacity. A higher number of functional teats indicates stronger lactation capacity in sows and higher weaning survival rates for piglets. However, current research results indicate that selection based on litter size is more effective than selection based on the number of functional teats, resulting in a lower number of functional teats than litter size, making it difficult to meet the nursing needs of piglets. Therefore, a better understanding of the genetic mechanisms of functional teat number and strengthening the selection based on the number of functional teats are essential for improving piglet weaning survival rates.
[0004] In recent years, with the continuous development and maturation of sequencing technology, genome-wide association study (GWAS) has become an important tool for screening variants related to economic traits in livestock and poultry. GWAS efficiently performs association analysis between phenotypes and genotypes by detecting millions of genetic markers, such as SNPs, InDels, and SVs, in large-scale samples, searching for candidate genes associated with complex traits. With the widespread application of GWAS in pig breeding improvement, 977 QTLs related to the number of pig teats have been included in the Pig QTL database. Candidate genes include VRTN, SPRY4, FGF1, and CPVL. While there are many research reports on the number of pig teats, there are relatively few reports on the number of effective teats, and the specific genetic mechanisms and major genes involved in the number of effective teats remain unclear. Summary of the Invention
[0005] In order to overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide an InDel molecular marker located on chromosome 11 of pigs that is associated with the trait of the number of effective right nipples.
[0006] Another object of the present invention is to provide a primer pair for detecting the above-mentioned InDel molecular marker.
[0007] Another object of the present invention is to provide a kit for detecting the above-mentioned InDel molecular marker, the kit comprising the above-mentioned primer pair.
[0008] A fourth objective of this invention is to provide applications of the aforementioned InDel molecular markers, primer pairs, and kits.
[0009] The fifth objective of this invention is to provide a method for genetic improvement of pigs.
[0010] The objective of this invention is achieved through the following technical solution:
[0011] An InDel molecular marker located on pig chromosome 11 and associated with the effective right teat count trait is described. The InDel site corresponds to the CCAG / C deletion mutation at positions 6990232 to 6990235 on chromosome 11 of the International Pig Reference Genome Version 11.1. Polymorphism of the bases at this site affects the effective right teat count trait in pigs. Pigs with the CCAG / C and CC (homozygous deletion) genotypes have a higher effective right teat count than pigs with the CCAG / CCAG genotype.
[0012] The pigs mentioned are Large White and its synthetic strains;
[0013] The preferred pigs are Danish Large White pigs and their synthetic lines;
[0014] The nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO: 1, where M in the sequence is CCAG or C, which leads to the difference in the number of effective right teats in pigs;
[0015] The InDel molecular marker is a deletion mutation of CCAG / C at positions 78 to 81 of the sequence marked in SEQ ID NO: 1 (corresponding to the deletion mutation of CCAG / C at positions 6990232 to 6990235 on chromosome 11 of the International Pig Reference Genome Version 11.1, named: g.78CCAG>C);
[0016] A primer pair for detecting the aforementioned InDel molecular marker, comprising primer P001-F and primer P002-R, has the following nucleotide sequence:
[0017] P001-F: 5'-GGCACGAGGAATACACAA-3';
[0018] P002-R: 5'-CTCACACGACTTGGCTTC-3';
[0019] A kit for detecting the above-mentioned InDel molecular marker, comprising the above-mentioned primer pair;
[0020] The InDel molecular markers, primer pairs, or kits described herein are used in identifying the trait of the number of effective right teats in pigs, screening for pig breeds with multiple effective right teats, high piglet nursing rates, or high piglet weaning survival rates, or in the genetic breeding of the trait of the number of effective right teats in pigs.
[0021] The genetic breeding method is preferably marker-assisted breeding;
[0022] The pigs mentioned are Large White and its synthetic strains;
[0023] The preferred pigs are Danish Large White pigs and their synthetic lines;
[0024] The application of the InDel molecular marker in gene editing;
[0025] A method for detecting the number of valid right teats in pigs includes the following steps:
[0026] The InDel molecular markers mentioned above were detected on pig chromosome 11. Based on whether the InDel site nucleotide of the InDel molecular marker was CCAG or C, the effective right teat number trait in pigs was determined. Among them, the effective right teat number of pigs with CCAG / C and CC (homozygous deletion) genotypes was higher than that of pigs with CCAG / CCAG genotypes.
[0027] The method for screening pig breeds with multiple effective right teat counts, high piglet nursing rates, or high piglet weaning survival rates using the aforementioned InDel molecular markers includes the following steps:
[0028] The InDel molecular markers described above were detected on pig chromosome 11. Based on the base sequence of the InDel molecular marker sites, individuals with the CCAG / CCAG genotype were eliminated, while individuals with the CCAG / C or CC genotypes were retained. Among them, the number of effective right teats in pigs with the CCAG / C and CC (homozygous deletion) genotypes was higher than that in pigs with the CCAG / CCAG genotype.
[0029] The detection method includes the following steps:
[0030] (1) Extract genomic DNA from the pigs to be tested;
[0031] (2) Using the primer pairs mentioned above or the primer pairs in the kit mentioned above as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, PCR amplification is performed to obtain PCR amplification products.
[0032] (3) Sequencing the PCR amplification products to obtain sequencing results;
[0033] (4) Based on the sequencing results, determine the genotype of the InDel molecular marker;
[0034] The pigs mentioned are Large White and its synthetic strains;
[0035] The preferred pigs are Danish Large White pigs and their synthetic lines;
[0036] A method for genetic improvement of pigs, comprising the following steps:
[0037] The sites of the aforementioned InDel molecular markers in the core breeding pig population were determined, and corresponding selections were made based on the molecular markers: breeding pig individuals with the CCAG / C or CC genotype at loci 6990232 to 6990235 on chromosome 11 of the International Swine Reference Genome Version 11.1 were selected from the core breeding pig population, and breeding pig individuals with the CCAG / CCAG genotype at loci 6990232 to 6990235 were culled, so as to increase the frequency of allele C at this locus generation by generation, thereby increasing the effective right teat count of offspring pigs;
[0038] The pigs mentioned are Large White and its synthetic strains;
[0039] The preferred pigs are Danish Large White pigs and their synthetic lines;
[0040] The present invention has the following advantages and effects compared with the prior art:
[0041] (1) This invention studies and determines that the InDel molecular marker affecting the number of effective right teats in pigs is located on the nucleotide sequence of chromosome 11 of pigs, verifies its effect on the trait of the number of effective right teats, and finally establishes an efficient and accurate molecular marker-assisted breeding technology, which is applied to the genetic improvement of increasing the number of effective right teats in breeding pigs, thereby improving the suckling ability of offspring pigs, increasing the weaning survival rate of piglets, increasing the economic profit of enterprises, and increasing core competitiveness.
[0042] (2) The present invention provides a primer pair and kit for detecting the above-mentioned InDel molecular marker. With the primer pair and kit, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select the effective right nipple number trait and accelerate the breeding process.
[0043] (3) The present invention provides a method for genetic improvement of pigs. By selecting the dominant allele of InDel, the frequency of the dominant allele can be increased generation by generation, the number of effective right teats of breeding pigs can be increased, and superior breeding pigs with the above-mentioned traits can be bred, thereby accelerating the progress of pig genetic improvement and effectively improving the economic benefits of breeding pigs. Attached Figure Description
[0044] Figure 1 This is a Manhattan plot of the genome-wide association study (GWAS) on chromosome 11 in Danish Large White pigs, performed using GCTA software. The x-axis represents the chromosome number of the pig, and the y-axis represents -log[i, j]. 10 P-value.
[0045] Figure 2 This is a Manhattan plot of the genome-wide association analysis (GWAS) performed on chromosome 11 of Danish Large White pigs using the FASTmrMLM model in mrMLM software, focusing on the effective right teat count trait. The x-axis represents the pig's chromosome number, and the principal y-axis represents -log... 10 The P-value is represented by the secondary y-axis, which indicates the LOD value.
[0046] Figure 3 This is a Manhattan plot of the genome-wide association analysis (GWAS) performed on chromosome 11 of Danish Large White pigs using the FASTmrEMMA model in mrMLM software, focusing on the effective right teat count trait. The x-axis represents the chromosome number of the pig, and the principal y-axis represents -log... 10 The P-value is represented by the secondary y-axis, which indicates the LOD value.
[0047] Figure 4 This is a graph showing the phenotypic differences in the number of effective right teats among pigs of different genotypes. Detailed Implementation
[0048] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.
[0049] The InDel molecular marker provided by this invention is located at positions 78 to 81 from the 5' end on SEQ ID NO: 1, corresponding to positions 6990232 to 6990235 from the 5' end on chromosome 11 of the 11.1 International Swine Reference Genome, and is CCAG; or located at positions 79 to 81 from the 5' end on SEQ ID NO: 1, corresponding to positions 6990233 to 6990235 from the 5' end on chromosome 13 of the 11.1 International Swine Reference Genome, where the original base CAG is deleted. Therefore, positions 78 to 81 from the 5' end on SEQ ID NO: 1 correspond to positions 6990232 to 6990235 from the 5' end on chromosome 11 of the 11.1 International Swine Reference Genome, and are C. In other words, the InDel marker of this invention is CCAG or C.
[0050] When it is CCAG, it is located at positions 78 to 81 from the 5' end on SEQ ID NO: 1, corresponding to positions 6990232 to 6990235 from the 5' end on chromosome 13 of the 11.1 version of the International Pig Genome.
[0051] When it is C, the CAG deletion at positions 79 to 81 from the 5' end on SEQ ID NO: 1 is replaced by the bases following in the sequence of SEQ ID NO: 1, corresponding to the CAG deletion at positions 6990233 to 6990235 from the 5' end on chromosome 11 of the 11.1 International Pig Reference Genome, which is replaced by the bases following in the sequence of chromosome 11.
[0052] For the sake of brevity, in this invention, positions 79 to 81 from the 5' end of SEQ ID NO: 1 are either CAG from the InDel molecular marker CCAG, or they are empty. That is, when CAG is missing, position 78 is still C, and the subsequent bases are still considered to be in their original positions. Positions 78 to 81 are then represented as C.
[0053] Example 1: Experimental Subjects, Phenotypic Determination, and DNA Sample Collection
[0054] (1) Experimental animals
[0055] The experimental pig herd used in this invention was a core herd of Danish Large White sows from a company in Shaanxi Province. A total of 560 Danish Large White sows were selected from this core herd, and the herd's pedigree was recorded in detail. The pigs in this experiment had free access to feed and water, and the feeding methods and rearing conditions remained consistent throughout the experiment, following conventional methods.
[0056] (2) Phenotypic determination
[0057] The number of effective right teats was determined artificially in 560 Danish Large White sows.
[0058] (3) Collection of pig tissue samples
[0059] To extract DNA, ear samples were collected from the aforementioned 560 Danish Large White sows and stored at -80°C for subsequent whole-genome resequencing.
[0060] Example 2: Whole-genome resequencing and genome-wide association analysis
[0061] (1) Whole genome resequencing
[0062] The whole-genome resequencing data of 560 Danish Large White pigs were completed by BGI Genomics Co., Ltd. in Shenzhen. The specific methods and steps are as follows:
[0063] ① Ear samples from 560 Danish Large White sows in Example 1 were sent to BGI Genomics Co., Ltd. in Shenzhen for DNA extraction;
[0064] ② Library construction: The qualified DNA is randomly fragmented and processed; then, through DNA fragment end repair, 3' end addition of polyA, sequencing adapter configuration, PCR amplification and other steps, the sequencing library is obtained;
[0065] ③ Sequencing: Whole genome resequencing was performed on BGI's DNB SEQ-T7 platform, with an average sequencing depth of 15.6×, yielding raw sequencing data in FASTQ format.
[0066] (2) Whole genome resequencing data analysis
[0067] ① Use Fastp software (version 0.20.1) to perform quality control on the raw sequencing data obtained in step (1), including deleting low-quality sequences, to obtain quality-controlled sequencing data in FASTQ file format;
[0068] ② Use the BWA-mem module in BWA software (version 0.7.15) to align the quality-controlled sequencing data to the Sscrofa11.1 pig reference genome to obtain the aligned SAM file;
[0069] ③ Using the Germline module of Clara Parabricks software (version 4.0.1), the aligned SAM file was sorted, repetitive sequences were marked, base quality values were recorrected, variants were detected, and variant quality control was performed to obtain the final variant result VCF file, which contains 103,491 InDel variant sites.
[0070] (3) Site-wide genome-wide association (GWAS) analysis
[0071] Unit-point GWAS analysis was performed using GCTA software developed by Professor Jian Yang et al. from the School of Life Sciences at Westlake University. Specifically, a univariate mixed linear model was used to analyze the GWAS relationship between variant sites and traits. The univariate mixed linear model is as follows:
[0072] y = a + bx + g + e
[0073] Where y is the phenotype, a is the mean, b is the additive effect (fixed effect) of the candidate InDel to be tested for association, x is the InDel genotype indicator variable encoded as 0, 1, or 2, g is the polygenic effect (random effect), i.e., the cumulative effect of all InDels (captured by the GRM calculated using all InDels), and e is the residual. For ease of calculation, the genetic variance var(g) is estimated based on a null model, i.e., y = a + g + e, and then fixed when testing the association between each InDel and the trait.
[0074] The specific site-wide genome-wide association study (GWAS) analysis method is as follows:
[0075] ① Use PLINK 2.0 to convert the VCF file containing the final mutation results obtained in step (2) into PLINK format (.fam, .bim, .bed);
[0076] ② Use GCTA software to convert the PLINK format file to GRM format as a genotype file, and extract the number of valid nipples from the original phenotype file as a phenotype file; use GCTA software, select the --pca parameter, input the GRM format genotype file to calculate PCA and take the first three principal components, and extract the sex, batch, and the first three principal components of the calculated PCA corresponding to the individuals in the original records as a covariance file.
[0077] ③ Prepare genotype, phenotype, and covariance files according to the format required by the GCTA software, and input them into the software to obtain the significant locus results; among them, the significance threshold at the genomic level is 0.05 divided by the total number of InDel loci, that is, the significance threshold at the genomic level is 0.05 / 103491, or 4.83E-07; the significance threshold at the chromosome level is 1 divided by the total number of InDel loci, that is, the significance threshold at the chromosome level is 1 / 103491, or 9.66E-06.
[0078] Unit point GWAS analysis results are as follows Figure 1As shown in the figure, there is an InDel site on chromosome 11 of Danish Large White pigs that significantly affects the number of effective right teats. This corresponds to a deletion mutation from CCAG to C at positions 6990232 to 6990235 on chromosome 11 of the International Swine Reference Genome Version 11.1 (nucleotide g.78CCAG>C at position 78 in SEQ ID NO:1) (p value 6.02E-06).
[0079] (4) Multisite GWAS analysis
[0080] Multisite GWAS analysis was performed using the FASTmrMLM and FASTmrEMMA models from the mrMLM software package developed by Professor Yuan-Ming Zhang of Huazhong Agricultural University. The specific methods are as follows:
[0081] ① Use PLINK 2.0 to convert the VCF file containing the final mutation results obtained in step (2) into PLINK format (.fam, .bim, .bed) as a genotype file;
[0082] ② Extract the number of valid right nipples from the original phenotypic file as the phenotypic file, and extract the gender, batch number, and the first three principal components of PCA calculated by GCTA software from the original records as the covariance file;
[0083] ③ Prepare the genotype, phenotype, and covariance files according to the software's required format, input them into the software, and obtain the significant loci results. The significance threshold is a LOD value of 3.
[0084] Results of multi-site GWAS analysis as follows Figure 2 and Figure 3 As shown in the figure, there is an InDel site on chromosome 11 of Danish Large White pigs that significantly affects the number of effective right teats. This corresponds to a deletion mutation from CCAG to C at positions 6990232 to 6990235 on chromosome 11 of the International Swine Reference Genome Version 11.1 (nucleotide g.78CCAG>C at position 78 in SEQ NO.1) (LOD value of FASTmrMLM is 6.1357; LOD value of FASTmrEMMA is 6.4201).
[0085] (5) Association analysis between different genotypes and the effective number of right nipples phenotype
[0086] Further combining the analysis results of the single-site GWAS and multi-site GWAS, the same variant locus that significantly affects the effective right teat number trait in both the single-site GWAS and multi-site GWAS models FASTmrMLM and FASTmrEMMA was retained. The results showed that there is a variant locus on chromosome 11 that significantly affects the effective right teat number trait, and its most significantly associated locus, g.78CCAG>C, was of particular interest. According to Table 1, the InDel locus g.78CCAG>C of the molecular marker is highly significantly correlated with the effective right teat number trait in pigs (P<0.001), indicating that this molecular marker significantly affects the effective right teat number trait in pigs. Assisted selection at this InDel locus in pigs can increase the effective right teat number in the population, thereby improving piglet nursing rate and weaning survival rate.
[0087] Furthermore, Table 1 shows that the deletion type (CC) has a higher average number of effective right nipples than the CCAG / CCAG and CCAG / C types, indicating that homozygous CCAG / CCAG is the most unfavorable for the number of effective right nipples. Figure 4 Further investigation revealed significant differences between the deletion-type CC and CCAG / C genotypes, and even more significant differences between the CC and CCAG / CCAG genotypes. This further indicates that homozygous CCAG / CCAG is most detrimental to the number of effective right teats. The number of effective right teats is an important trait for measuring sow reproductive performance; a low number of effective right teats signifies poor sow reproductive performance, low piglet weaning rate, and low piglet survival rate. Therefore, in breeding processes, it is necessary to cull CCAG / CCAG type breeding pigs and retain those with deletion mutations in CCAG / C and CC types to gradually increase the frequency of allele C at this locus. Currently, the dominant allele frequency in this population is only 40%, indicating room for genetic improvement.
[0088] Table 1. Correlation analysis of InDel site g.78CCAG>C of molecular markers with the number of effective right nipples.
[0089]
[0090] Note: The results for the number of valid right nipples are expressed as mean ± standard deviation (SD).
[0091] Example 2: Target DNA Sequence Amplification and Sequencing
[0092] (1) Primer design
[0093] The DNA sequence of SEQ ID NO:1 on pig chromosome 11 was downloaded from the Ensembl website (http: / / asia.ensembl.org / index.html). Primers were designed using the primer design software Primer Premier 6.0 and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The DNA sequences of the designed primers are shown below:
[0094] P001-F: 5'-GGCACGAGGAATACACAA-3' (SEQ ID NO: 2);
[0095] P002-R: 5'-CTCACACGACTTGGCTTC-3' (SEQ ID NO: 3);
[0096] (2) PCR amplification
[0097] To a 10 μL reaction mixture, add 1 μL of DNA template, 3.4 μL of double-distilled water, 5 μL of 2×Tag PCR Stan Mix with Loading Dye, and 0.3 μL each of primers P001-F and P002-R. The PCR reaction conditions were: 94℃ pre-denaturation for 5 min, followed by 35 cycles of 94℃ denaturation for 30 s, 64.5℃ annealing for 30 s, and 72℃ extension for 45 s, with a final extension at 72℃ for 5 min.
[0098] (3) DNA sequencing
[0099] DNA sequence sequencing and identification: Performed at BGI Genomics Co., Ltd. in Shenzhen, the gene fragments were sequenced using both forward and reverse reactions. The obtained sequences were compared with the NCBI genome sequence to identify mutations at the corresponding InDel sites. The sequencing results are shown below: GGCACGAGGAATACACAAGCATCCAATATGCAGCACCGGCCGGCGGCCTCCCCCAGGAACTTGGAGCTGGCGTGACA M (CCAG or C) CATCAGGTGATGCCCTCGACTCACTGC ATGTGTGACCCGTTCAGCGTGGTGAACGGGGACCTGCACTTACTCCGCAGAGGCCCCA GGCCACTCCCTGACTCCCGGATCCCACACGTCCTATACCCGAAGCCAAGTCGTGTGA G (SEQ ID NO: 1)
[0100] Note: M marked in the sequence listing is the mutation site, indicated by an underline (the mutated base in parentheses represents the allele mutation). The positions of the primer sequences are indicated by bolding at the beginning and end of the sequence.
[0101] Example 3: Analysis of the g.78CCAG>C effect at the InDel site of the molecular marker
[0102] According to Table 1 and Figure 4 It was found that, for the number of effective right teats, the dominant allele of the InDel locus g.78CCAG>C, i.e., the deletion type (CC), significantly increased the number of effective right teats by 0.35 per head compared to the CCAG / CCAG phenotype. The more effective teats a sow has, the higher the piglet uniformity, piglet weaning rate, and weaning survival rate will be. This will greatly reduce economic losses in pig farming and create wealth for enterprises. In this InDel-marked individual, by selecting the dominant allele (C) of this InDel in Danish Large White pigs, the economic benefits of commercial pigs can ultimately be improved, thereby increasing the enterprise's profits.
[0103] This invention provides a novel molecular marker for marker-assisted selection in pigs by detecting mutation sites at positions 78 to 81 of the SEQ ID NO:1 sequence and conducting preliminary association analysis between the genotype and the effective number of right teats in pigs.
[0104] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. The application of a reagent for detecting InDel molecular markers located on porcine chromosome 11 associated with the trait of the number of effective right teats in screening pigs with multiple effective right teats, characterized in that, The InDel molecular marker corresponds to the CCAG / C deletion mutation at positions 6990232 to 6990235 on chromosome 11 of the International Pig Reference Genome Version 11.
1. The polymorphism of the base at this site affects the effective right teat count trait in pigs. Specifically, pigs with the CCAG / C and CC genotypes have a higher effective right teat count than pigs with the CCAG / CCAG genotype. The pigs mentioned are Danish Large White pigs.
2. The application of a reagent for detecting InDel molecular markers located on chromosome 11 of pigs and associated with the trait of effective right teat count in the genetic breeding of pigs with this trait, characterized in that, The InDel molecular marker corresponds to the CCAG / C deletion mutation at positions 6990232 to 6990235 on chromosome 11 of the International Pig Reference Genome Version 11.
1. The polymorphism of the base at this site affects the effective right teat count trait in pigs. Specifically, pigs with the CCAG / C and CC genotypes have a higher effective right teat count than pigs with the CCAG / CCAG genotype. The pigs mentioned are Danish Large White pigs.
3. The application according to claim 1 or 2, characterized in that: The nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO: 1, where M in the sequence is CCAG or C.
4. The application of a primer pair for detecting InDel molecular markers located on chromosome 11 of pigs, which are associated with the trait of the number of effective right teats, in screening pigs with multiple effective right teats, characterized in that, The primer pair comprises primer P001-F and primer P002-R, and their nucleotide sequences are shown below: P001-F: 5'-GGCACGAGGAATACACAA-3'; P002-R: 5'-CTCACACGACTTGGCTTC-3'; The molecular marker is the molecular marker described in claim 1, wherein the number of effective right teats in CCAG / C and CC genotype pigs is higher than the number of effective right teats in CCAG / CCAG genotype pigs; The pigs mentioned are Danish Large White pigs.
5. The application of a primer pair for detecting InDel molecular markers located on chromosome 11 of pigs and associated with the trait of effective right teat count in the genetic breeding of pigs with this trait, characterized in that, The primer pair is the primer pair described in claim 4; the molecular marker is the molecular marker described in claim 1, wherein the effective right teat count of CCAG / C and CC genotype pigs is higher than that of CCAG / CCAG genotype pigs; The pigs mentioned are Danish Large White pigs.
6. The application of a kit for detecting InDel molecular markers located on porcine chromosome 11 associated with the trait of the number of effective right teats in screening pigs with multiple effective right teats, characterized in that, The kit comprises the primer pair as described in claim 4; the molecular marker is the molecular marker as described in claim 1, wherein the effective right teat count of CCAG / C and CC genotype pigs is higher than that of CCAG / CCAG genotype pigs; The pigs mentioned are Danish Large White pigs.
7. A kit for detecting InDel molecular markers located on chromosome 11 of pigs and associated with the trait of effective right teat count, used in the genetic breeding of pigs with traits related to the effective right teat count, characterized in that... The kit comprises the primer pair as described in claim 4; the molecular marker is the molecular marker as described in claim 1, wherein the effective right teat count of CCAG / C and CC genotype pigs is higher than that of CCAG / CCAG genotype pigs; The pigs mentioned are Danish Large White pigs.
8. A method for screening pigs with multiple effective right teats using InDel molecular markers located on chromosome 11 of pigs and associated with the trait of the number of effective right teats, characterized in that, It includes the following steps: The InDel molecular marker described in claim 1 is detected on chromosome 11 of pigs. Based on the base sequence of the InDel site of the InDel molecular marker, CCAG / CCAG genotype individuals are eliminated, while CCAG / C or CC genotype individuals are retained. Among them, the number of effective right teats of CCAG / C and CC genotype pigs is higher than that of CCAG / CCAG genotype pigs. The pigs mentioned are Danish Large White pigs.
9. The method according to claim 8, characterized in that: The detection method includes the following steps: (1) Extract genomic DNA from the pigs to be tested; (2) Using the primer pair described in claim 4 as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, PCR amplification is performed to obtain PCR amplification products; (3) Sequencing the PCR amplification products to obtain sequencing results; (4) Based on the sequencing results, determine the genotype of the InDel molecular marker.
10. A method for genetic improvement of pigs, characterized in that, It includes the following steps: Identify the InDel molecular marker sites of the breeding pigs in the core breeding pig population as described in claim 1, and make corresponding selections based on the molecular markers: select breeding pig individuals with the CCAG / C or CC genotype at loci 6990232 to 6990235 on chromosome 11 of the International Swine Reference Genome Version 11.1 in the core breeding pig population, and cull breeding pig individuals with the CCAG / CCAG genotype at loci 6990232 to 6990235, in order to increase the frequency of allele C at this locus generation by generation, thereby increasing the effective right teat count of offspring pigs; The pigs mentioned are Danish Large White pigs.