Rolling circle amplification molecular beacon based on DNA synthesized silver nanocluster and application of rolling circle amplification molecular beacon in DNA and RNA virus detection
By using DNA to synthesize silver nanoclusters (AgNCs/DNA) and G-rich adjacent fluorescence enhancement effect in rolling ring amplification reaction, a primer-free two-enzyme one-step RCA-H2O2-AgNCs/DNA reaction system was developed, which solved the problem of insufficient sensitivity and low specificity of SARS-CoV-2 and BKV virus detection in the prior art, and achieved rapid and accurate virus detection.
Patent Information
- Application Number
- CN202510349290.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-24
- Publication Date
- 2025-06-27
AI Technical Summary
The prior art has problems such as insufficient sensitivity, low specificity and long detection time in the detection of SARS-CoV-2 and BKV viruses, which are difficult to meet the needs of clinical promotion and application.
Using a rolling ring amplification molecular beacon based on DNA synthesis silver nanoclusters (AgNCs/DNA), combining rolling ring amplification reaction and G-rich adjacent fluorescence enhancement effect, a primer-free two-enzyme one-step RCA-H2O2-AgNCs/DNA reaction system was developed for rapid and accurate detection of DNA and RNA viruses.
It realizes rapid and accurate detection of SARS-CoV-2 and BKV viruses, improves the sensitivity and specificity of detection, simplifies the operation process, and reduces the detection cost.
Smart Images

Figure CN120210185A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a rolling circle amplification molecular beacon based on DNA-synthesized silver nanoclusters (AgNCs / DNA) and its application in the detection of DNA and RNA viruses, belonging to the technical fields of medicine and molecular diagnosis. Background Art
[0002] Coronavirus disease 2019 (COVID-19) is a disease caused by the infection of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). At present, based on the characteristics of the virus itself, the host immune response characteristics it causes, and the dynamic development law, a variety of methods and technologies for detecting RNA virus nucleic acids, host serum antigens or antibodies have been developed. However, large-scale clinical screening still mainly relies on the detection of SARS-CoV-2 virus RNA molecules (Rasmi, Y., et al. (2021). Analytical and Bioanalytical Chemistry 413(16):4137-4159; Yüce, M., et al. (2021). Biosensors & Bioelectronics 172:112752.). For this reason, a variety of emerging detection technologies for the detection of SARS-CoV-2 RNA have also been developed, such as isothermal nucleic acid amplification combined with electrochemical sensing (Chaibun, T., et al. (2021). Nature communications 12(1):802.), nucleic acid molecular electromechanical system sensing (Wang, L., et al. (2022). Nature Biomedical Engeneering.), CRISPR-Cas system (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR associated nucleases), (Wang, Y., et al. (2021). Analytical Chemistry 93(7):3393-3402.), etc. However, because these technologies are either easily interfered by the complex environmental medium of the detection sample, or rely on expensive new detection instruments and consumables, or the detection sensitivity or specificity is insufficient, they still cannot meet the requirements of clinical promotion and application.At present, reverse transcription-quantitative polymerase chain reaction (RT-qPCR), regarded as the "gold standard" for SARS-CoV-2 nucleic acid detection, is the most reliable method for COVID-19 clinical screening and diagnosis determination (Yüce, M., et al. (2021). Biosensors & Bioelectronics 172:112752; Li, D., et al. (2020). Theranostics 10(16):7150-7162.). It is worth noting that most commercially promoted RT-qPCR detection technologies target N, E, RdRP, or ORF1a / b, with a detection time of ~3 h. They pay less attention to the detection of variant strains and have a risk of false negatives (Yüce, M., et al. (2021). Biosensors & Bioelectronics 172:112752; Sethuraman, N., et al. (2020). JAMA 323(22):2249-2251.). Therefore, there is a need to develop more efficient, rapid, and accurate new methods for detecting SARS-CoV-2 virus RNA and its mutations.
[0003] BK human polyomaviruses (BKV) is a non-enveloped double-stranded DNA virus that can widely infect the population as early as childhood and cause persistent infections with almost no clinical symptoms (Helle, F., et al. (2017). Viruses 9(11):327.). However, BKV infection can cause severe neurological and urinary tract pathological damage in immunocompromised individuals (Moret, H., et al. (2006). Journal of Clinical Microbiology 44(4):1305-1309.). In particular, during kidney transplantation, due to the impairment of cellular and humoral immunity of the body, the massive replication of BKV can lead to a certain probability of BKV viremia and may further develop into BKV-associated nephropathy (BKVN) (Gras, J., et al. (2023). Transplant Infectious Disease 25(2):e14012.). It has been reported that the BKV viral load in urine can predict the risk of BKVN onset (Randhawa, P., et al. (2004). Journal of Clinical Microbiology 42(3):1176-1180.). Therefore, there is an urgent need to develop a simple and rapid method for detecting BKV in urine. Existing detection methods mainly rely on qPCR (Moret, H., et al. (2006). Journal of Clinical Microbiology 44(4):1305-1309.). The new surface plasmon resonance (SPR)-based biosensing detection faces problems such as insufficient specificity and large sample loading (Su, L.-C., et al. (2014). Journal of Biomedical Optics 19(1):011013).
[0004] In recent years, with the continuous development of isothermal amplification technology, nucleic acid molecule detection technology is no longer limited to polymerase chain reaction. Among them, rolling circle amplification (RCA) is particularly remarkable. It is an isothermal amplification reaction that continuously amplifies with a small circular DNA as a template, mainly including linear amplification initiated by a single primer (linear rolling circle amplification, LRCA) and hyperbranched amplification initiated by a double primer (hyperbranched rolling circle amplification, HRCA) (Xu, L., et al. (2021). Analytica Chimica Acta 1148). LRCA generally needs to first synthesize a circular probe through a ligase-mediated ligation reaction with a linear padlock probe, and then use this circular probe as a template to carry out the RCA reaction under the action of polymerase and primer, and can generate hundreds or thousands of tandem repeat long-chain nucleic acid products with the padlock probe as an element within just 2 - 30 minutes, with an amplification rate of 53 nt / s (Lizardi, P.M., et al. (1998). Nature Genetics 19(3):225 - 232). HRCA is to introduce a secondary reverse primer on the basis of LRCA to enable exponential amplification of the original microcircles (Lizardi, P.M., et al. (1998). Nature Genetics 19(3):225 - 232). It should be noted that the target to be detected by RCA, especially LRCA, can be DNA, RNA, even small molecules and cells, and is applicable to both liquid-phase detection and washable solid-phase detection (Yan, L., et al. (2014). Molecular Biosystems 10(5):970 - 1003). At the same time, there are various signal output methods for RCA, including using fluorescent molecules or dye-labeled dNTPs or oligonucleotide probes, or directly using dye molecules that can insert into nucleic acids, as well as color reactions induced by horseradish peroxidase labeling, or chemiluminescence reactions induced by luciferase or G4 / heme-DNAzyme labeling, or even the cleavage effect of the Taqman probe by the CRISPR / Cas system, etc. (Xu, L., et al. (2021). Analytica Chimica Acta 1148; Ali, M.M., et al. (2014). Chemical Society Reviews 43(10):3324 - 3341).Recently, by using dumbbell-shaped probes to pre-synthesize circular templates and directly introducing target-specific binding into the amplification reaction, a ligation-free one-step RCA for RNA detection has been achieved (Luo, N., et al. (2019). Analytica Chimica Acta 1067:129-136.). Due to the advantages of RCA such as flexible and adjustable design strategies, rapid amplification reactions, simple operation procedures, tolerance to sample matrix interference, and compatibility with various signal output modes, a large number of studies have successfully applied it to single nucleotide polymorphism detection and gene mutation detection (Lizardi, P.M., et al. (1998). Nature Genetics 19(3):225-232; Steain, M.C., et al. (2009). Antiviral Research 84(3):242-248; Faruqi, A.F., et al. (2001). Bmc Genomics 2:4.). In addition, several companies have developed RCA-based nucleic acid diagnostic products for clinical-related DNA and RNA detection (Demidov, V.V. (2002). Expert Review of Molecular Diagnostics 2(6):542-548.). However, at present, the various signal output methods of RCA have their own advantages and disadvantages. The main problem is that additional fluorescent molecules, quenching molecules, dyes, or active enzymes need to be introduced, which increases the reaction time, steps, and cost. There is still a need to develop a simple, efficient, and reliable new molecular beacon for RCA and apply it to viral nucleic acid detection.
[0005] DNA-synthesized silver nanoclusters (AgNCs / DNA) are expected to become efficient fluorescent molecular beacons for RCA. As an aggregate formed by the assembly of dozens of silver atoms, AgNCs / DNA are less than 1 nm in size, and the synthesis steps are simple and the fluorescence is tunable. By simply changing the length, sequence or structure of the DNA template used, the optical properties of AgNCs can be regulated (Zhou, Z., et al. (2011). Biosensors & Bioelectronics 28(1):33 - 37; Liu, J. (2014). TrAC Trends in Analytical Chemistry, 58:99 - 111.). Moreover, the DNA template used can hybridize with the target nucleic acid according to the principle of base complementary pairing, and has direct target-responsive fluorescence regulation performance, showing significant advantages as a new type of molecular beacon in nucleic acid detection. Recently, it has been found that AgNCs / DNA have the fluorescence enhancement effect near G-rich regions (Obliosca, J.M., et al. (2014). Acs Nano 8(10):10150 - 10160; Lin, R.Y., et al. (2017). Chemistry - a European Journal 23(45):10893 - 10900.), laying the foundation for its application in hybridization-based signal amplification reactions. Among them, the fluorescence enhancement near G-rich regions is to synthesize AgNCs using a DNA sequence rich in cytosine C. After hybridization with a complementary strand with a G-rich sequence overhang, the fluorescence of AgNCs is enhanced due to the proximity of the G-rich sequence to AgNCs (Yeh, H.-C., et al. (2010). Nano Letters 10(8):3106 - 3110.). The applicant has previously developed hairpin-type DNA-synthesized silver nanoclusters AgNCs / HpDNA using the fluorescence enhancement effect near G-rich regions, and used it as a molecular beacon for strand displacement amplification (SDA) and successfully applied it to microRNA detection (Zhang, J., et al. (2016). Analytical Chemistry 88(2):1294 - 1302.). There have also been other reports on engineering AgNCs / DNA and using their fluorescence enhancement or quenching or recovery properties for the detection of viral DNA or RNA (Zhang, K., et al. (2016). Rsc Advances 6(101):99269 - 99273; Li, D., et al. (2021). ACS Sensors 6(3):613 - 627.).However, there have been no reports on the application of AgNCs / DNA combined isothermal amplification in the nucleic acid detection of SARS-CoV-2. Combining AgNCs / DNA with excellent fluorescence performance and LRCA with excellent repeat element amplification ability is expected to provide a new solution for the rapid, accurate, convenient, and low-cost in vitro detection of viral nucleic acids. Summary of the Invention
[0006] The object of the present invention is: aiming at the deficiencies of existing detection technologies, the present invention provides a rolling circle amplification molecular beacon based on DNA-synthesized silver nanoclusters (AgNCs / DNA) and its application in the detection of DNA and RNA viruses.
[0007] To achieve the above object, the present invention adopts the following technical solutions:
[0008] In the first aspect, the present invention provides a fluorescent molecular beacon AgNCs / DT-GSP-t4. The AgNCs / DT-GSP-t4 is a silver nanocluster synthesized based on the DNA template DT-GSP-t4, which contains a hybridization region and a silver nanocluster (AgNCs, Silver Nanoclusters) nucleation region from 5' to 3'. The sequence of the DNA template DT-GSP-t4 is shown in SEQ ID No.2.
[0009] Preferably, the preparation method of the AgNCs / DT-GSP-t4 includes: sequentially adding AgNO3 and NaBH4 to the phosphate buffer solution containing DT-GSP-t4 and oscillating for reaction, and placing the obtained solution in the dark at room temperature for 18 h to obtain it.
[0010] Preferably, when sequentially adding AgNO3 and NaBH4 to the phosphate buffer solution containing DT-GSP-t4, the final molar concentration ratios of DT-GSP-t4, AgNO3, and NaBH4 are 1:26:26 respectively.
[0011] Preferably, the raw material ratio in the preparation method is as follows for each 1 mL of AgNCs / DT-GSP-t4 prepared:
[0012]
[0013] Among them, NaBH4 needs to be freshly prepared and quickly added to the mixture of Ag + / DT-GSP-t4 within 30 s. Then, shake vigorously for about 30 s. The obtained solution is placed in the dark at room temperature for 18 - 24 h to obtain AgNCs / DT-GSP-t4, which is stored in the dark at 4 °C for standby.
[0014] Second aspect, the present invention provides the application of the fluorescent molecular beacon AgNCs / DT-GSP-t4 described in the first aspect in detecting DNA and RNA viruses for non-diagnostic and therapeutic purposes.
[0015] Third aspect, the present invention provides the application of the fluorescent molecular beacon AgNCs / DT-GSP-t4 described in the first aspect in the preparation of reagents or kits for detecting DNA and RNA viruses.
[0016] Preferably, the detection is achieved through a rolling circle amplification reaction. The rolling circle amplification reaction uses a padlock probe (PlP) that can specifically bind to the target to be detected and contains an AgNCs / DNA fluorescence-enhancing C-rich sequence region to perform a two-enzyme one-step method (T4 DNA ligase and phi29 DNA polymerase) RCA reaction under primer-free conditions to generate single-stranded DNA containing tandem repeat elements of G-rich sequences. Subsequently, H2O2 is added to eliminate the influence of residual DTT in the RCA reaction. Then, using AgNCs / DT-GSP-t4 as a signal probe, under the action of the G-rich adjacent fluorescence enhancement effect, a specific fluorescence enhancement signal is generated for the target to be detected. Among them, the design of the padlock template probe needs to meet the condition that there is no neck-loop structure at the 5' end, while there is a neck-loop structure at the 3' end, and this neck-loop is located near the 3' end of the AgNCs / DNA enhancement region, thereby obtaining an optimal RCA-H2O2-AgNCs / DNA detection system to achieve the maximum fluorescence enhancement.
[0017] Among them, the two-enzyme one-step RCA reaction uses T4 DNA ligase and phi29 DNA polymerase; the target to be detected is a DNA or RNA virus; the tandem repeat element containing G-rich sequences is (PlP complementary strand)n, where n≥1.
[0018] Preferably, the detection target is the specific region RNA of the N, E, ORF1ab genes of the SARS-CoV-2 virus or the specific region DNA of the overlapping region of the VP2 and VP3 genes of the BKV virus, and the padlock template probe used is a single padlock template probe. Among them:
[0019] When the target sequence is the Nl RNA shown in SEQ ID No.10, the corresponding single padlock template probe is PlP-Nl4-s2a-Np of SEQ ID No.20;
[0020] When the target sequence is the El RNA shown in SEQ ID No.25, the corresponding single padlock template probe is PlP-EWl1m-Np of SEQ ID No.35;
[0021] When the target sequence is the ORF1abl RNA shown in SEQ ID No. 44, the corresponding single padlock template probe is PlP-ORF1ab-Wl2m-a1-Np of SEQ ID No. 48;
[0022] When the target sequence is VP23l shown in SEQ ID No. 55, the corresponding single padlock template probe is PlP-VP23l2-a2s-Np shown in SEQ ID No. 59;
[0023] The single padlock template probe is sequentially from 5' to 3': 5' target binding region, AgNCs / DT-GSP-t4 hybridization region, AgNCs / DT-GSP-t4 fluorescence-enhanced C-rich sequence region, addition sequence region (with or without), and 3' target binding region, and the PlP secondary structure with the optimal fluorescence enhancement effect satisfies that there is no stem-loop structure at the 5' end, especially there is no stem-loop near the signal probe hybridization region CATC, so as to ensure the smooth hybridization of AgNCs / DNA; and a stem-loop structure is formed at the 3' end of the corresponding AgNCs / DNA fluorescence enhancement region to achieve the optimal fluorescence enhancement effect.
[0024] Preferably, the detection target is the RNA of a specific region of the E or ORF1ab gene of the SARS-CoV-2 virus, and the padlock template probe used is a double padlock template probe (PlP-UD); wherein:
[0025] When the target sequence is El RNA of SEQ ID No. 25, the corresponding double padlock template probes are PlP-EWl1m-Np-U2 shown in SEQ ID No. 39 and PlP-EWl1m-Np-D2 shown in SEQ ID No. 40 respectively;
[0026] When the target sequence is ORF1abl RNA shown in SEQ ID No. 44, the corresponding double padlock template probes are PlP-ORF1ab-Wl2m-a1-Np-U2 shown in SEQ ID No. 52 and PlP-ORF1ab-Wl2m-a1-Np-D2 shown in SEQ ID No. 53.
[0027] The double padlock template probe is sequentially from 5' to 3': the upstream target binding padlock probe PlP-U and the downstream padlock probe PlP-D. The downstream padlock probe PlP-D still contains a 5' target binding region, an AgNCs / DT-GSP-t4 hybridization region, an AgNCs / DT-GSP-t4 fluorescence-enhanced C-rich sequence region, an addition sequence region (with or without), and a 3' target binding region.
[0028] In the fourth aspect, the present invention provides a detection kit, including the fluorescent molecular beacon AgNCs / DT-GSP-t4 described in the first aspect of the present invention.
[0029] Preferably, the detection kit further comprises a single padlock template probe or a double padlock template probe. The sequence of the single padlock template probe is SEQ ID No.20, 35, 48 or 59, and the sequence of the double padlock template probe is SEQ ID No.39-40 or SEQ ID No.52-53
[0030] In a fifth aspect, the present invention provides a method for detecting DNA or RNA viruses for non-diagnostic and non-therapeutic purposes. The method includes: a step of two-enzyme one-step RCA reaction and a step of labeling reaction (RCA-H2O2-AgNCs / DNA reaction) between the RCA reaction product and the fluorescent molecular beacon AgNCs / DT-GSP-t4 described in claim 1 under the condition of H2O2.
[0031] Preferably, the composition of each 10 μL reaction system in the RCA reaction is as follows:
[0032] Ligation reaction premix (LM) 1 μL;
[0033] Target to be measured 1 μL;
[0034] RCA reaction premix (RM) 8 μL;
[0035] Among them, the composition of 5 μL LM is:
[0036]
[0037] The composition of 8 μL RM is:
[0038]
[0039] Among them, phi29 DNA polymerase is diluted with 10×OP;
[0040] 10×LTA is a self-made ligation reaction buffer, and its components are:
[0041] 500 mM Tris-HAc;
[0042] 100 mM MgAc2 and
[0043] 10 mM ATP;
[0044] 10×PA is a self-made polymerase reaction buffer, and its components are:
[0045] 500 mM Tris-HAc;
[0046] 100 mM MgAc2 and
[0047] 100 mM NH4Ac;
[0048] 10×OP is the original reaction buffer of the polymerase, and its components are as follows:
[0049] 500 mM Tris-HCl
[0050] 100 mM MgCl2
[0051] 100 mM (NH4)2SO4 and
[0052] 40 mM DTT.
[0053] Preferably, the procedure of the two-enzyme one-step RCA reaction is: 30 °C, 30 min, 4 °C, forever.
[0054] Preferably, the composition of each 50 μL reaction system in the labeling reaction is as follows:
[0055] 10 μL of RCA reaction product;
[0056] 0.846 μL of 0.1% H2O2;
[0057] 40 μL of 15 μM AgNCs / DT-GSP-t4.
[0058] Preferably, the preparation method of the reaction system is: add 0.1% H2O2 to the RCA reaction product and let it stand at room temperature for 5 min, then add AgNCs / DT-GSP-t4 and let it stand at room temperature for another 5 min.
[0059] Preferably, it further includes the step of fluorescence detection of the product obtained from the labeling reaction: place the product obtained from the RCA-H2O2-AgNCs / DNA reaction system in a microplate for fluorescence measurement, and perform fluorescence emission spectrum measurement on a (Cytation 5) multifunctional microplate reader to obtain a fluorescence detection signal.
[0060] Preferably, the conditions for the fluorescence emission spectrum measurement are: excitation wavelength λ ex = 540 nm, excitation and emission slits are 10 nm, scanning step size is 1 nm, and take the fluorescence intensity value at λ ex = 540 nm / λ em = 620 nm - as the virus nucleic acid detection signal.
[0061] The present invention establishes a primer-free two-enzyme one-step RCA-H2O2-AgNCs / DNA reaction system based on AgNCs / DNA. After generating specific tandem repeat G-rich sequence elements, it triggers the G-rich proximity fluorescence enhancement effect of AgNCs / DT-GSP-t4 and generates a fluorescence enhancement signal for virus nucleic acid detection.
[0062] Compared with the prior art, the present invention has the following beneficial effects:
[0063] (1) In the present invention, the RCA reaction does not require primer mediation. Correspondingly, the target to be detected acts as a primer, simplifying the design of the padlock probe PlP and the experimental operation steps.
[0064] (2) Compared with the problem of low specificity of existing RCA fluorescent dyes, the novel fluorescent molecular beacon based on the fluorescence enhancement effect of AgNCs / DT-GSP-t4 rich in G has high specificity, can recognize single-base mismatches at the PlP junction, and by increasing the number of PlP junctions to form upstream and downstream PlP double probes, specific recognition of double mutation sites can be achieved.
[0065] (3) The secondary structure of the PlP probe is one of the important factors affecting the fluorescence detection signals of the RCA product and AgNCs / DT-GSP-t4. When the PlP secondary structure satisfies that there is no neck-loop structure at the 5' end, while there is a neck-loop structure at the 3' end of the corresponding AgNCs / DNA fluorescence enhancement region, the optimal RCA-H2O2-AgNCs / DNA detection system can be obtained, thereby realizing the co-regulation of PlP and AgNCs / DT-GSP-t4 on the output fluorescence signal and further improving the detection specificity. BRIEF DESCRIPTION OF THE DRAWINGS
[0066] Figure 1Schematic diagram of the RCA-H2O2-AgNCs / DNA reaction steps and forms of PlP probes: ① After the padlock probe PlP is complementary paired with the target to be detected, under the action of T4 DNA ligase, the 5' end and 3' end of PlP are connected head to tail to form a ring; ② After adding phi29 DNA polymerase and dNTP, the circular PlP is subjected to rolling circle amplification (RCA) for 30 min at 30 °C without primers to generate tandem repeat linear long-chain DNA; ③ After adding H2O2 and reacting at room temperature for 5 min, AgNCs / DT-GSP-t4 signal probe is added, and then reacting at room temperature for 5 min, a fluorescence-enhanced signal can be obtained; From 5' to 3', PlP is in turn the 5' target binding region, AgNCs / DT-GSP-t4 hybridization region, AgNCs / DT-GSP-t4 fluorescence-enhanced C-rich sequence region, primer binding region, 3' target binding region, PlP-Np is in turn the 5' target binding region, AgNCs / DT-GSP-t4 hybridization region, AgNCs / DT-GSP-t4 fluorescence-enhanced C-rich sequence region and 3' target binding region from 5' to 3', PlP-a-Np is in turn the 5' target binding region, AgNCs / DT-GSP-t4 hybridization region, AgNCs / DT-GSP-t4 fluorescence-enhanced C-rich sequence region, added sequence region and 3' target binding region from 5' to 3', and PlP-UD is in turn the upstream target binding padlock probe PlP-U and the downstream padlock probe PlP-D from 5' to 3', and the latter contains the 5' target binding region, AgNCs / DT-GSP-t4 hybridization region, AgNCs / DT-GSP-t4 fluorescence-enhanced C-rich sequence region, added sequence region (with or without) and 3' target binding region.
[0067] Figure 2 Characterization results of the fluorescence enhancement characteristics of G-rich hybridization of AgNC / DT-GSP-t4 in Example 1: (A-D) are the fluorescence emission spectra (λ ex = 540 nm) (A and B) and their fluorescence emission peak intensities (C and D) of the reaction mixtures of AgNCs / DT-GSP-t4 (SEQ ID No.2) (A and C) and AgNCs / DT-GSP-t1 (SEQ ID No.1) (B and D) with G-rich hybrid complementary strand SPc-G-tra (SEQ ID No.3) at different concentration gradients (0, 0.4, 0.8, 1.2, 1.6, 2 and 2.4 μM); (E-H) are the fluorescence emission spectra (λ ex= 540 nm) (E and F) and their fluorescence emission peak intensities (G and H). In the figure, the abbreviation C denotes the reaction solution containing only 2.4 μM AgNCs / DT-GSP-t4, CG-0.8, 1.6, and 2.4 are the reaction mixtures of 2.4 μM AgNCs / DT-GSP-t4 with 0.8, 1.6, and 2.4 μM SPc-G-tra, respectively, C(G)2-0.8 or C(G)3-0.8 are the reaction mixtures of 2.4 μM AgNCs / DT-GSP-t4 (SEQ ID No.2) with 0.8 μM (SPc-G-tra)2 or (SPc-G-tra)3 (SEQ ID No.4), CG is the reaction mixture of 2.4 μM AgNCs / DT-GSP-t4 (SEQ ID No.2) with 2.4 μM SPc-G-tra (SEQ ID No.3), 2C or 3C are the reaction solutions of 4.8 or 7.2 μM AgNCs / DT-GSP-t4 (SEQ ID No.2), and 2C(G)2 or 3C(G)3 are the reaction mixtures of 4.8 or 7.2 μM AgNCs / DT-GSP-t4 (SEQ ID No.2) with 2.4 μM (SPc-G)2 or (SPc-G)3 (SEQ ID No.4), respectively.
[0068] Figure 3 For the evaluation results of the RCA-AgNCs / DT-GSP-t4 compatibility in Example 2: (A-C) are the fluorescence emission spectra (λ ex = 540 nm) (A), fluorescence emission peak intensities (λ ex=(B) and absorption spectrum (C) with λex = 540 nm / λem = 620 nm); (D-F) are the fluorescence emission spectra (D), fluorescence emission peak intensities (E), and absorption spectra (F) of the reaction mixture of AgNCs / DT-GSP-t4 alone or the hybridization reaction mixture of AgNCs / DT-GSP-t4 (SEQ ID No. 2) and SPc-G-tra (SEQ ID No. 3) in different buffer systems (Pi, LTA, LTM, PA, PM); (G-H) are the gel imaging grayscale images of the products obtained from the RCA reaction when PlP-(DT-G2-tran)-2 (abbreviated as PlP-D2) (SEQ ID No. 6) is used as the padlock probe, DT-N-Pri1 (SEQ ID No. 7) is used as the primer, and N (SEQ ID No. 5) DNA is used as the target in different reaction buffer systems (G) or phi29 polymerase dilution buffer systems (H); in the figure, the abbreviation Pi indicates phosphate buffer, OT and OP are the original T4 DNA ligase buffer and phi29 DNA polymerase buffer respectively, O-O refers to OT paired with OP, LTA and LTM are self-made T4 DNA ligase buffers without DTT, PA and PM are phi29 DNA polymerase buffers without DTT, 10×OT contains 500 mM Tris-HCl, 100 mM MgCl2, 100 mM DTT, and 10 mM ATP, 10×LTA contains 500 mM Tris-HAc, 100 mM MgAc2, and 10 mM ATP, 10×LTM contains 500 mM Tris-HAc, 100 mM MgCl2, and 10 mM ATP, 10×OP contains 500 mM Tris-HCl, 100 mM MgCl2, 100 mM (NH4)2SO4, and 40 mM DTT, 10×PA contains 500 mM Tris-HAc, 100 mM MgAc2, and 100 mM NH4Ac, 10×PM contains 500 mM Tris-HAc, 100 mM MgCl2, and 100 mM NH4Ac. In the figure, the abbreviations λ and Mar are λ-Hind III digest (Takara, catalog number 3403) and 1Kb DNA ladder (Transgen, catalog number BM201) respectively. In the grayscale photos of (B and E), from left to right are the reaction solutions sorted from top to bottom in the title boxes of (A and D).
[0069] Figure 4Optimization results of the DTT-H2O2-AgNCs / DNA reaction in Example 3: (A) shows the enhanced fluorescence emission peak intensity values of the reaction mixtures with optimized H2O2 and AgNCs / DNA concentrations in DTT-H2O2-AgNCs / DNA. The reaction mixtures contained 10 μL of rich-G sequence SPc-G-tra (SEQ ID No. 3) at different concentrations (36, 48, and 60 μM), 0.4 mM DTT, different volume fractions of H2O2 (0.001, 0.005, 0.01, and 0.05%), and 20 mM phosphate buffer (Pi, pH = 7.6), and were incubated at room temperature for 20 min. Then, 40 μL of AgNCs / DT-GSP-t4 (SEQ ID No. 2) at different concentrations (9, 12, and 15 μM) was added and incubated at room temperature for 5 - 10 min. (B) shows the fluorescence emission peak intensity values of the reaction mixtures with optimized DTT-H2O2 reaction time. The reaction mixtures contained 10 μL of 60 μM rich-G sequence SPc-G-tra, 0.4 mM DTT, 0.005% volume fraction of H2O2, and 0.2×LTA and 1×PA, and were incubated at room temperature for different times (5, 10, 20, and 30 min). Then, 40 μL of 15 μM AgNCs / DT-GSP-t4 (SEQ ID No. 2) was added and incubated at room temperature for 5 - 10 min. (C) shows the enhanced fluorescence emission peak intensity values of the reaction mixtures with optimized DTT-H2O2-AgNCs / DNA reaction procedure. The reaction mixtures contained 10 μL of 60 μM SPc-G-tra (SEQ ID No. 3), 0.4 mM DTT, 0.005% H2O2, and 0.2×LTA and 1×PA, and were incubated at 25°C for 20 min or at 95°C for 5 min. Then, 40 μL of 15 μM AgNCs / DT-GSP-t4 (SEQ ID No. 2) was added and heated (hybridization reaction was carried out on a thermal cycler at 95°C for 5 min and 25°C for 30 min) or incubated at room temperature for 5 min.
[0070] Figure 5 Results of the optimization of the RCA-H2O2-AgNCs / DNA reaction conditions in Example 3. Using PlP-D2 (SEQ ID No. 6) as the padlock probe, DT-N-Pri1 (SEQ ID No. 7) as the primer, and N (SEQ ID No. 5) DNA as the target, the RCA reaction and the optimization of the RCA-H2O2-AgNCs / DNA reaction conditions were carried out: (A and D) show the fluorescence emission peak intensity (A) and its enhanced value (D) of the experiment for optimizing the H2O2 concentration in the RCA-H2O2-AgNCs / DNA reaction system (λ ex = 540 nm / λ em= 620 nm), where H2O2-0, 1, 2, 3, 4, and -5 indicate 0, 0.5, 0.846, 0.87, 0.92, and 1 μL of 0.1% H2O2, respectively; (B and E) are the fluorescence emission peak intensities (B) and their enhancement values (E) of the H2O2 reaction time optimization experiment of the RCA-H2O2-AgNCs / DNA reaction system (λ ex = 540 nm / λ em = 620 nm); (C and F) are the fluorescence emission peak intensities (C) and their enhancement values (F) of the AgNCs reaction time optimization experiment of the RCA-H2O2-AgNCs / DNA (λ ex = 540 nm / λ em = 620 nm).
[0071] Figure 6 For the results of optimizing the RCA-H2O2-AgNCs / DNA reaction procedure in Example 3, PlP-D2 (SEQ ID No. 6) was used as the padlock probe, DT-N-Pri1 (SEQ ID No. 7) was used as the primer, and N (SEQ ID No. 5) DNA was used as the target for RCA reaction and optimization of the RCA-H2O2-AgNCs / DNA reaction procedure: (A-C) are the fluorescence emission peak intensities (A) and their enhancement values (B) of the RCA-H2O2-AgNCs / DNA reaction procedure optimization experiment I (λ ex = 540 nm / λ em = 620 nm), and the gel imaging grayscale image (C), where Rec1-5, i.e., procedures 1-5, are detailed in the "Experimental Procedures" in Example 3; (D-F) are the fluorescence emission peak intensities (D) and their enhancement values (λ ex = 540 nm / λ em = 620 nm) (E) of the RCA-H2O2-AgNCs / DNA reaction procedure optimization experiment II, and the gel imaging grayscale image (F), where each reaction procedure is detailed in the "Experimental Procedures" in Example 3.
[0072] Figure 7Results of primer - independence and breakpoint recognition of PlP - mediated RCA reaction in Example 4: (A, B, and D) Using PlP - Nl4 (SEQ ID No.17) as the padlock probe and Nl - 1 (SEQ ID No.8) as the target (final concentrations of 0, 0.1, 1 μM in a 10 μL RCA system), the fluorescence emission peak intensity (A) and its enhancement value (B) of the RCA - H2O2 - AgNCs / DNA reaction, and the grayscale gel electrophoresis image (D) were obtained under the conditions of no primer or using TP1 as the primer; (E) Using PlP - Nl4 (SEQ ID No.17) as the padlock probe and Nl (SEQ ID No.9) and its single - base mutants at different sites (M1 - 6) (SEQ ID No.11 - 16) as the targets (final concentration of 0.1 μM in a 10 μL RCA system), the grayscale gel electrophoresis images of the RCA - H2O2 - AgNCs / DNA reaction were obtained under the conditions of no primer or using TP1 as the primer; (C) is the mFold secondary structure diagram of PlP - Nl4 (SEQ ID No.17).
[0073] Figure 8 Results of the optimization of the padlock template probe PlP - E (padlock probe targeting the E gene) in Example 5: (A, B, E, and F) The fluorescence emission spectra (A and E) and absorption spectra (B and F) of detecting EW (SEQ ID No.22) or EB (SEQ ID No.23) DNA (A and B) and ElW (SEQ ID No.24) or ElB (SEQ ID No.26) DNA (E and F) by the RCA - H2O2 - AgNCs / DNA reaction using PlP - EWs1m - Np (SEQ ID No.29) and PlP - EWl1m - Np (SEQ ID No.35) as the padlock probes respectively; (C and G) The fluorescence emission peak intensity enhancement values of detecting EW (SEQ ID No.22) or EB DNA (SEQ ID No.23) (C) and ElW (SEQ ID No.24) or ElB DNA (SEQ ID No.26) (G) by the RCA - H2O2 - AgNCs / DNA system using various variants of PlP - E as the padlock probes (final concentration of the target in a 10 μL RCA system is 0.1 μM) (C) and (G), where λ ex = 540 nm / λ em= 620 nm); (D and H) are the mFold secondary structure diagrams of PlP-EWs1m-Np (SEQ ID No. 29) and PlP-EWl1m-Np (SEQ ID No. 35), respectively; in the figure, the abbreviation M indicates 1Kb DNA ladder (Transgen, catalog number BM201); in the figure, the abbreviations E(l)W and E(l)B respectively refer to the selected E gene sequences of wild-type (Wild) and mutant (BA.2) SARS-CoV-2.
[0074] Figure 9Experimental results of the optimization of the padlock template probe PlP-N / ORF1ab / VP23 in Example 6: (A, D, and G) are respectively the fluorescence emission peak intensity enhancement values (A), gel grayscale images (D), and the mFold secondary structure diagrams (G) of the PlP with the optimal fluorescence enhancement effect obtained by using PlP-Nl4 (SEQ ID No. 17), PlP-Nl4-Np (SEQ ID No. 18), PlP-Nl4-s2-Np (SEQ ID No. 19), PlP-Nl4-s2a-Np (SEQ ID No. 20) as padlock probes and Nl (SEQ ID No. 9) DNA as the target for the RCA-H2O2-AgNCs / DNA reaction; (B, E, and H) are respectively the fluorescence emission peak intensity enhancement values (B), gel grayscale images (E), and the mFold secondary structure diagrams (H) of the PlP with the optimal fluorescence enhancement effect obtained by using PlP-ORF1ab-Wl1-Np (SEQ ID No. 46), PlP-ORF1ab-Wl1m-Np (SEQ ID No. 47), PlP-ORF1ab-Wl2m-a1-Np (SEQ ID No. 48), PlP-ORF1ab-Wl2m-a2-Np (SEQ ID No. 54) as padlock probes and ORF1ablW (SEQ ID No. 43) or ORF1ablB (SEQ ID No. 45) DNA as the target for the RCA-H2O2-AgNCs / DNA reaction; (C, F, and I) are respectively the fluorescence emission peak intensity enhancement values (C), gel grayscale images (F), and the mFold secondary structure diagrams (I) of the PlP with the optimal fluorescence enhancement effect obtained by using PlP-VP23l2 (SEQ ID No. 56), PlP-VP23l2-Np (SEQ ID No. 57), PlP-VP23l2-a1s-Np (SEQ ID No. 58), PlP-VP23l2-a2s-Np (SEQ ID No. 59) as padlock probes and VP23l (SEQ ID No. 55) DNA as the target for the RCA-H2O2-AgNCs / DNA reaction; In the figure, the abbreviation M is 1Kb DNA ladder (Transgen, catalog number BM201), Nl (SEQ ID No. 9) is the specific sequence of the N gene of wild-type SARS-CoV-2, ORF1ablW (SEQ ID No. 43) and ORF1ablB (SEQ ID No. 45) respectively refer to the specific segment sequences of the ORF1ab gene of wild-type (Wild) and mutant (BA.2) SARS-CoV-2, VP23l (SEQ ID No.55) It is the sequence of a specific segment in the overlapping region of the VP2 and VP3 genes of BKV.
[0075] Figure 10Experimental results of the reaction specificity of RCA-H2O2-AgNCs / DT-GSP-t4 (SEQ ID No.2) in Example 7: (A-D) are four groups of padlock template probes, namely PlP-EWl1m-Np (SEQ ID No.35), PlP-EBl1m-Np (SEQ ID No.36) (A); PlP-ORF1ab-Wl2m-a1-Np (SEQ ID No.48), PlP-ORF1ab-Bl2m-a1-Np (SEQ ID No.49) (B); PlP-EWl1m-Np (SEQ ID No.35), PlP-EWl1m-Np-U (SEQ ID No.37) + PlP-EWl1m-Np-D (SEQ ID No.38) (PlP-EWl1m-Np-UD), PlP-EWl1m-Np-U2 (SEQ ID No.39) + PlP-EWl1m-Np-D2 (SEQ ID No.40) (PlP-EWl1m-Np-UD2) (C); and PlP-ORF1ab-Wl2m-a1-Np (SEQ ID No.48), PlP-ORF1ab-Wl2m-a1-Np-U (SEQ ID No.50) + PlP-ORF1ab-Wl2m-a1-Np-D (SEQ ID No.51) (PlP-ORF1ab-Wl2m-a1-Np-UD), PlP-ORF1ab-Wl2m-a1-Np-U2 (SEQ ID No.52) + PlP-ORF1ab-Wl2m-a1-Np-D2 (SEQ ID No.53) (PlP-ORF1ab-Wl2m-a1-Np-UD2) (D). The fluorescence emission peak intensity enhancement values of ElW (SEQ ID No.24) or ElB (SEQ ID No.26) DNA (A and C) and ORF1ablW (SEQ ID No.43) or ORF1ablB (SEQ ID No.43) DNA (B and D) are detected by RCA-H2O2-AgNCs / DT-GSP-t4 (SEQ ID No.2); (E-H) are the gel electrophoresis grayscale images corresponding to A-D respectively. The abbreviations in the figure indicate that ElW (SEQ ID No.24), ORF1ablW (SEQ ID No.43) and ElB (SEQ ID No.26), ORF1ablB (SEQ ID No.45) DNA refer to the specific segment sequences of the E or ORF1ab gene of wild-type (Wild) and mutant (BA.2) SARS-CoV-2 respectively.
[0076] Figure 11Experimental results of the reaction sensitivity of RCA-H2O2-AgNCs / DT-GSP-t4 in Example 8: (E, I, M, and A) are respectively the fluorescence emission peak intensity value (E) of the RCA-H2O2-AgNCs / DT-GSP-t4 reaction with PlP-Nl4-s2a-Np (SEQ ID No. 20) as the padlock template probe and Nl RNA (SEQ ID No. 10) as the target (initial concentration of 10 -9 ~10 μM), the fluorescence emission peak intensity enhancement values in the large gradient range (I) and small gradient range (M), and the fluorescence emission spectrum (A) corresponding to the small gradient range; (F, J, N, and B) are respectively the fluorescence emission peak intensity value (F) of the RCA-H2O2-AgNCs / DT-GSP-t4 reaction with PlP-EWl1m-Np (SEQ ID No. 35) as the padlock template probe and ElRNA (SEQ ID No. 25) as the target (initial concentration of 10 -9 ~10 μM), the fluorescence emission peak intensity enhancement values in the large gradient range (J) and small gradient range (N), and the fluorescence emission spectrum (B) corresponding to the small gradient range; (G, K, O, and C) are respectively the fluorescence emission peak intensity value (G) of the RCA-H2O2-AgNCs / DT-GSP-t4 reaction with PlP-ORF1ab-Wl2m-a1-Np (SEQ ID No. 48) as the padlock template probe and ORF1abl RNA (SEQ ID No. 44) as the target (initial concentration of 10 -9 ~10 μM), the fluorescence emission peak intensity enhancement values in the large gradient range (K) and small gradient range (O), and the fluorescence emission spectrum (C) corresponding to the small gradient range; (H, L, P, and D) are respectively the fluorescence emission peak intensity value (H) of the RCA-H2O2-AgNCs / DT-GSP-t4 reaction with PlP-VP23l2-a2s-Np (SEQ ID No. 59) as the padlock template probe and VP23l (SEQ IDNo. 55) DNA as the target (initial concentration of 10 -9 ~10 μM), the fluorescence emission peak intensity enhancement values in the large gradient range (L) and small gradient range (P), and the fluorescence emission spectrum (D) corresponding to the small gradient range; Meanwhile, (M, N, O, and P) were linearly fitted and the fitting results were shown. Detailed implementation manners
[0077] To make the present invention more obvious and understandable, preferred embodiments are hereby described in detail in conjunction with the accompanying drawings as follows.
[0078] The experimental methods used in the following embodiments are all conventional methods in the art unless otherwise specified.
[0079] The reagents, materials, etc. used in the following examples can be obtained through commercial channels without special instructions.
[0080] The RCA-H2O2-AgNCs / DNA nucleic acid detection system established by the present invention is as Figure 1 shown.
[0081] The sequences involved in the present invention are as follows:
[0082] DT-GSP-t1 (SEQ ID No.1) 29nt:
[0083] CCTCATCCCCCCCCCCCCCCCCGCCCGCC;
[0084] DT-GSP-t4 (SEQ ID No.2) 26nt:
[0085] CATCCCCCCCCCCCCCCCCGCCCGCC;
[0086] SPc-G-tra (SEQ ID No.3) 25nt:
[0087] GGGTGGGGTGGGGTGGGGGATGAGG;
[0088] (SPc-G-tra)n (n≥1) (SEQ ID No.4) (25)n nt:
[0089] (GGGTGGGGTGGGGTGGGGGATGAGG)n;
[0090] N(NC_045512.2,28827-28856) (SEQ ID No.5) 30nt:
[0091] GTTCCTCATCACGTAGTCGCAACAGTTCAA;
[0092] PlP-(DT-G2-tran)-2 (or PlP-D2) (SEQ ID No.6) 52nt:
[0093] 5’p-GATGAGGCCTCATCCCCCACCCCACCCCACCCGGCGGTAATTGCG ACTACGT;
[0094] DT-N-Pri1 (SEQ ID No.7) 20nt:
[0095] TTGAACTGTTAATTACCGCC;
[0096] Nl-1(NC_045512.2, 28815 - 28873)(SEQ ID No.8) 59 nt:
[0097] AAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGC;
[0098] Nl(NC_045512.2, 28800 - 28873)(SEQ ID No.9) 74 nt:
[0099] GCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGC;
[0100] Nl RNA(NC_045512.2, 28800 - 28873)(SEQ ID No.10) 74 nt:
[0101] GCAGAGGCGGCAGUCAAGCCUCUUCUCGUUCCUCAUCACGUAGUCGCAACAGUUCAAGAAAUUCAACUCCAGGC
[0102] Nl-M1(SEQ ID No.11) 74 nt:
[0103] GCAGAGGCGGCAGTCAAGCCTCTTCTCGTTACTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGC;
[0104] Nl-M2(SEQ ID No.12) 74 nt:
[0105] GCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCGTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGC;
[0106] Nl-M3(SEQ ID No.13) 74 nt:
[0107] GCAGAGGCGGCAGTCAAGCCCCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGC;
[0108] Nl-M4(SEQ ID No.14) 74 nt:
[0109] GCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACTGTTCAAGAAATTCAACTCCAGGC;
[0110] Nl-M5 (SEQ ID No.15) 74 nt:
[0111] GCAGAGACGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGC;
[0112] Nl-M6 (SEQ ID No.16) 74 nt:
[0113] GCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTTCAGGC;
[0114] PlP-Nl4 (SEQ ID No.17) 76 nt:
[0115] 5’p-GAACGAGAAGAGGCTTCATCCCCCACCCCACCCCACCCGGCGGTAATTTCTTGAACTGTTGCGACTACGTGATGAG;
[0116] PlP-Nl4-Np (SEQ ID No.18) 66 nt:
[0117] 5’p-GAACGAGAAGAGGCTTCATCCCCCACCCCACCCCACCCTCTTGAACTGTTGCGACTACGTGATGAG;
[0118] PlP-Nl4-s2-Np (SEQ ID No.19) 60 nt:
[0119] 5’p-GAACGAGAAGAGGCCATCCCCCACCCCACCCCACCCGAACTGTTGCGACTACGTGATGAG;
[0120] PlP-Nl4-s2a-Np (SEQ ID No.20) 67 nt:
[0121] 5’p-GAACGAGAAGAGGCCATCCCCCACCCCACCCCACCCAATCACGGAACTGTTGCGACTACGTGATGAG;
[0122] Pri-Nl-TP1(SEQ ID No.21)15 nt:GAATTAATTACCGCC;
[0123] E-Wild(EW:NC_045512.2,26260-26339)(SEQ ID No.22)80 nt:
[0124] TCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGC;
[0125] E-BA.2(EB:OX315675.1,25697-25776)(SEQ ID No.23)80 nt:
[0126] TCGGAAGAGATAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGC;
[0127] El-Wild(ElW:NC_045512.2,26245-26324)(SEQ ID No.24)80 nt:
[0128] ATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTT;
[0129] El RNA(NC_045512.2,26245-26324)(SEQ ID No.25)80 nt:
[0130] ATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTT;
[0131] El-BA.2(ElB:OX315675.1,25682-25761)(SEQ ID No.26)80 nt:
[0132] ATGTACTCATTCGTTTCGGAAGAGATAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTT;
[0133] PlP-EWm-Np(SEQ ID No.27)77 nt:
[0134] 5’p-TCTCTTCCGACATCCCCCACCCCACCCCACCCCGAAAGCAAGAAAAAGAAGTACGCTATTAACTATTAACGTACCTG;
[0135] PlP-EWs1-Np(SEQ ID No.28)67 nt:
[0136] 5’p-GTCTCTTCCGACATCCCCCACCCCACCCCACCCAAAAAGAAGTACGCTATTAACTATTAACGTACCT;
[0137] PlP-EWs1m-Np(SEQ ID No.29)67 nt:
[0138] 5’p-TCTCTTCCGACATCCCCCACCCCACCCCACCCAAAAAGAAGTACGCTATTAACTATTAACGTACCTG;
[0139] PlP-EWs2-Np(SEQ ID No.30)56 nt:
[0140] 5’p-GTCTCTTCCGACATCCCCCACCCCACCCCACCCCGCTATTAACTATTAACGTACCT;
[0141] PlP-EWs2m-Np(SEQ ID No.31)56 nt:
[0142] 5’p-TCTCTTCCGACATCCCCCACCCCACCCCACCCCGCTATTAACTATTAACGTACCTG;
[0143] PlP-EWs3-Np(SEQ ID No.32)44 nt:
[0144] 5’p-GTCTCTTCCGACATCCCCCACCCCACCCCACCCTTAACGTACCT;
[0145] PlP-EWs3m-Np (SEQ ID No.33) 44 nt:
[0146] 5’p-TCTCTTCCGACATCCCCCACCCCACCCCACCCTTAACGTACCTG;
[0147] PlP-EWl1-Np (SEQ ID No.34) 66 nt:
[0148] 5’p-GTCTCTTCCGAAACGACATCCCCCACCCCACCCCACCCAAGTACGCTATTAACTATTAACGTACCT;
[0149] PlP-EWl1m-Np (SEQ ID No.35) 66 nt:
[0150] 5’p-TCTCTTCCGAAACGACATCCCCCACCCCACCCCACCCAAGTACGCTATTAACTATTAACGTACCTG;
[0151] PlP-EBl1m-Np (SEQ ID No.36) 66 nt:
[0152] 5’p-TCTCTTCCGAAACGACATCCCCCACCCCACCCCACCCAAGTACGCTATTAACTATTAACGTACCTA;
[0153] PlP-EWl1m-Np-U (SEQ ID No.37) 22 nt:
[0154] 5’p-CTATTAACTATTAACGTACCTG;
[0155] PlP-EWl1m-Np-D (SEQ ID No.38) 44 nt:
[0156] 5’p-TCTCTTCCGAAACGACATCCCCCACCCCACCCCACCCAAGTACG;
[0157] PlP-EWl1m-Np-U2 (SEQ ID No.39) 14 nt: 5’p-TATTAACGTACCTG;
[0158] PlP-EWl1m-Np-D2 (SEQ ID No.40) 52 nt:
[0159] 5’p-TCTCTTCCGAAACGACATCCCCCACCCCACCCCACCCAAGTACGCTATTAAC;
[0160] PlP-EWl2-Np(SEQ ID No.41)74 nt:
[0161] 5’p-GTCTCTTCCGAAACGAATGAGTACATCATCCCCCACCCCACCCCACCCGTACGCTATTAACTATTAACGTACCT;
[0162] PlP-EWl2m-Np(SEQ ID No.42)74 nt:
[0163] 5’p-TCTCTTCCGAAACGAATGAGTACATCATCCCCCACCCCACCCCACCCGTACGCTATTAACTATTAACGTACCTG;
[0164] ORF1abl-Wild(ORF1ablW:NC_045512.2,14383-14462)(SEQ ID No.43)80nt:
[0165] GTTTTATTCTCTACAGTGTTCCCACCTACAAGTTTTGGACCACTAGTGAGAAAAATATTTGTTGATGGTGTTCCATTTGT;
[0166] ORF1abl RNA(NC_045512.2,14383-14462)(SEQ ID No.44)80 nt:
[0167] GUUUUAUUCUCUACAGUGUUCCCACCUACAAGUUUUGGACCACUAGUGAGAAAAAUAUUUGUUGAUGGUGUUCCAUUUGU;
[0168] ORF1abl-BA.2(ORF1ablB:OX315675.1,14121-14200)(SEQ ID No.45)80 nt:
[0169] GTTTTATTCTCTACAGTGTTCCCACTTACAAGTTTTGGACCACTAGTGAGAAAAATATTTGTTGATGGTGTTCCATTTGT;
[0170] PlP-ORF1ab-Wl1-Np (SEQ ID No.46) 66 nt:
[0171] 5’p-GGTGGGAACACTGTAGCATCCCCCACCCCACCCCACCCTTTTCTCACTAGTGGTCCAAAACTTGTA;
[0172] PlP-ORF1ab-Wl1m-Np (SEQ ID No.47) 66 nt:
[0173] 5’p-GTGGGAACACTGTAGCATCCCCCACCCCACCCCACCCTTTTCTCACTAGTGGTCCAAAACTTGTAG;
[0174] PlP-ORF1ab-Wl2m-a1-Np (SEQ ID No.48) 61 nt:
[0175] 5’p-GTGGGAACACTGTAGCATCCCCCACCCCACCCCACCCAAACAAGTGGTCCAAAACTTGTAG;
[0176] PlP-ORF1ab-Bl2m-a1-Np (SEQ ID No.49) 61 nt:
[0177] 5’p-GTGGGAACACTGTAGCATCCCCCACCCCACCCCACCCAAACAAGTGGTCCAAAACTTGTAA;
[0178] PlP-ORF1ab-Wl2m-a1-Np-U (SEQ ID No.50) 13 nt: 5’p-GTGGGAACACTGT; PlP-ORF1ab-Wl2m-a1-Np-D (SEQ ID No.51) 48 nt:
[0179] 5’p-AGCATCCCCCACCCCACCCCACCCAAACAAGTGGTCCAAAACTTGTAG;
[0180] PlP-ORF1ab-Wl2m-a1-Np-U2 (SEQ ID No.52) 13 nt: 5’p-CCAAAACTTGTAG;
[0181] PlP-ORF1ab-Wl2m-a1-Np-D2 (SEQ ID No.53) 48 nt:
[0182] 5’p-GTGGGAACACTGTAGCATCCCCCACCCCACCCCACCCAAACAAGTGGT;
[0183] PlP-ORF1ab-Wl2m-a2-Np(SEQ ID No.54)61 nt:
[0184] 5’p-GTGGGAACACTGTAGCATCCCCCACCCCACCCCACCCAACTACAAGGTCCAAAACTTGTAG;
[0185] VP23l((AB36516.1,1438-1511))(SEQ ID No.55)74nt:
[0186] TATGAAGATGGCCCCAACCAAAAGAAAAGGAGAGTGTCCAGGGGCAGCTCCCAAAAAGCCAAAGGAACCCGTGC;
[0187] PlP-VP23l2(SEQ ID No.56)76nt:
[0188] 5’p-ACACTCTCCTTTTCTTTTGGTTCATCCCCCACCCCACCCCACCCGGCGGTAATTGCTTTTTGGGAGCTGCCCCTGG;
[0189] PlP-VP23l2-Np(SEQ ID No.57)66nt:
[0190] 5’p-ACACTCTCCTTTTCTTTTGGTTCATCCCCCACCCCACCCCACCCGCTTTTTGGGAGCTGCCCCTGG;
[0191] PlP-VP23l2-a1s-Np(SEQ ID No.58)62nt:
[0192] 5’p-ACACTCTCCTTTTCTTTTGCATCCCCCACCCCACCCCACCCAACCAGGGGAGCTGCCCCTGG;
[0193] PlP-VP23l2-a2s-Np(SEQ ID No.59)64nt:
[0194] 5’p-ACACTCTCCTTTTCTTTTGCATCCCCCACCCCACCCCACCCAACCAGGATGGAGCTGCCCCTGG。
[0195] When naming the PlP sequence, m refers to the mutated base placed at the 3' end of PlP, s refers to the shortening of the PlP target sequence binding region, and a refers to adding a complementary sequence at the 3' end corresponding to the AgNCs hybridization enhancement region in PlP to form a stem-loop structure. PlP-W is completely complementary to the wild-type SARS-CoV-2 target gene, and PlP-B is completely complementary to the BA.2 mutant SARS-CoV-2 target gene.
[0196] Some of the reagents used in the embodiments of the present invention are as follows:
[0197] The composition of 5 μL of LM is:
[0198]
[0199] The composition of 8 μL of RM is:
[0200]
[0201]
[0202] Among them, phi29 DNA polymerase is diluted with 10×OP;
[0203] 10×LTA is a self-made ligation reaction buffer, and its components are:
[0204] 500 mM Tris-HAc;
[0205] 100 mM MgAc2; and,
[0206] 10 mM ATP;
[0207] 10×PA is a self-made polymerase reaction buffer, and its components are:
[0208] 500 mM Tris-HAc;
[0209] 100 mM MgAc2; and
[0210] 100 mM NH4Ac;
[0211] 10×OP is the original polymerase reaction buffer, and its components are:
[0212] 500 mM Tris-HCl
[0213] 100 mM MgCl2
[0214] 100 mM (NH4)2SO4 and
[0215] 40 mM DTT.
[0216] Example 1: Fluorescence Enhancement Characteristics of G-Rich Hybridization of AgNC / DT-GSP-t4
[0217] (1) Experimental Procedure
[0218] Prepare AgNCs / DNA (AgNCs / DT-GSP-t4 or AgNCs / DT-GSP-t1) according to the following method. Add equimolar AgNO3 and NaBH4 successively to the phosphate buffer containing DT-GSP-t4 (so that the final molar concentration ratios of DT-GSP-t4 or DT-GSP-t1, AgNO3, and NaBH4 are 1:26:26 or 1:29:29 respectively, where the final concentration of DT-GSP-t4 or DT-GSP-t1 DNA is 2.4 μM), and the phosphate buffer (Pi, pH 7.6, final concentration 20 mM). Among them, NaBH4 needs to be freshly prepared and quickly added to the mixture of Ag + / DT-GSP-t4 or Ag + / DT-GSP-t1 within 1 min, and then shake vigorously for ~30 s. The resulting solution is placed at room temperature in the dark for 18 h to obtain AgNCs / DT-GSP-t4 or AgNCs / DT-GSP-t1, and store it at 4°C in the dark for later use.
[0219] Subsequently, take 40 μL of the obtained AgNCs / DNA and add it to 10 μL of the phosphate buffer (Pi, pH 7.6, final concentration 20 mM) containing a specific concentration of G-rich sequence SPc-G-tra or its tandem repeat sequence (SPc-G-tra)2 or (SPc-G-tra)3, and then perform a hybridization reaction on a thermal cycler according to 95°C, 5 min, 25°C, 30 min. The resulting reaction mixture is diluted 2-fold or not diluted, and fluorescence spectrum detection is performed on a Cytation 5 multimode microplate reader (Biotek, USA) (excitation wavelength λ ex = 540 nm, excitation and emission slits are 10 nm, gain = 60, scanning step size 1 nm). Subsequently, grayscale photos and fluorescence imaging photos under ultraviolet lamp irradiation are collected on a gel imaging system (2500 Gel Image System, Tanon, China).
[0220] (2) Experimental Results
[0221] First, based on the rolling circle amplification (RCA) reaction and the design principle of the padlock probe PlP (padlock probe), we designed signal probes AgNCs / DT-GSP-t4 or AgNCs / DT-GSP-t1 (abbreviated as C) synthesized using the rich C sequence DT-GSP-t4 or DT-GSP-t1 as templates by shortening the hybridization sequence length, and investigated their original fluorescence enhancement effect of rich G. We found that both of them showed fluorescence enhancement ( Figure 2 A-D) after adding the hybrid complementary strand SPc-G-tra (abbreviated as G) containing the rich G sequence, and the emission peaks (λ ex = 540 nm / λ em = 620 nm) increased with the increase in the concentration of SPc-G-tra, that is, both had the fluorescence enhancement effect near rich G, and it had a concentration gradient dependence on the rich G sequence. However, AgNCs / DT-GSP-t4 ( Figure 2 A and Figure 2 C) had higher fluorescence emission peak intensity and enhancement degree than AgNCs / DT-GSP-t1 ( Figure 2 B and Figure 2 D), so the former was selected as the RCA signal probe for subsequent experiments. Then, we further used multiple repeat elements (SPc-G-tra)n (n≥1) of SPc-G-tra as complementary rich G enhancement sequences to simulate multiple repeat complementary enhancement elements generated by RCA products, and evaluated their influence on the fluorescence enhancement effect of rich G. We found that when the concentration of AgNCs / DT-GSP-t4 was kept constant, gradually increasing the number n of rich G elements achieved a similar fluorescence enhancement effect as increasing the concentration of the rich G sequence ( Figure 2 E and Figure 2 G). When the concentration of multiple repeat elements (SPc-G-tra)n (n≥1) was kept constant and only the corresponding AgNCs / DT-GSP-t4 concentration was increased (so that AgNCs / DT-GSP-t4 (abbreviated as C): SPc-G-tra (abbreviated as G) = 1:1), we found that in the hybridization mixture nC(G)n (n≥1), as the n value increased, the fluorescence intensity also gradually increased ( Figure 2 F and Figure 2 H). These results suggest that an increase in the number n of elements in the tandem repeat sequence of multiple elements (SPc-G-tra)n maintains a fluorescence enhancement effect similar to that of an increase in the concentration of the SPc-G-tra sequence. In summary, we screened the red AgNCs / DT-GSP-t4 probe, whose fluorescence enhancement effect has a dependence on the rich G sequence concentration and the number of elements, and can be used as a signal probe for subsequent RCA reactions.
[0222] Example 2: Compatibility between RCA and AgNCs / DT-GSP-t4
[0223] (1) Experimental procedure
[0224] Prepare a sufficient amount of 3 μM AgNCs / DT-GSP-t4 signal probe according to the method in Example 1. Subsequently, take 40 μL of the obtained AgNCs / DT-GSP-t4 and add it to 10 μL of phosphate buffer (Pi, pH 7.6, final concentration 20 mM) containing 12 μM SPc-G-tra and different concentrations of DTT (dithiothreitol, final concentration in the 50 μL system is 5 - 400 μM). Or take 40 μL of the obtained AgNCs / DT-GSP-t4 and add it to 10 μL of different buffer systems containing 12 μM SPc-G-tra (phosphate buffer system (Pi, pH 7.6, final concentration 20 mM) or final concentrations of 1×LTA, 1×LTM, 1×PA, and 1×PM). Finally, perform the hybridization reaction according to the method in Example 1, and conduct fluorescence spectroscopy (excitation wavelength λ ex = 540 nm, excitation and emission slits are 10 nm, gain = 60, scanning step 1 nm) and absorption spectroscopy measurements (scanning range 400 - 700 nm, scanning step 1 nm) on a Cytation 5 multifunctional microplate reader.
[0225] In addition, the RCA reaction solution is prepared according to a two-step reaction. First, prepare 10 μL of ligation reaction mixture: 2.5 μL of enzyme-free water (MC119A, Promega, USA), 1 μL of 10× T4 DNA ligase buffer (product number B0202S, New England BioLabs, USA), 1 μL of 10 μM PlP-(DT-G2-tran)-2 (abbreviated as PlP-D2), 0.5 μL of 400 U / μL T4 DNA ligase (product number M0202S, New England BioLabs, USA), 5 μL of N target (final concentration 0 or 0.1 μM in a 10 μL final volume). The resulting reaction solution is subjected to a ligation reaction on a thermal cycler at 25 °C for 10 min and 65 °C for 10 min. Then, prepare 10 μL of RCA reaction mixture: 5.5 μL of enzyme-free water (MC119A, Promega, USA), 1 μL of 10× phi29 DNA polymerase buffer (product number B0269S, New England BioLabs, USA), 0.2 μL of 10 μM primer, 0.4 μL of 10 mM dNTP, 0.1 μL of 10 mg / mL recombinant albumin (product number B9200S, New England BioLabs, USA), 0.8 μL of 1 U / μL phi29 DNA polymerase (product number M0269S, New England BioLabs, USA), and 2 μL of the aforementioned ligation reaction product. The resulting mixture is subjected to an amplification reaction on a thermal cycler at 30 °C for 30 min and 65 °C for 10 min.
[0226] Take an appropriate amount of RCA reaction product and mix it with 6× DNA loading buffer to obtain an RCA loading sample. At the same time, prepare a 0.5% agarose gel, load 6 - 10 μL, pre-stain with ethidium bromide EB, and perform electrophoresis at a constant voltage of 100 V for 40 - 50 min.
[0227] (2) Experimental results
[0228] Before using AgNCs / DT-GSP-t4 as a signal probe in the RCA reaction, it is necessary to first investigate their compatibility. Since the ligation reaction and RCA reaction buffers contain a large amount of DTT, we first evaluated the effect of DTT on the G-rich fluorescence enhancement effect of AgNCs / DT-GSP-t4 ( Figure 3(A-B), it was found that DTT below 60 μM (in 10 μL of the SPc-G-tra mixture) quenched the fluorescence of the hybridization mixture CG of AgNCs / DT-GSP-t4 and SPc-G-tra weakly, but DTT above this concentration rapidly quenched the fluorescence of CG, and there was no fluorescence at all when it reached 200 μM. At the same time, the absorption spectrum measurement showed that the C reaction solution had an absorption peak at about 650 nm, while the absorption peak of the CG reaction solution blue-shifted to around 530 nm ( Figure 3 C), and the latter was consistent with the fluorescence excitation wavelength.
[0229] Therefore, we prepared a reaction buffer without DTT and investigated its effect on the fluorescence enhancement effect of AgNCs / DT-GSP-t4 rich in G ( Figure 3 (D-F), it was found that the self-prepared ligation reaction buffer LTA and the self-prepared DNA polymerization reaction buffer PA could retain the fluorescence enhancement effect similar to that under the Pi buffer condition to the greatest extent. Therefore, in the following, the buffer combination of LTA and PA was mainly used for the RCA reaction (RCA-AgNCs / DT-GSP-t4 reaction) with AgNCs / DT-GSP-t4 as the signal probe.
[0230] At the same time, when the self-prepared buffer was used for the RCA reaction, we found that under the condition of diluting phi29 with the original phi29 DNA polymerase buffer OP, and, it was possible to freely combine any one of the ligation reaction buffer (self-prepared T4 DNA ligase buffer LTA and LTM without DTT and the original T4 DNA ligase buffer OT) and the RCA reaction buffer (phi29 DNA polymerase buffer PA and PM without DTT and the original phi29 DNA polymerase buffer OP). After adding the target, bands appeared for any combination of buffer pairs, indicating that the RCA reaction could be successfully carried out ( Figure 3 G).
[0231] And from Figure 3 H, it can be seen that using the self-prepared buffer combination of LTA-PM with different phi29 diluents, including the original OP, the self-prepared buffer PM without DTT and PA, there were indeed bands only when OP was used in the whole RCA system. The reaction system mediated by the combination of the original ligation reaction buffer OT and the RCA reaction buffer OP was also the brightest when OP was used as the phi29 diluent, indicating that the original phi29 buffer OP containing DTT was crucial for maintaining the dilution activity of phi29. In the LTA-PM system without DTT, adding PM or PA without DTT for phi29 dilution would directly result in the inability to carry out the RCA reaction.
[0232] In summary, we finally obtained a self-made LTA-PA buffer system that can maximize the removal of DTT, which can minimize the influence on the fluorescence enhancement effect of the signal probe. However, in order to retain the RCA reaction activity, it is necessary to dilute phi29 with the original buffer containing DTT, resulting in a DTT concentration of 676 μM in the entire RCA system, which is sufficient to quench fluorescence. Therefore, it is still necessary to remove the influence of these residual DTTs.
[0233] Example 3: Optimization of RCA-H2O2-AgNCs / DNA Reaction Conditions and Procedures
[0234] (1) Experimental Procedures
[0235] First, optimize the reaction conditions and procedures of DTT-H2O2-AgNCs / DNA. (1) Optimization experiments of H2O2 and AgNCs / DNA concentrations: First, prepare 10 μL of reaction mixtures containing different concentrations of G-rich sequence SPc-G-tra (36, 48, 60 μM), 0.4 mM DTT, different volume fractions of H2O2 (0.001, 0.005, 0.01, 0.05%), and 20 mM phosphate buffer (Pi, pH = 7.6), and place them at room temperature for 20 min; then add 40 μL of AgNCs / DT-GSP-t4 (SEQ ID No. 2) with different concentrations (9, 12, 15 μM), and place them at room temperature for 5 - 10 min; subsequently, measure the fluorescence signals according to the method in Example 2. (2) Optimization experiment of DTT-H2O2 reaction time: First, prepare 10 μL of reaction mixtures containing 60 μM G-rich sequence SPc-G-tra, 0.4 mM DTT, 0.005% volume fraction of H2O2, and 0.2×LTA and 1×PA, and place them at room temperature for different times (5, 10, 20, and 30 min); then add 40 μL of 15 μM AgNCs / DT-GSP-t4 (SEQ ID No. 2), and place them at room temperature for 5 - 10 min; subsequently, measure the fluorescence signals according to the method in Example 2. (3) Optimization experiment of DTT-H2O2-AgNCs / DNA reaction procedures: First, prepare 10 μL of reaction mixtures containing 60 μM SPc-G-tra, 0.4 mM DTT, 0.005% H2O2, and 0.2×LTA and 1×PA, and incubate them at 25°C for 20 min or at 95°C for 5 min; then add 40 μL of 15 μM AgNCs / DT-GSP-t4 (SEQ ID No. 2), heat (perform hybridization reaction on a thermal cycler at 95°C for 5 min and 25°C for 30 min) or place them at room temperature for 5 min; subsequently, measure the fluorescence signals according to the method in Example 2.
[0236] Next, using PlP-D2 (SEQ ID No.6) as the padlock probe, DT-N-Pri1 (SEQ ID No.7) as the primer, and the N (SEQ ID No.5) DNA in the wild-type N gene of SARS-CoV-2 as the target, the RCA reaction and the reaction conditions and procedures of RCA-H2O2-AgNCs / DNA were optimized. In the two-enzyme one-step RCA reaction system, the ligation reaction premix Ligationmix (LM) and the RCA reaction premix RCA mix (RM) were respectively prepared, and then according to 1 μL LM, 1 μL target (final concentrations of 0, 0.1, and 1 μM), and 8 μL RM, a 10 μL reaction system was obtained. Among them, the composition of 5 μL LM was: 3.4 μL enzyme-free water (MC119A, Promega, USA), 1 μL 10×LTA, 0.5 μL 100 μM PlP-D2, and 0.1 μL 400 U / μL T4 DNA ligase (product number M0202S, New England BioLabs, USA). The composition of 8 μL RM with primer was: 4.7 μL enzyme-free water (MC119A, Promega, USA), 1 μL 10×PA, 0.1 μL 10 mg / mL recombinant albumin (product number B9200S, New England BioLabs, USA), 0.4 μL 10 mM dNTP, 0.2 μL 100 μM primer, 1.6 μL 1 U / μL phi29 DNA polymerase (product number M0269S, New England BioLabs, USA). The reaction system was subjected to a two-enzyme one-step RCA reaction on a thermal cycler: 30 °C, 30 min, 4 °C, forever. Subsequently, the fluorescence signal was measured according to the method in Example 2. In the experiment for optimizing the H2O2 concentration in the RCA-H2O2-AgNCs / DNA reaction, different volumes (0, 0.5, 0.846, 0.87, 0.92, and 1 μL) of 0.1% H2O2 were added to the above 10 μL RCA reaction product, and it was left standing at room temperature (RT) for 5 min, and then 40 μL of 15 μM AgNCs / DT-GSP-t4 (SEQ ID No.2) was added and left standing at room temperature for 5 min. Subsequently, the fluorescence signal was measured according to the method in Example 2.
[0237] In the experiment for optimizing the H2O2 reaction time in the RCA-H2O2-AgNCs / DNA reaction, 0.846 μL of 0.1% H2O2 was added to the above 10 μL RCA reaction product, and it was left standing at room temperature (RT) for different times (0, 1, 5, 10, and 20 min), and then 40 μL of 15 μM AgNCs / DT-GSP-t4 (SEQ ID No.2) was added and left standing at room temperature for 5 min. Subsequently, the fluorescence signal was measured according to the method in Example 2.
[0238] In the experiment for optimizing the reaction time of AgNCs in the RCA-H2O2-AgNCs / DNA reaction, 0.846 μL of 0.1% H2O2 was added to the above-mentioned 10 μL of RCA reaction product, and the mixture was allowed to stand at room temperature (RT) for 5 min. Then, 40 μL of 15 μM AgNCs / DT-GSP-t4 (SEQ ID No. 2) was added, and the mixture was allowed to stand at room temperature for different times (5, 10, 20 min). Subsequently, the fluorescence signal was measured according to the method in Example 2.
[0239] In Experiment I for optimizing the RCA-H2O2-AgNCs / DNA reaction procedure, the RCA reaction solution was prepared according to the aforementioned steps. Subsequently, the RCA reaction and the addition of H2O2 were carried out according to different procedures (Procedure 1-5) (0.846 μL of 0.1% H2O2 was added in the procedures where H2O2 needed to be added): (Procedure 1) RCA: 30 °C, 30 min, 4 °C, forever, H2O2: RT, 5 min; (Procedure 2) RCA: 30 °C, 30 min, 65 °C, 10 min, 4 °C, forever, H2O2: RT, 5 min; (Procedure 3) RCA: RT, 30 min, 4 °C, forever, H2O2: RT, 5 min; (Procedure 4) RCA: 30 °C, 30 min, 4 °C, forever, H2O2: 95 °C, 5 min; (Procedure 5) RCA: 30 °C, 30 min, 95 °C, 5 min, 4 °C, forever. Finally, 40 μL of 15 μM AgNCs / DT-GSP-t4 (SEQ ID No. 2) was added, and the mixture was allowed to stand at room temperature for 5 min. The resulting reaction solution was subjected to fluorescence signal measurement and gel electrophoresis characterization according to the method in Example 2.
[0240] In the optimization experiment II of the RCA-H2O2-AgNCs / DNA reaction procedure, the RCA reaction solution was prepared according to the aforementioned steps. Subsequently, the RCA reaction was carried out according to different procedures (a-d), and H2O2 (0.846 μL, 0.1% H2O2) or AgNCs / DT-GSP-t4 (40 μL, 15 μM) was added. (a) RCA-25: RCA: 30 °C, 30 min, 4 °C, forever, H2O2: 25 °C, 5 min; (b) RCA-30: RCA: 30 °C, 30 min, 4 °C, forever, H2O2: 30 °C, 5 min; (c) RCA-H2O2: After the mixture of the RCA reaction solution and H2O2 was prepared in a reaction tube, it was incubated at 30 °C for 30 min and at 4 °C forever; (d) RCA-H2O2-AgNCs / DNA: After the mixture of RCA, H2O2 and AgNCs / DT-GSP-t4 (SEQ ID No. 2) was prepared in a reaction tube, it was incubated at 30 °C for 30 min and at 4 °C forever. The resulting reaction solution was subjected to fluorescence signal measurement and gel electrophoresis characterization according to the method in Example 2.
[0241] All the steps of adding reagents above need to be operated on ice.
[0242] (2) Experimental results
[0243] We optimized the reaction conditions and procedures of the mixture of RCA, H2O2 and AgNCs / DT-GSP-t4 (RCA-H2O2-AgNCs / DNA) by introducing H2O2 to eliminate the influence of residual DTT in the RCA reaction on the fluorescence performance of AgNCs / DNA. First, we optimized the reaction concentration and time of H2O2. First, the reaction conditions were optimized with a mixture containing the G-rich enhancer element SPc-G-tra, a specific concentration of DTT, H2O2 and AgNCs / DT-GSP-t4 (DTT-H2O2-AgNCs / DNA). In the optimization experiment of the H2O2 and AgNCs / DNA concentrations, we found that the fluorescence enhancement amplitude of the resulting reaction solution was the largest when 15 μM AgNCs / DT-GSP-t4 was added under the condition of 0.4 mM DTT: 0.005% H2O2 ( Figure 4 A). Then, the optimization of the DTT-H2O2 reaction time showed that as the reaction time of the two increased from 5 min to 30 min at room temperature, the fluorescence enhancement degree of the DTT-H2O2-AgNCs / DT-GSP-t4 reaction system also gradually increased ( Figure 4 B). Based on this, we also optimized the DTT-H2O2-AgNCs / DNA reaction procedure, as Figure 4As shown in C, whether H2O2 is added or not, simply incubating the DTT-H2O2 reaction mixture at 95 °C for 5 min (DTT-95 °C and DTT-H2O2-95 °C) can also eliminate the influence of DTT and achieve fluorescence enhancement of AgNCs / DT-GSP-t4. However, when treating DTT-H2O2 at room temperature, H2O2 must be added (DTT-H2O2-25 °C) to achieve fluorescence enhancement of AgNCs / DT-GSP-t4. After adding AgNCs / DT-GSP-t4 and heating the reaction mixture, the fluorescence of the resulting reaction solution (DTT-H2O2-95 °C+Heat and DTT-H2O2-25 °C+Heat) is quenched under any incubation conditions.
[0244] Theoretically, the residual DTT in the RCA reaction system only comes from the original buffer OP used for diluting phi29, reaching 676 μM DTT. According to the optimal DTT-H2O2 concentration ratio determined by the previous DTT-H2O2-AgNCs experiment ( Figure 4 A), we obtained that 0.845 μL of 0.1% H2O2 should be added to the RCA reaction solution. Figure 5 A shows that as the H2O2 concentration increases, the intensity value of the fluorescence emission peak generally decreases; Figure 5 D shows that the fluorescence enhancement is the weakest without adding H2O2, the fluorescence enhancement degree is the highest when adding 0.5 μL of 0.1% H2O2, and there is little difference when adding 0.846, 0.87, and 0.92 μL of H2O2. In order to ensure the best DTT scavenging effect, we finally used 0.846 μL of H2O2 for subsequent experiments. In the RCA-H2O2-AgNCs / DNA system, when the H2O2 concentration is fixed, as the H2O2 reaction time prolongs, the intensity of the fluorescence emission peak decreases overall ( Figure 5 B). However, fortunately, as the addition of H2O2 increases, the fluorescence emission peak intensity enhancement value increases. The fluorescence peak enhancement values of 1 μM target are not much different, while the enhancement values of 0.1 μM target are larger at 5 or 10 min ( Figure 5 E). In order to shorten the reaction time while maintaining the fluorescence signal, the H2O2 reaction time was finally taken as 5 min for subsequent experiments.
[0245] Second, we optimized the AgNCs / DNA reaction time. From Figure 5 C and Figure 5It can be seen that the overall fluorescence emission peak intensity value increases with the extension of the AgNCs / DNA reaction time, while the increased value of the fluorescence emission peak intensity first increases and then decreases as the AgNCs / DNA reaction time ranges from 5 min, through 10 min, to 20 min. Finally, we selected an AgNCs / DNA reaction time of 5 - 10 min for subsequent experiments.
[0246] Thirdly, we optimized the reaction procedure to determine the optimal reaction temperature of H2O2 and evaluate the feasibility of the RCA - H2O2 - AgNCs / DNA one - step reaction. On the one hand, considering that the fluorescence enhancement effect of DTT - AgNCs / DNA or DTT - H2O2 - AgNCs / DNA can be retained after reacting at 95 °C for 5 min - Figure 4 C), we attempted the procedure of 95 °C in the RCA - H2O2 - AgNCs / DNA reaction. As can be seen from Figure 6 A and Figure 6 B, only by slightly adjusting the RCA reaction (procedures 1 - 3), while still maintaining a 5 - min reaction at room temperature after adding H2O2, the fluorescence emission peak intensity values and the increased values of the fluorescence emission peak intensity of the three groups of reactions showed good gradient enhancement; however, when H2O2 was added (procedure 4, RCA: 30 °C for 30 min, 4 °C forever, H2O2: 95 °C for 5 min) or not added (procedure 5, RCA: 30 °C for 30 min, 95 °C for 5 min, 4 °C forever) after the RCA reaction at 30 °C and then treated at 95 °C, instead, the increased value of the fluorescence peak decreased with the increase of the target concentration. Gel imaging showed that all reactions normally generated the corresponding target bands Figure 6 C). Therefore, the abnormal fluorescence signals in procedures 4 and 5 may mainly stem from the DTT treatment problem. On the other hand, to further simplify the experimental steps, we attempted a one - step reaction. Adding H2O2 Figure 5 RCA - H2O2 in Figure 5 D - E) or even AgNCs / DNA Figure 6 RCA - H2O2 - AgNCs / DNA in Figure 6 D - E) during the preparation stage of the RCA reaction solution, it can be seen that both the fluorescence emission peak intensity values Figure 6 D) and their increased values Figure 6 E) showed a decreasing trend. Correspondingly, when the RCA and H2O2 reactions were carried out separately, the fluorescence emission peak intensity values and their increased values still showed a gradient increase. Gel imaging Figure 6 F) showed that except for the RCA - H2O2 - AgNCs / DNA one - step reaction system without target bands, the rest all generated gradient - enhanced target bands. Therefore, the RCA - H2O2 - AgNCs / DNA cannot proceed according to the one - step reaction procedure.
[0247] In summary, finally, we will obtain a mixed solution according to 10 μL RCA (30 °C, 30 min, 4 °C forever), 0.846 μL 0.1% H2O2 (added on ice, 5 min at room temperature), and 40 μL 15 μM AgNCs / DNA (added on ice, 5 min at room temperature), and conduct subsequent experiments.
[0248] Example 4: Primer independence and breakpoint recognition of PlP-mediated RCA reaction
[0249] (1) Experimental procedure
[0250] Using PlP-Nl4 (SEQ ID No. 17) as the padlock template probe and N (SEQ ID No. 5) DNA in the SARS-CoV-2 wild-type N gene as the target, the RCA-H2O2-AgNCs / DNA reaction was carried out in the absence or presence of primers. The ligation reaction premix Ligation mix (LM) and the RCA reaction premix RCA mix (RM) were still prepared according to the two-enzyme one-step RCA reaction system. Then, according to 1 μL LM, 1 μL target (final concentrations of 0, 0.1, and 1 μM), and 8 μL RM, a 10 μL reaction system was mixed. Among them, the composition of 5 μL LM was: 3.4 μL enzyme-free water (MC119A, Promega, USA), 1 μL 10×LTA, 0.5 μL 100 μM padlock template probe PlP, and 0.1 μL 400 U / μL T4 DNA ligase (product number M0202S, New England BioLabs, USA). The composition of 8 μL primer-free RM was: 4.9 μL enzyme-free water (MC119A, Promega, USA), 1 μL 10×PA, 0.1 μL 10 mg / mL recombinant albumin, 0.4 μL 10 mM dNTP, and 1.6 μL 1 U / μL phi29 DNA polymerase (product number M0269S, New England BioLabs, USA), and the composition of RM with primers was as described in Example 3. The reaction system was subjected to a two-enzyme one-step RCA reaction on a thermal cycler: 30 °C, 30 min, 4 °C, forever. Subsequently, 0.846 μL 0.1% H2O2 was added to the obtained 10 μL RCA reaction product, and it was left standing at room temperature (RT) for 5 min, and then 40 μL 15 μM AgNCs / DT-GSP-t4 (SEQ ID No. 2) was added, and it was left standing at room temperature for another 5 min. All steps of adding reagents needed to be carried out on ice. The reaction solutions obtained above were all subjected to fluorescence spectroscopy, absorption spectroscopy, and gel electrophoresis detection according to the method in Example 2.
[0251] (2) Experimental results
[0252] To investigate the effect of primers on the RCA reaction, we used PlP-Nl4 as the padlock template probe and N DNA in the SARS-CoV-2 wild-type N gene as the target, and carried out the RCA-H2O2-AgNCs / DNA reaction with or without primers. As can be seen from Figure 7 A-C, the fluorescence intensities of both systems increased gradually with or without primers ( Figure 7 A and Figure 6 B), and the same gel bands were shown ( Figure 7 D). Furthermore, it was indicated that the padlock template probe PlP could perform the two-enzyme one-step RCA and RCA-H2O2-AgNCs / DNA reactions without relying on primers. Therefore, primers were no longer added in the subsequent RCA reactions. The secondary structure diagram of PlP-Nl4 showed that it had three stem-loop structures, and one of them was in the AgNCs / DNA-rich G fluorescence enhancement region ( Figure 7 C), which might be the reason for the weak enhancement value of its fluorescence signal peak.
[0253] Next, by designing the mismatched or mutated sites (M) on the target Nl in different regions of the corresponding PlP, we found that there were no amplification bands at the M1 and M2 sites, indicating that PlP-RCA-H2O2-AgNCs / DNA mainly recognized the single-base mismatches located at the PlP ligation site. However, non-specific bands were generated for the single-base mismatches such as M4-6 far from the ligation site, and the recognition effect was poor ( Figure 7 E).
[0254] Example 5: Optimization of the padlock template probe PlP-E
[0255] (1) Experimental procedure
[0256] Using PlP-EWm-Np (SEQ ID No.27), PlP-EWs1(m)-Np (SEQ ID No.28(29)), PlP-EWs2(m)-Np (SEQ ID No.30(31)), PlP-EWs3(m)-Np (SEQ ID No.32(33)), PlP-EWl1(m)-Np (SEQ ID No.34(35)), and PlP-EWl2(m)-Np (SEQ ID No.41(42)) as padlock template probes and the wild-type (Wild) or mutant (BA.2) E gene of SARS-CoV-2 as the target, the RCA-H2O2-AgNCs / DNA reaction was carried out without primers. The ligation reaction premix Ligation mix (LM) and the RCA reaction premix RCA mix (RM) were still prepared according to the two-enzyme one-step RCA reaction system. Then, 1 μL of LM, 1 μL of the target (final concentration 0.1 μM), and 8 μL of RM were mixed to obtain a 10 μL reaction system. Among them, the composition of 5 μL of LM was: 3.4 μL of enzyme-free water (MC119A, Promega, USA), 1 μL of 10×LTA, 0.5 μL of 100 μM padlock template probe PlP, and 0.1 μL of 400 U / μL T4 DNA ligase (product number M0202S, New England BioLabs, USA). The composition of 8 μL of RM was: 4.9 μL of enzyme-free water (MC119A, Promega, USA), 1 μL of 10×PA, 0.1 μL of 10 mg / mL recombinant albumin (product number B9200S, New England BioLabs, USA), 0.4 μL of 10 mM dNTP, and 1.6 μL of 1 U / μL phi29 DNA polymerase (product number M0269S, New England BioLabs, USA). The reaction system was subjected to a two-enzyme one-step RCA reaction on a thermal cycler: 30 °C for 30 min, 4 °C forever. Subsequently, 0.846 μL of 0.1% H2O2 was added to the obtained 10 μL of RCA reaction product, and it was allowed to stand at room temperature (RT) for 5 min. Then, 40 μL of 15 μM AgNCs / DT-GSP-t4 was added, and it was allowed to stand at room temperature for another 5 min. All steps of adding reagents were required to be carried out on ice. The reaction solutions obtained above were all subjected to fluorescence spectroscopy, absorption spectroscopy, and gel electrophoresis detection according to the method in Example 2.
[0257] (2) Experimental results
[0258] By changing the positions of the target region and the mutation site at the ligation end of the padlock probe PlP, we designed a series of padlock template probes PlP-E targeting the SARS-CoV-2 E gene for the RCA-H2O2-AgNCs / DNA reaction to explore the characteristics and rules of the PlP sequence and structure design in the reaction system, so as to obtain the maximum detection signal-to-noise ratio. From Figure 8 As can be seen from A and C, the PlP-EWs1m or s2m-Np probe shows fluorescence quenching when recognizing EB DNA, forming a strong signal difference with the target EW DNA. Among them, PlP-EWs1m-Np performs particularly well, showing a strong fluorescence enhancement signal when detecting EW DNA and a strong fluorescence quenching signal when detecting EB DNA. We further adjusted the detection target region and designed PlP-EWs3(m), l1(m), l2(m)-Np, and found that PlP-EWl1m-Np forms a strong signal difference when recognizing ElW and ElB DNA, and the gel electrophoresis is basically consistent with the AgNCs fluorescence signal ( Figure 8 E and G). The gel electrophoresis results show that all PlP-Exm-Np (x = s1, s2, s3, l1, placing the mutation site at the 3' end of PlP, i.e., on the side of the long target complementary sequence) can recognize the E gene of the mutant SARS-CoV-2 BA.2 type ( Figure 8 I and J), among which the one with the largest signal-to-noise ratio is PlP-EWl1m-Np. Therefore, we subsequently selected PlP-EWl1m-Np for the specificity and sensitivity detection of the target.
[0259] We further analyzed the mFold secondary structure of the PlP-E probe series and found that the RCA-H2O2-AgNCs / DNA reaction mediated by the padlock probe PlP with a stem-loop structure at the 3' end showed significant fluorescence enhancement. Among them, the detection signal-to-noise ratios of PlP-EWs1m-Np and PlP-EWl1m-Np were relatively large, and the mFold secondary structures of the two showed common characteristics. Specifically, PlP-EWs1m-Np has a single secondary structure, Tm = 45.5 °C, and a stem-loop structure at the 3' end ( Figure 8 D), with an interval of 8 bases (AAAAAGAA) from the AgNCs / DNA enhancement region, and strong fluorescence ( Figure 8 A and 8C), and can distinguish EW and EB ( Figure 8 A, 8C and 8I). And PlP-EWl1m-Np also has a single secondary structure, Tm = 45.5 °C, and a stem-loop structure at the 3' end ( Figure 8 H), with an interval of 2 bases (AA) from the AgNCs / DNA enhancement region, and strong fluorescence ( Figure 8 E and 8G), and can distinguish ElW and ElB ( Figure 8E, 8G, and 8J). The absorption spectra of both showed that an absorption peak around 520 - 540 nm was generated only when ElW DNA was added. Figure 8 B and 8F), contributing to the excitation of fluorescence.
[0260] In summary, the present invention found that the fluorescence of RCA - AgNCs / DNA is affected by two factors: the amount of products generated by the RCA reaction and the strength of the fluorescence enhancement effect of AgNCs / DNA hybridization. Among them, the latter is related to the PlP sequence composition and the hairpin structure. The design principle of PlP is: (1) The 5' end of PlP needs to have no neck - loop structure, especially no neck - loop near the CATC in the signal probe hybridization region, to ensure the smooth hybridization of AgNCs / DNA; (2) The 3' end of PlP needs to have a neck - loop structure, and this neck - loop is located near the 3' end of the AgNCs / DNA enhancement region to achieve the optimal fluorescence enhancement effect.
[0261] Example 6: Optimization of the padlock template probe PlP - N / ORF1ab / VP23
[0262] (1) Experimental steps
[0263] Using three groups of padlock template probes, namely PlP-Nl4 (SEQ ID No.17), PlP-Nl4-Np (SEQ ID No.18), PlP-Nl4-s2-Np (SEQ ID No.19), PlP-Nl4-s2a-Np (SEQ ID No.20); PlP-ORF1ab-Wl1-Np (SEQ ID No.46), PlP-ORF1ab-Wl1m-Np (SEQ ID No.47), PlP-ORF1ab-Wl2m-a1-Np (SEQ ID No.48), PlP-ORF1ab-Wl2m-a2-Np (SEQ ID No.54); PlP-VP23l2 (SEQ ID No.56), PlP-VP23l2-Np (SEQ ID No.57), PlP-VP23l2-a1s-Np (SEQ ID No.58), PlP-VP23l2-a2s-Np (SEQ ID No.59), they were respectively paired with three groups of detection targets, namely the SARS-CoV-2 wild-type N gene (Nl (SEQ ID No.9) DNA), the wild-type or mutant (BA.2) ORF1ab gene (ORF1ablW (SEQ ID No.43) and ORF1ablB (SEQ ID No.45) DNA), and the overlapping region of the VP2 and VP3 genes of BK polyomavirus (BKV) (VP23l (SEQ ID No.55) DNA). Under the condition of no primer, the RCA-H2O2-AgNCs / DNA reaction, fluorescence spectrum, absorption spectrum and gel electrophoresis were measured according to the "experimental procedure" in Example 5. The final concentration of the target to be measured in the 10 μL RCA reaction system was 0.1 μM.
[0264] (2) Experimental results
[0265] On the basis of obtaining the design rules of the padlock template probe PlP, according to this principle, by changing the length of the target binding region, or adding complementary sequences to the 3' end of the corresponding AgNCs / DNA hybridization enhancement region in PlP to form a stem-loop structure, or placing the mutant base recognition at the 3' end of PlP, three groups of candidate PlPs targeting the other two target genes N and ORF1ab of SARS-CoV-2 virus and the overlapping region of VP2 and VP3 genes of BKV virus were designed to screen the PlP that showed the best fluorescence enhancement effect in the RCA-H2O2-AgNCs / DNA reaction. It can be seen from the fluorescence emission peak intensity enhancement value graph that among the candidate groups of PlP-N, PlP-ORF1ab and PlP-VP23, PlP-Nl4-s2a-Np ( Figure 9A), PlP-ORF1ab-Wl2m-a1-Np( Figure 9 B) and PlP-VP23l2-a2s-Np( Figure 9 C) can obtain the maximum fluorescence enhancement signal-to-noise ratio. At the same time, the gel grayscale map shows that all three also generate specific target bands well( Figure 9 D-F). In addition, the mFold secondary structure analysis shows that PlP-Nl4-s2a-Np( Figure 9 G) and PlP-VP23l2-a2s-Np( Figure 9 I) satisfy that there is no neck-loop structure at the 5' end of PlP, and there is a neck-loop structure only at the 3' end of the corresponding AgNCs / DNA enhancement region in PlP, and both show the optimal fluorescence enhancement effect. And PlP-ORF1ab-Wl2m-a1-Np( Figure 9 H) contains a neck-loop structure at the 3' end of the corresponding AgNCs / DNA enhancement region, and at the same time, the 5' end target sequence binding region also contains a neck-loop structure. Therefore, this may lead to the fact that the BA.2 mutant target ORF1ablB DNA of ORF1ab can also make PlP-ORF1ab-Wl2m-a1-Np generate weak non-specific bands( Figure 9 E), but the overall impact can be ignored. In summary, the specificity and sensitivity of subsequent targets can be detected with PlP-Nl4-s2a-Np, PlP-ORF1ab-Wl2m-a1-Np or PlP-VP23l2-a2s-Np.
[0266] Example 7: Specificity of RCA-H2O2-AgNCs / DT-GSP-t4 reaction
[0267] (1) Experimental procedure
[0268] Using PlP-EWl1m-Np (SEQ ID No.35) and PlP-EBl1m-Np (SEQ ID No.36); PlP-EWl1m-Np (SEQ ID No.35), PlP-EWl1m-Np-U (SEQ ID No.37) + PlP-EWl1m-Np-D (SEQ ID No.38) and PlP-EWl1m-Np-U2 (SEQ ID No.39) + PlP-EWl1m-Np-D2 (SEQ ID No.40); PlP-ORF1ab-Wl2m-a1-Np (SEQ ID No.48) and PlP-ORF1ab-Bl2m-a1-Np (SEQ ID No.49); PlP-ORF1ab-Wl2m-a1-Np (SEQ ID No.48), PlP-ORF1ab-Wl2m-a1-Np-U (SEQ ID No.50) + PlP-ORF1ab-Wl2m-a1-Np-D (SEQ ID No.51) and PlP-ORF1ab-Wl2m-a1-Np-U2 (SEQ ID No.52) + PlP-ORF1ab-Wl2m-a1-Np-D2 (SEQ ID No.53) as 4 groups of padlock template probes PlP, respectively paired with 2 groups of detection targets of the SARS-CoV-2 wild type (Wild) or mutant (BA.2) E or ORF1ab gene, under the condition of no primer, the RCA-H2O2-AgNCs / DNA reaction, fluorescence spectrum and gel electrophoresis were measured according to the "experimental procedure" in Example 5. Among them, in the reaction system of the upstream and downstream double PlP of PlP-U + PlP-D compared with the single PlP, the composition of LM (5 μL) was slightly adjusted to: 2.9 μL of enzyme-free water (MC119A, Promega, USA), 1 μL of 10×LTA, 0.5 μL each of 100 μM padlock template probes PlP-U and PlP-D, and 0.1 μL of 400 U / μL T4 DNA ligase (product number M0202S, New England BioLabs, USA). The final concentration of the target to be measured in the 10 μL RCA reaction system was 0.1 μM.
[0269] (2) Experimental results
[0270] Targeting single-base mutations in the E and ORF1ab genes of SARS-CoV-2 wild-type and BA.2 mutant, the specificity of the RCA-H2O2-AgNCs / DT-GSP-t4 reaction was evaluated. First, we used PlP-EWl1m-Np and PlP-EBl1m-Np; and PlP-ORF1ab-Wl2m-a1-Np and PlP-ORF1ab-Bl2m-a1-Np as two groups of padlock template probes to detect specific segments of wild-type (ElW, ORF1ablW) and mutant (ElB, ORF1ablB) genes ( Figure 10 A-B, Figure 10 E-F). We found that the fluorescence emission peak intensity enhancement values ( Figure 10 A) and gel electrophoresis grayscale images ( Figure 10 E) of the PlP-EWl1m-Np and PlP-EBl1m-Np probe groups both showed strong fluorescence enhancement signals or bands when adding the completely complementary target, indicating that both could better distinguish the single-base differences of wild-type or mutant E genes; while the gel electrophoresis grayscale images of the PlP-ORF1ab-Wl2m-a1-Np and PlP-ORF1ab-Bl2m-a1-Np probe groups showed false-positive bands, especially the latter was more obvious. However, the fluorescence emission peak intensity enhancement values showed that both PlP probes could distinguish positive and negative signals.
[0271] Second, considering that the experimental results in Example 4 showed that the RCA reaction mainly recognized single-base mismatches located at the PlP ligation site, therefore, in order to further increase the probability of mismatch recognition, we added a breakpoint in the target-binding region of the PlP probe to form two upstream and downstream PlP probes, PlP-U and PlP-D, to evaluate their specificity for the RCA-H2O2-AgNCs / DT-GSP-t4 reaction. In the detection experiment with PlP-EWl1m-Np, PlP-EWl1m-Np-U+PlP-EWl1m-Np-D (PlP-EWl1m-Np-UD) and PlP-EWl1m-Np-U2+PlP-EWl1m-Np-D2 (PlP-EWl1m-Np-UD2) as probe groups, the gel electrophoresis of the double PlP probes, like the single PlP probe, could better distinguish wild-type or BA.2 mutant E genes ( Figure 10 G), while the fluorescence emission peak intensity enhancement values showed that PlP-EWl1m-Np-UD2 had a better fluorescence signal-to-noise ratio than PlP-EWl1m-Np-UD ( Figure 10C); Similarly, the gel electrophoresis results of the PlP-ORF1ab-Wl2m-a1-Np, PlP-ORF1ab-Wl2m-a1-Np-U+PlP-ORF1ab-Wl2m-a1-Np-D (PlP-ORF1ab-Wl2m-a1-Np-UD) and PlP-ORF1ab-Wl2m-a1-Np-U2 + PlP-ORF1ab-Wl2m-a1-Np-D2 (PlP-ORF1ab-Wl2m-a1-Np-UD2) probe sets showed that the UD dual probe could not perform the RCA reaction to form a bright band, and the UD2 dual probe had obvious false positive bands ( Figure 10 H). Correspondingly, the fluorescence emission peak intensity enhancement value showed that the UD dual probe had almost no positive fluorescence signal, but instead had false positive fluorescence signals. Fortunately, the UD2 dual probe formed a fluorescence quenching signal under the action of the negative target BA.2 mutant ORFlablB DNA and generated a fluorescence enhancement signal under the action of the positive target ORF1ablW DNA ( Figure 10 D). The above results suggest that in the RCA-H2O2-AgNCs / DT-GSP-t4 reaction mediated by the dual PlP probe, after screening the PlP breakpoint positions, the PlP-UD2 probe set can achieve the optimal fluorescence performance.
[0272] In summary, the single PlP probe with 1 target ligation site or the dual PlP probe with 2 target ligation sites, after optimization, can recognize the single base mismatch at the ligation site of the target through the RCA-H2O2-AgNCs / DT-GSP-t4 reaction.
[0273] Example 8: Sensitivity of the RCA-H2O2-AgNCs / DT-GSP-t4 reaction
[0274] (1) Experimental procedure
[0275] Using PlP-Nl4-s2a-Np (SEQ ID No.20), PlP-EWl1m-Np (SEQ ID No.35), PlP-ORF1ab-Wl2m-a1-Np (SEQ ID No.48), and PlP-VP23l2-a2s-Np (SEQ ID No.59) as padlock template probes respectively, and matching with different concentrations (10 -9Four groups of detection targets, namely, the specific segment RNA sequences of the SARS-CoV-2 wild-type N, E, or ORF1ab genes (Nl (SEQ ID No. 10), El (SEQ ID No. 25), ORF1abl RNA (SEQ ID No. 44)) at 0~10 μM, and the specific segment DNA sequence of the overlapping region of the BKV VP2 and VP3 genes (VP23l DNA (SEQ ID No. 55)), without primers, were subjected to the RCA-H2O2-AgNCs / DNA reaction and fluorescence spectrum determination according to the "Experimental Procedures" in Example 5.
[0276] (2) Experimental results
[0277] Finally, we used the optimized PlP probes (PlP-Nl4-s2a-Np, PlP-EWl1m-Np, PlP-ORF1ab-Wl2m-a1-Np, and PlP-VP23l2-a2s-Np) to detect the specific segment RNAs of the N, E, and ORF1ab genes of SARS-CoV-2 and the specific segment DNA of VP23 of BKV, respectively. From the fluorescence emission peak intensity value diagrams of a wide range of concentration gradient targets, we can see that the fluorescence signals of the three RNA targets all first increased rapidly and then approached a plateau ( Figure 11 E-G), while the fluorescence signal of the DNA target showed an increasing trend ( Figure 11 H). After displaying the abscissa in logarithmic form, it was found that the enhanced value of the fluorescence emission peak intensity of El RNA ( Figure 11 J) and VP23lDNA ( Figure 11 L) showed a gradually increasing trend in the concentration range of 10 -9 ~10 μM. The enhanced values of the fluorescence emission peak intensity of Nl RNA or ORF1abl RNA only showed an increasing trend in the ranges of 10 -4 ~10 μM or 10 -2 ~10 μM, respectively. Correspondingly, the fluorescence emission spectra also showed a similar increasing pattern ( Figure 11 A-D). Then, we further performed linear fitting on the enhanced values of the fluorescence emission peak intensity within the corresponding gradient ranges to obtain the linear ranges of the four PlP probe detection targets. Among them, the linear range of PlP-EWl1m-Np for detecting El RNA was 10 -9 ~10 μM, which was the best; the linear range of PlP-Nl4-s2a-Np for detecting Nl RNA was 10 -4 ~1 μM, while the linear range of PlP-ORF1ab-Wl2m-a1-Np for detecting ORF1abl RNA was 10 -2~10 μM, and their sensitivities are relatively low; in addition, the linear range for PlP-VP23l2-a2s-Np to detect VP23l DNA is 10 -9 ~1 μM, and it also performs well.
[0278] As described above, it is only a preferred embodiment of the present invention, and it is not a limitation to the present invention in any formal or substantial form. It should be pointed out that for those of ordinary skill in the art, without departing from the premise of the present invention, several improvements and supplements can still be made, and these improvements and supplements should also be regarded as the protection scope of the present invention.
Claims
1. A fluorescent molecular beacon AgNCs / DT-GSP-t4, characterized in that: The AgNCs / DT-GSP-t4 is a silver nanocluster AgNCs / DNA synthesized based on the DNA template DT-GSP-t4, which is a hybridization region and a silver nanocluster AgNCs nucleation region from 5' to 3', and the sequence of the DNA template DT-GSP-t4 is shown in SEQ ID No.
2.
2. The fluorescent molecular beacon AgNCs / DT-GSP-t4 according to claim 1, characterized in that: The preparation method of AgNCs / DT-GSP-t4 comprises: adding AgNO3 and NaBH4 to a phosphate buffer solution containing DT-GSP-t4 in sequence for shaking reaction, and placing the obtained solution at room temperature in a dark environment for 18 hours.
3. Use of the fluorescent molecular beacon AgNCs / DT-GSP-t4 described in claim 1 in detecting DNA and RNA viruses.
4. Use of the fluorescent molecular beacon AgNCs / DT-GSP-t4 according to claim 1 in the preparation of a reagent or kit for detecting DNA and RNA viruses.
5. The use according to claim 3 or 4, characterized in that The detection is achieved by a rolling circle amplification reaction RCA, wherein the rolling circle amplification reaction uses a padlock template probe PlP that can specifically bind to the target to be detected and contains a C-rich sequence region of AgNCs / DNA fluorescence enhancement to perform a two-enzyme one-step RCA reaction under primer-free conditions to generate a single-stranded DNA containing a G-rich sequence tandem repeat element, and then H2O2 is added to eliminate the influence of residual DTT in the RCA reaction, and then AgNCs / DT-GSP-t4 is used as a signal probe to generate a specific fluorescence enhancement signal for the target to be detected under the action of the G-rich adjacent fluorescence enhancement effect; Among them, the padlock template probe must satisfy the requirement that there is no neck ring structure at the 5' end, but a neck ring structure is required at the 3' end, and the neck ring is located near the 3' end of the AgNCs / DNA enhancement region; the two-enzyme one-step RCA reaction uses T4 DNA ligase and phi29 DNA polymerase; the target to be detected is a DNA or RNA virus, and the tandem repeat element containing a G-rich sequence is (PlP complementary chain)n, n≥1.
6. The use according to claim 5, characterized in that The detection target is RNA in the specific regions of the N, E, and ORF1ab genes of the SARS-CoV-2 virus or DNA in the specific regions of the overlapping regions of the VP2 and VP3 genes of the BKV virus, and the padlock template probe used is a single padlock template probe; wherein: When the target sequence is the N1 RNA shown in SEQ ID No. 10, the corresponding single padlock template probe is P1P-N14-s2a-Np of SEQ ID No. 20; When the target sequence is the E1 RNA shown in SEQ ID No.25, the corresponding single padlock template probe is P1P-EWl1m-Np of SEQ ID No.35; When the target sequence is ORF1ab1 RNA shown in SEQ ID No.44, the corresponding single padlock template probe is PlP-ORF1ab-Wl2m-a1-Np of SEQ ID No.48; When the target sequence is VP231 shown in SEQ ID No.55, the corresponding single padlock template probe is PlP-VP2312-a2s-Np shown in SEQ ID No.
59.
7. The use according to claim 5, characterized in that The detection target is the RNA in the specific region of the E or ORF1ab gene of the SARS-CoV-2 virus, and the padlock template probe used is a double padlock template probe; wherein: When the target sequence is E1 RNA of SEQ ID No.25, the corresponding double padlock template probes are PlP-EWl1m-Np-U2 shown in SEQ ID No.39 and PlP-EWl1m-Np-D2 shown in SEQ ID No.40; When the target sequence is ORF1ab1 RNA shown in SEQ ID No.44, the corresponding double padlock template probe is PlP-ORF1ab-Wl2m-a1-Np-U2 shown in SEQ ID No.52 and PlP-ORF1ab-Wl2m-a1-Np-D2 shown in SEQ ID No.
53.
8. A detection kit, characterized in that: It includes the fluorescent molecular beacon AgNCs / DT-GSP-t4 as described in claim 1.
9. The detection kit according to claim 8, characterized in that The detection kit also includes a single padlock template probe or a double padlock template probe, the sequence of the single padlock template probe is SEQ ID No. 20, 35, 48 or 59, and the sequence of the double padlock template probe is SEQ ID No. 39-40 or SEQ ID No. 52-53.
10. A method for detecting DNA or RNA viruses for non-diagnostic and therapeutic purposes, characterized in that: The method comprises: a step of two-enzyme one-step RCA reaction and a step of labeling the RCA reaction product with the fluorescent molecular beacon AgNCs / DT-GSP-t4 according to claim 1 under H2O2 conditions.
11. The method according to claim 10, characterized in that The reaction system composition of each 10 μL in the RCA reaction is as follows: Ligation reaction master mix LM 1 μL; 1 μL of target to be tested; RCA reaction master mix RM 8 μL; Among them, 5 μL LM is composed of: 8 μL RM composition: Among them, phi29 DNA polymerase was diluted with 10× OP; 10×LTA is the ligation reaction buffer, and its composition is: 500 mM Tris-HAc; 100 mM MgAc2 and 10 mM ATP; 10×PA is the polymerase reaction buffer, and its composition is: 500 mM Tris-HAc; 100 mM MgAc2 and 100 mM NH4Ac; 10×OP is the original reaction buffer of polymerase, and its composition is: 500mM Tris-HCl 100mM MgCl2 100mM (NH4)2SO4 and 40mM DTT.
12. The method according to claim 10, characterized in that The reaction system composition of each 50 μL in the labeling reaction is as follows: RCA reaction product 10 μL; 0.1% H2O2 0.846μL; 15μM AgNCs / DT-GSP-t4 40μL.
13. The method according to claim 10, characterized in that The step of performing fluorescence detection on the product obtained by the labeling reaction is also included: placing the product obtained by the RCA-H2O2-AgNCs / DNA reaction system in a microplate for measuring fluorescence, and performing fluorescence emission spectrum measurement on a multifunctional microplate reader, taking the excitation wavelength λ ex =540nm / emission wavelength λ em =The fluorescence intensity value at 620 nm is taken as the detection signal value.