Specific probe for branched chain DNA amplification system and application thereof
By designing a specific probe system containing blocked probes, the problem of insufficient specificity in tissue in situ hybridization is solved, and significant specificity improvement and non-specific hybridization reduction is achieved, which is suitable for improving the signal-to-noise ratio of the detection results.
Patent Information
- Application Number
- CN202510375789.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-27
- Publication Date
- 2025-06-27
AI Technical Summary
The existing branched DNA amplification system has insufficient specificity during tissue in situ hybridization, resulting in excessive nonspecific hybridization, affecting the detection results.
A specific probe system including target gene probes, preamplifier probes, amplification probes, labeled probes and blocking probes is designed, where the blocking probes and the preamplifier probes bind complementarily to reduce the binding of non-target fragments to ssDNA, thereby inhibiting non-specific hybridization.
It significantly improves the specificity of branched DNA amplification system in tissue in situ hybridization, reduces non-specific hybridization, improves the signal-to-noise ratio of the detection results, and does not require complex design and operation, making it easier to promote and use on a large scale.
Smart Images
Figure CN120210334A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a specific probe for a branched DNA amplification system and its application, belonging to the technical field of pathological diagnosis. Background Art
[0002] The copy number of about 80% of the genes' mRNA in cells is less than 5 copies per cell, and about 95% of the mRNA is less than 50 copies per cell. In order to detect lower copy gene expression, postoperative minimal residual lesions, or lower copy or even single-copy viral nucleic acid expression, amplification is thus required to improve the detection sensitivity. Different from the amplification of target nucleic acids by polymerase chain reaction (PCR), represented by the branched DNA signal amplification technology (branched DNA, bDNA), amplifying the signal is another amplification method.
[0003] The branched DNA signal amplification technology is a nucleic acid hybridization signal amplification detection technology introduced by Chiron Corporation, which overcomes the defects and uncertainties in the traditional real-time fluorescence quantitative PCR technology. It does not require RNA extraction and purification, reverse transcription, or PCR amplification. After simply lysing the sample with a specific lysis solution, gene quantitative results can be quickly obtained after probe hybridization and signal amplification. The bDNA technology has the advantages of high sensitivity, large detection range, and accurate quantification, and has extremely high accuracy and reproducibility for various common samples, blood samples that are difficult to analyze by qPCR, and formalin-fixed paraffin-embedded (FFPE) samples with highly degraded mRNA after being stored for many years.
[0004] Up to now, the bDNA technology has developed to the third generation. Among them, in the first generation, the labeled auxiliary probe directly connects to the bDNA amplification molecule, and an alkaline phosphatase (AP) probe is connected to this molecule; in the second generation, a pre-amplifier probe is first connected to the labeled auxiliary probe, and many bDNA amplification molecules are connected to the pre-amplifier probe. Through two amplifications, the signal is stronger and the sensitivity is higher, with a 20-fold increase in sensitivity compared to the first generation; in the third generation, 5-methyl-2'-deoxyisocytidine (isoC) and 5-methyl-2'-deoxyguanosine (isoG), which do not bind to the four natural bases (A, G, C, T), are used to inhibit non-specific hybridization signals, increasing the signal-to-noise ratio by 8 times.
[0005] It is not difficult to see from the development process from the second generation to the third generation of the bDNA technology that it mainly solves the problem of non-specific hybridization. However, considering the usage price of isoC / G and the popularity of modified bases in gene synthesis, it does not have the characteristics of wide range promotion and use. Although there are already ready-to-use kits based on the bDNA technology on the market (such as the RNAScope product of ACD Company, the ViewRNA product of ThermoFish Company, etc.), the method for improving the specificity of the ssDNA amplification probe has not been disclosed. Therefore, a simple, easy-to-implement probe or probe design method that can significantly inhibit non-specific hybridization or significantly improve the specificity of bDNA is an urgent problem to be solved in the further development and utilization of the bDNA technology. Summary of the Invention
[0006] The first object of the present invention is to provide a specific probe for a branched DNA amplification system, providing a simple, low-cost and highly specific specific probe for a branched DNA amplification system.
[0007] The second object of the present invention is to provide an application of the specific probe in improving the specificity of the branched DNA amplification system in tissue in situ hybridization, so as to solve the problem that the specificity of the branched DNA amplification system needs to be enhanced in the process of tissue in situ hybridization in the prior art.
[0008] In order to achieve the above object, the technical solution of a specific probe for a branched DNA amplification system in the present invention is:
[0009] A specific probe for a branched DNA amplification system includes a target gene probe, a pre-amplification probe, an amplification probe, and a labeling probe; the target gene probe is composed of a basic probe and a linker sequence at the 3' end; the pre-amplification probe is composed of a linker sequence 1 at the 5' end and multiple repeat sequence units 1; the amplification probe is composed of a linker sequence 2 at the 5' end and multiple repeat sequence units 2; the labeling probe is composed of a linker sequence 3 and a visualization modification label at the 3' end; the basic probe is complementary to the mRNA sequence of the gene to be detected; the linker sequence is base complementary to the linker sequence 1; the repeat sequence unit 1 is base complementary to the linker sequence 2; the repeat sequence unit 2 is base complementary to the linker sequence 3, and the specific probe includes a blocking probe; the blocking probe is base complementary to the repeat sequence unit 1.
[0010] The beneficial effects of the above solution are as follows: A specific probe for a branched DNA amplification system of the present invention belongs to a pioneering invention. On the basis of the original target gene probe, pre-amplification probe, amplification probe, and labeling probe in the probe system of the branched DNA amplification system, the present invention adds a blocking probe for blocking the pre-amplification probe, which can complementarily bind to the pre-amplification probe. All probes used in the bDNA technology are single-stranded DNA (ssDNA). The binding of the blocking probe to the pre-amplification probe can reduce the binding of non-target fragments in the sample to ssDNA, thereby reducing non-specific hybridization and improving the specificity of bDNA.
[0011] As a further improvement, the Tm value of the blocking probe is 35 - 40 °C.
[0012] As a further improvement, the length of the linker sequence is 18 - 22 bp.
[0013] As a further improvement, the length of the repeat sequence unit 1 is 18 - 22 bp, and it is tandemly repeated 5 - 7 times.
[0014] As a further improvement, the length of the repeat sequence unit 2 is 18 - 22 bp, and it is tandemly repeated 4 - 6 times.
[0015] As a further improvement, the screening conditions for the basic probe are as follows: probe length 35 - 40 bp, GC content 40 - 60%, probe interval 5 - 10 bp, Tm value 65 - 70 °C, and the number of identical consecutive bases is less than 5.
[0016] In order to achieve the above object, the technical solution of the application of a specific probe in improving the specificity of the branched DNA amplification system in tissue in situ hybridization in the present invention is:
[0017] The application of a specific probe in improving the specificity of the branched DNA amplification system in tissue in situ hybridization.
[0018] The beneficial effects of the above solution are as follows: The pre-amplification probe, amplification probe, and labeling probe used in the bDNA method are all single-stranded DNA (ssDNA). Generally, tissue sections are used in tissue in situ hybridization. After the nucleic acids in the sections are heat-repaired and de-crosslinked, they will inevitably renature and bind to ssDNA, resulting in a large amount of non-specific hybridization and affecting the final detection result (the principle is as Figure 1 shown). However, in the present invention, the use of a blocking probe to block the pre-amplification probe can significantly inhibit non-specific hybridization and improve the specificity of bDNA (the principle is as Figure 2 shown). The specific probe provided by the present invention improves the specificity of the bDNA system in tissue in situ hybridization, and does not require complex design and operation, which is conducive to large-scale popularization and use.
[0019] As a further improvement, the in-situ hybridization of tissues is carried out on paraffin sections.
[0020] As a further improvement, the application includes the following steps:
[0021] (1) Dissolve the specific probe with probe buffer to prepare a probe working solution;
[0022] (2) Dewax, block, repair, and enzymatically digest the section to be detected;
[0023] (3) Sequentially perform target gene probe hybridization, pre-amplified probe and blocking probe hybridization, amplified probe hybridization, labeled probe hybridization, and visualization modification staining on the section that has completed enzymatic digestion in step (2).
[0024] As a further improvement, in step (3), the pre-amplified probe and blocking probe hybridization is to mix the pre-amplified probe working solution and the blocking probe working solution and then drop them on the section tissue for hybridization. Description of the Drawings
[0025] Figure 1 It is a staining pattern diagram of the branched-chain DNA amplification system of the present invention without a blocking probe;
[0026] Figure 2 It is a staining pattern diagram of the branched-chain DNA amplification system of the present invention with a blocking probe;
[0027] Figure 3 It is a diagram of the in-situ hybridization staining result after blocking the pre-amplified probe AMP1 with the blocking probe 1 in Example 2 of the present invention (wherein, the left figure is the staining after in-situ hybridization of DapB (negative control probe) mRNA, and the right figure is the in-situ hybridization staining of UBC (positive control probe) mRNA, 40× objective lens, 10× eyepiece);
[0028] Figure 4 It is a diagram of the in-situ hybridization staining result after blocking the pre-amplified probe AMP1 with the blocking probe 2 in Example 2 of the present invention (wherein, the left figure is the staining after in-situ hybridization of DapB (negative control probe) mRNA, and the right figure is the in-situ hybridization staining of UBC (positive control probe) mRNA, 40× objective lens, 10× eyepiece);
[0029] Figure 5 It is a diagram of the in-situ hybridization staining result after blocking the pre-amplified probe AMP1 with the blocking probe 3 in Example 2 of the present invention (wherein, the left figure is the staining after in-situ hybridization of DapB (negative control probe) mRNA, and the right figure is the in-situ hybridization staining of UBC (positive control probe) mRNA, 40× objective lens, 10× eyepiece);
[0030] Figure 6In - situ hybridization staining result graph for Comparative Example 1 of the present invention (wherein, the left graph is the in - situ hybridization staining of DapB (negative control probe) mRNA; the right graph is the in - situ hybridization staining of UBC (positive control probe) mRNA, 40 - fold objective lens, 10 - fold eyepiece). Detailed implementation manners
[0031] In the prior art, the cost of improving the specificity of the branched - chain DNA amplification system is relatively high, and currently, the commercial ready - made reagents based on the bDNA system on the market are monopolized by foreign companies (such as ACD Company, ThermoFish Company, etc.). Based on this, the present invention provides a specific probe for the branched - chain DNA amplification system and its application in improving the in - situ hybridization specificity of the branched - chain DNA amplification system in tissues.
[0032] Specific embodiments of a specific probe for the branched - chain DNA amplification system and its application according to the present invention:
[0033] Taking human UBC as the gene to be detected, the design, synthesis and application of the specific probe are specifically described as follows:
[0034] Example 1 Probe design, synthesis and preparation of working solution
[0035] 1. Obtain the mRNA sequences of target genes (taking UBC gene and DapB gene as examples)
[0036] Download the human UBC mRNA sequence (NM_021009) published by NCBI as the positive control probe, and the Bacillus subtilis DapB mRNA sequence (EF191515) as the negative control probe for subsequent probe design.
[0037] 2. Design of target - gene probes
[0038] According to the mRNA nucleic acid sequences of the human UBC gene and the Bacillus subtilis DapB gene, the probes are screened according to the following conditions: probe length is 35 - 40bp, GC content is 40 - 60%, probe interval is 5 - 10bp, Tm value is 65 - 70°C, and the number of identical consecutive bases is less than 5. Add a 20 - bp linker sequence acaagctgtgaccgtctccg to the 3' sequence of the target gene for binding to the pre - amplification probe AMP1. The specifically designed target - probe sequences are shown in Table 1.
[0039] Table 1 Specific nucleotide sequences of target - gene probes
[0040]
[0041]
[0042] 3. Design of amplification and labeled probes
[0043] (1) Pre-amplification probe AMP1
[0044] The 1-20 bp sequence at the 5'-end serves as the linker region with the 3'-end sequence of the target gene, and the 21-140 bp region is divided into 20-bp repeat units as the tandem binding region with the amplification probe AMP2, and is synthesized into ssDNA by a gene synthesis company. The specific sequence of the pre-amplification probe is shown in Table 2.
[0045] (2) Amplification probe AMP2
[0046] The 1-20 bp sequence at the 5'-end serves as the binding region with the repeat units of the pre-amplification probe, and the 21-120 bp region is divided into 20-bp repeat units as the tandem binding region with the labeled probe AMP3, and is synthesized into ssDNA by a gene synthesis company. The specific sequence of the amplification probe is shown in Table 2.
[0047] (3) Labeled probe AMP3
[0048] The 3'-end is labeled with a hapten digoxin molecule and serves as the binding region with the repeat units of the amplification probe, and is synthesized into ssDNA by a gene synthesis company (GenScript Nanjing). The specific sequence of the labeled probe is shown in Table 2.
[0049] Table 2 Specific nucleotide sequences of amplification and labeled probes
[0050]
[0051] 4. Design of blocking probes
[0052] According to the repeat unit sequence of the pre-amplification probe AMP1, blocking probes with different lengths are designed to block the pre-amplification probe AMP1. The specific sequences of the blocking probes are shown in Table 3.
[0053] Table 3 Specific nucleotide sequences of blocking probes
[0054] Name Sequence Length (bp) Tm Blocking sequence 1 GGATTAGCAGAGCGAGGTAT(SEQ ID NO.44) 20 60 Blocking sequence 2 TAGCAGAGCGAGGTAT(SEQ ID NO.45) 16 48 Blocking sequence 3 TAGCAGAGCGAG(SEQ ID NO.46) 12 38
[0055] 5. Preparation of probe working solution
[0056] Preparation of probe buffer: Prepare a probe buffer with a final concentration of 20% deionized formamide, 10% dextran sulfate, 5×SSC (0.75 M NaCl and 0.075 M sodium citrate), and 0.3% SDS. Adjust the pH value to 7.5 and make up to 1 L for standby.
[0057] a. Targeting probes: Mix equal volumes of each targeting probe with a final concentration of 10 μM to obtain a mixed probe with a total probe concentration of 10 μM, and configure it in the probe buffer to a final concentration of 40 nM (the total amount of probes is 40 nM, including each probe).
[0058] b. Configure the pre-amplification probe AMP1, amplification probe AMP2, and labeled probe AMP3 in the probe buffer to a final concentration of 10 nM respectively.
[0059] c. Blocking probe: Dissolve the blocking probe (powder form) in 1×TE to prepare a stock solution with a final concentration of 100 μM for later use.
[0060] Example 2 Detection of samples after the action of bDNA in situ hybridization with blocking probe
[0061] In this example, using the specific probes designed and synthesized in Example 1, breast cancer paraffin sections were used as the object for bDNA in situ hybridization detection. The specific implementation operations are as follows:
[0062] 1. Preparation and pretreatment of samples
[0063] a. Section preparation: Select breast cancer paraffin samples for sectioning, with a section thickness of 4 - 5 μm, and bake the sections in a 60°C baking oven for 60 min.
[0064] b. Deparaffinization: Immerse in xylene 3 times, 10 min each time, then immerse in absolute ethanol 2 times, 5 min each time, and air dry at room temperature for later use.
[0065] c. Blocking: Use 3% hydrogen peroxide to block endogenous peroxidase in the section tissue, and block at room temperature for 10 min.
[0066] d. Repair: Place the sections in boiling EDTA antigen repair solution for heat repair for 15 min. After the repair is completed, immediately place the sections in pure water.
[0067] e. Enzyme digestion: Drop 100 μg / mL pepsin solution onto the tissue on the sections, and place the sections in a 37°C oven for 5 - 10 min. Immediately place the sections in pure water to stop the digestion after the enzyme digestion is completed.
[0068] 2. Hybridization of target gene probes
[0069] Drop 100 - 150 μL (just evenly cover the tissue) of the target probe working solution onto the section tissue, incubate at 37°C for 120 min. After the hybridization is completed, wash 3 times with 1×PBS, 2 min each time.
[0070] 3. Hybridization of pre-amplification probe AMP1 and blocking probe
[0071] After thoroughly mixing the preventive large probe AMP1 and blocking probes of different lengths (blocking probe concentration: AMP1 concentration 100:1), add 100 - 150 μL (just evenly cover the tissue) of the reagent dropwise onto the tissue section, and hybridize at 37°C for 30 min. After hybridization, wash with 0.1×PBS 3 times, 2 min each time.
[0072] 4. Hybridization of amplification probe AMP2
[0073] Add 100 - 150 μL (just evenly cover the tissue) of the working solution of AMP2 reagent dropwise onto the tissue section, and hybridize at 37°C for 30 min. After hybridization, wash with 1×PBS 3 times, 2 min each time.
[0074] 5. Hybridization of labeled probe AMP3
[0075] Add 100 - 150 μL (just evenly cover the tissue) of the working solution of labeled probe AMP3 reagent dropwise onto the tissue section, and hybridize at 37°C for 30 min. After hybridization, wash with 1×PBS 3 times, 2 min each time.
[0076] 6. Incubation with anti - digoxin antibody
[0077] Drop HRP - conjugated anti - digoxin antibody onto the tissue section, incubate at room temperature for 30 min, and then wash with 1×PBS 3 times, 2 min each time.
[0078] 7. DAB color development
[0079] Freshly prepare DAB (substrate: Buffer = 1:20), drop it onto the tissue section, incubate at room temperature for 5 min, and then wash with pure water 3 times.
[0080] 8. Counter - staining with hematoxylin
[0081] Drop hematoxylin staining solution onto the tissue section, incubate at room temperature for 2 min, and then rinse with tap water. Finally, obtain the final staining result through dehydration and mounting.
[0082] 9. Microscopic observation of the staining result
[0083] Observe the staining result through a microscope, as Figures 3 - 5 shown.
[0084] As Figure 3 can be seen, the left figure is the staining after in - situ hybridization of DapB (negative control probe) mRNA, with basically no non - specific staining; the right figure is the in - situ hybridization staining of UBC (positive control probe) mRNA. Affected by the blocking, the positive signal was not stained out.
[0085] As Figure 4It can be seen that the left figure shows the staining after in situ hybridization of DapB (negative control probe) mRNA, with basically no non-specific staining; the right figure shows the in situ hybridization staining of UBC (positive control probe) mRNA. Affected by the blocking, a small amount of positive staining appears (partially indicated by the red arrow).
[0086] It can be seen from Figure 5 that the left figure shows the staining after in situ hybridization of DapB (negative control probe) mRNA, with basically no non-specific staining; the right figure shows the in situ hybridization staining of UBC (positive control probe) mRNA, with a large amount of positive staining (partially indicated by the red arrow), having a high signal-to-noise ratio.
[0087] Based on the above results, the in situ hybridization of UBC mRNA shows positive staining; the in situ hybridization of DapB mRNA shows negative staining. With the addition of the blocking probe, the non-specific staining significantly decreases. It is preferred that the length of the blocking probe is 12 bp. In the design of the blocking probe, the Tm value of the blocking probe should be higher than the hybridization temperature to ensure the stable binding of the blocking probe during hybridization, thereby inhibiting non-specific binding; the length of the blocking probe should not be too long, as it is not conducive to the binding of the downstream probe and will affect the final staining effect.
[0088] Detection of the bDNA in situ hybridization sample in Comparative Example 1
[0089] The only difference between this comparative example and Example 2 is that when pre-amplifying the probe AMP1 in step 3, the blocking probe is not added. The specific process is as follows:
[0090] 1. Sample preparation and pretreatment: The same as in Example 2.
[0091] 2. Hybridization of the target gene probe: The same as in Example 2.
[0092] 3. Hybridization of the pre-amplifying probe AMP1
[0093] Drop the working solution of the pre-amplifying probe AMP1 onto the tissue section, and hybridize at 37°C for 30 min. After hybridization, wash with 1×PBS 3 times, 2 min each time.
[0094] 4. Hybridization of the amplifying probe AMP2: The same as in Example 2.
[0095] 5. Hybridization of the labeling probe AMP3: The same as in Example 2.
[0096] 6. Incubation with anti-digoxin antibody: The same as in Example 2.
[0097] 7. DAB color development: The same as in Example 2.
[0098] 8. Counterstaining with hematoxylin: The same as in Example 2.
[0099] 9. Microscopic observation of the staining results
[0100] The staining results were observed under a microscope. The in situ hybridization of UBC mRNA showed positive staining; the in situ hybridization of DapB mRNA showed negative staining, but there was obvious non-specific staining (partially pointed out by the red arrow), such as Figure 6 shown.
[0101] The above are only illustrative specific embodiments of the present invention and are not intended to limit the scope of the present invention. Any equivalent changes and modifications made by those of ordinary skill in the art without departing from the concept and principles of the present invention shall fall within the scope of protection of the present invention.
Claims
1. A specific probe for a branched DNA amplification system, comprising a target gene probe, a pre-amplification probe, an amplification probe, and a labeling probe; the target gene probe is composed of a basic probe and a linker sequence at the 3' end; the pre-amplification probe is composed of a connection sequence 1 at the 5' end and a plurality of repeating sequence units 1; the amplification probe is composed of a connection sequence 2 at the 5' end and a plurality of repeating sequence units 2; the labeling probe is composed of a connection sequence 3 and a visual modification label at the 3' end; the basic probe is complementary to the mRNA sequence of the gene to be tested; the linker sequence is complementary to the connection sequence 1 base pairing; the repeating sequence unit 1 is complementary to the connection sequence 2 base pairing; the repeating sequence unit 2 is complementary to the connection sequence 3 base pairing, characterized in that: The specific probe comprises a blocking probe; the blocking probe is complementary to the base of the repeating sequence unit 1.
2. The specific probe for branched DNA amplification system according to claim 1, characterized in that: The Tm value of the blocking probe is 35-40°C.
3. The specific probe for branched DNA amplification system according to claim 1 or 2, characterized in that: The length of the linker sequence is 18 to 22 bp.
4. The specific probe for branched DNA amplification system according to claim 1 or 2, characterized in that: The length of the repeating sequence unit 1 is 18 to 22 bp and is repeated 5 to 7 times in tandem.
5. The specific probe for branched DNA amplification system according to claim 1 or 2, characterized in that: The length of the repeating sequence unit 2 is 18 to 22 bp and is repeated 4 to 6 times in tandem.
6. The specific probe for branched DNA amplification system according to claim 1 or 2, characterized in that: The screening conditions of the basic probe are as follows: probe length 35-40 bp, GC content 40-60%, probe interval 5-10 bp, Tm value 65-70°C, and less than 5 identical continuous bases.
7. Use of the specific probe according to any one of claims 1 to 6 in improving the specificity of branched DNA amplification system in tissue in situ hybridization.
8. Use of the specific probe according to claim 7 in improving the specificity of branched DNA amplification system in tissue in situ hybridization, characterized in that: The tissue in situ hybridization was performed on paraffin sections.
9. Use of the specific probe according to claim 7 or 8 in improving the specificity of branched DNA amplification system in tissue in situ hybridization, characterized in that: The application comprises the following steps: (1) using a probe buffer to dissolve the specific probe according to any one of claims 1 to 6 to prepare a probe working solution; (2) Dewaxing, blocking, repairing, and enzymatically digesting the sections to be tested; (3) The sections that have completed enzyme digestion in step (2) are subjected to target gene probe hybridization, pre-amplification probe and blocking probe hybridization, amplification probe hybridization, labeling probe hybridization, and visualization modification staining in sequence.
10. Use of the specific probe according to claim 9 in improving the specificity of branched DNA amplification system in tissue in situ hybridization, characterized in that: In step (3), the pre-amplification probe and the blocking probe are hybridized by mixing the pre-amplification probe working solution and the blocking probe working solution, and then dropping the mixture onto the sliced tissue for hybridization.