Application of miRNA in diagnosis, prediction and treatment of bile duct cancer
By studying the regulatory effect of miR-26 on the CTSB protein gene, it was found that miR-26 is low in cholangiocarcinoma, which can inhibit the biological behavior of cholangiocarcinoma cells, providing a new method for diagnosing and treating cholangiocarcinoma.
Patent Information
- Application Number
- CN202311819398.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-27
- Publication Date
- 2025-06-27
AI Technical Summary
There are challenges in the diagnosis and treatment of cholangiocarcinoma, and the prior art is difficult to effectively predict and treat the disease.
By analyzing the regulatory effect of miR-26 on CTSB protein gene expression, the expression of miR-26 and CTSB protein genes in cholangiocarcinoma tissues and normal tissues were detected, the effect of miR-26 on CTSB gene expression was detected by qRT-PCR and Western blot, and the function and mechanism of miR-26 in cholangiocarcinoma were studied through cell experiments and nude mouse transplant tumor model.
It was found that miR-26 was low in cholangiocarcinoma tissues, and could inhibit the proliferation, migration and invasion of cholangiocarcinoma cells by targeting the regulation of the expression of CTSB genes, suggesting that miR-26 may have anti-tumor effects and provide a new possibility of diagnosing and treating cholangiocarcinoma.
Smart Images

Figure CN120210360A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biopharmaceutical technology, and particularly to the application of miRNA in the diagnosis, prediction and treatment of cholangiocarcinoma. Background Art
[0002] Cholangiocarcinoma (CCA) is a tumor formed by the malignant transformation of bile duct epithelial cells and the tumorigenic malignant transformation of intrahepatic and extrahepatic bile duct endothelial cells. The symptoms of cholangiocarcinoma are mainly atypical biliary obstruction symptoms, including jaundice, liver function impairment, biliary tract infection, biliary tract bleeding, etc. The occurrence of cholangiocarcinoma is a multi-factor and multi-stage complex process, which is the result of the combined action of multiple oncogenes and tumor suppressor genes. Therefore, it is of great significance to deeply explore the occurrence and development mechanisms of cholangiocarcinoma.
[0003] Cathepsin belongs to the papain family and includes a total of 12 subtypes such as cathepsin B, C, D, W, etc. Cathepsin mainly exists in intracellular lysosomes and exerts its proteolytic function under physiological conditions. Under the stimulation of specific carcinogenic factors, cathepsin can be secreted in large amounts, abnormally transported and distributed through various mechanisms. The gene of CTSB protein is located on chromosome 8p22. The CTSB protein is a cysteine protease and functions as a housekeeper enzyme in lysosomes. Studies have shown that the gene of CTSB protein is involved in various pathological processes such as diabetic nephropathy, rheumatoid arthritis, emphysema, multiple sclerosis, myocardial fibrosis and atherosclerosis. The gene of CTSB protein is up-regulated in most tumor cells and can cooperate with other proteases (such as matrix metalloproteinases, plasmin, etc.) or directly degrade extracellular matrix components to participate in the occurrence and development of tumors.
[0004] miRNA is an endogenous small molecule RNA with a length of about 22 nucleotides, which regulates different biological processes post-transcriptionally, such as cell growth, cell division, differentiation, development, metabolism and apoptosis. The relative conservation of miRNA among different species implies its important physiological functions. More and more studies have shown that the abnormal expression of miRNA has a huge impact on the occurrence and development of tumors. They can change the protein expression balance by regulating a variety of corresponding target genes. Compared with normal tissues, the expression levels of many miRNAs are disordered in cancer tissues, and some miRNAs can play dual roles as tumor suppressor genes or oncogenes in different tissues and tumor environments. Existing studies have also shown that the abnormal expression of some miRNAs in cholangiocarcinoma will cause the regulatory network composed of target genes and important signaling pathways to be dysregulated, thus affecting the occurrence and development of tumors. Summary of the Invention
[0005] The present invention aims to analyze the regulatory effect of miR-26 on the gene expression of CTSB protein, and detect the expression of miR-26 and CTSB protein gene in cholangiocarcinoma tissues and adjacent normal tissues; use qRT-PCR and Western blot to detect the effect of miR-26 on the expression of CTSB gene; use the CCK8 method, cell scratch experiment and Tranwell experiment to detect the effects of miR-26 and CTSB gene on the proliferation, migration and invasion abilities of QBC939 cells (human cholangiocarcinoma cells); observe the role of miR-26 in the nude mouse xenograft model of cholangiocarcinoma. Finally, analyze and obtain the effects of miR-26 and CTSB protein gene on the proliferation, migration and invasion abilities of cholangiocarcinoma cells, as well as the role of miR-26 in the animal model, and clarify the function and working mechanism of miR-26 in cholangiocarcinoma.
[0006] The first object of the present invention is to provide a drug capable of predicting and treating cholangiocarcinoma, that is, a drug that can promote the expression or physiological function of miR-26.
[0007] The second object of the present invention is to provide a biomarker capable of diagnosing cholangiocarcinoma and / or predicting the risk of cholangiocarcinoma onset, that is, miR-26.
[0008] Correspondingly, the third object of the present invention is to provide a product capable of diagnosing cholangiocarcinoma and / or predicting the risk of cholangiocarcinoma onset.
[0009] The above objects are specifically achieved by the following techniques.
[0010] Use of a reagent that promotes the expression or physiological function of miR-26 in the preparation of a drug for predicting and treating cholangiocarcinoma.
[0011] It should be noted that the miR-26 nucleic acid molecule of the present invention can be natural, or artificially synthesized, or obtained by transfecting cells with a vector using a DNA fragment that can express miR-26. The pharmaceutically acceptable carriers of the present invention include, but are not limited to, viruses, liposomes, nanoparticles or polymers and any combination thereof. Related delivery carriers may include, but are not limited to, liposomes, biocompatible polymers (including natural polymers and synthetic polymers), lipoproteins, polypeptides, polysaccharides, lipopolysaccharides, artificial virus envelopes, inorganic (including metal) particles, and bacteria or viruses (such as baculoviruses, adenoviruses and retroviruses), phages, cosmids or plasmid vectors.
[0012] Optionally, the DNA fragment expressing miR-26 can be obtained in the following manner: Search for the genomic location and specific sequence information of miR-26 in the miRNA database (http: / / microrna.sanger.ac.uk / sequences / ), determine the location of the initial miR-26 miRNA according to the genomic sequence, design specific primers within the 500-800 bp interval upstream and downstream of the location of the initial miR-26 miRNA, and amplify the sequence between the primers to obtain the DNA fragment expressing miR-26.
[0013] Furthermore, the drug contains a promoter that promotes the expression or physiological function of miR-26; and / or, contains a miR-26 mimic.
[0014] The research on miRNAs has been ongoing for many years, and they play a role in cell biological processes by acting on corresponding target genes. Although miR-26 is a microRNA with a known sequence, there have been no relevant reports on the role of miR-26 in the field of cholangiocarcinoma. In this invention, we found that the expression of miR-26 in cholangiocarcinoma tissues was significantly lower than that in adjacent normal tissues, while the expression of the CTSB gene was increased in cholangiocarcinoma tissues. miR-26 can specifically bind to the CTSB gene and negatively regulate the expression of the CTSB gene. Transfection with miR-26 mimics (miR-26 analogs) can inhibit the proliferation, migration, and invasion abilities of QBC939 cells, while transfection with miR-26 inhibitor (miR-26 inhibitor) shows the opposite result. Upregulating the expression of the CTSB gene can reverse the inhibitory effect of miR-26 on the biological behavior of cholangiocarcinoma cells. In a nude mouse xenograft model of cholangiocarcinoma, overexpression of miR-26 can inhibit the growth of tumors, and downregulating the expression of miR-26 has a promoting effect. Therefore, these experimental data of this invention all indicate that miR-26 is dysregulated in cholangiocarcinoma and can inhibit the biological behavior of cholangiocarcinoma cells by targeting and regulating the expression of the CTSB gene, suggesting that miR-26 may have an anti-tumor effect in cholangiocarcinoma. By selecting a promoter that can promote the expression or physiological function of miR-26, or selecting a compound with the same physiological function as miR-26 (i.e., miR-26 mimic), the occurrence of cholangiocarcinoma can be effectively treated and the progression of the disease can be delayed.
[0015] The present invention also provides the use of a reagent for detecting the expression level of miR-26 in the preparation and / or diagnosis of cholangiocarcinoma products.
[0016] Further, the product includes a product for diagnosing cholangiocarcinoma and / or predicting the risk of developing cholangiocarcinoma by detecting the expression level of miR-26 using qRT-PCR, blotting hybridization, in situ hybridization, array hybridization, gene chip or next-generation sequencing.
[0017] Further, the product includes a detection chip, array or kit.
[0018] Further, the product contains or is loaded with primers and / or probes specific for miR-26.
[0019] It should be noted that based on the research results of the present invention, by using primers and / or probes capable of detecting the expression level of miR-26 in a test sample taken from the blood of a subject / patient, the expression level of miR-26 can be detected, and further, it can be determined whether the subject has cholangiocarcinoma, or the severity of cholangiocarcinoma, or the probability of the subject developing cholangiocarcinoma can be predicted.
[0020] In the product for diagnosing and / or predicting cholangiocarcinoma, optionally, the detection chip includes a solid support, on which oligonucleotide probes are immobilized. The oligonucleotide probes include partial or all sequences specifically corresponding to miR-26.
[0021] The preparation of the miRNA detection chip can adopt the conventional manufacturing methods of biochips known in the art. For example, if the solid support is a modified glass slide or silicon wafer and the 5' end of the probe contains an amino-modified poly dT string, the oligonucleotide probe can be formulated into a solution, and then spotted on the modified glass slide or silicon wafer using a spotter, arranged in a predetermined sequence or array, and then fixed by overnight placement to obtain the miRNA chip of the present invention.
[0022] Optionally, an "array" or "microarray" is an ordered arrangement of hybridization array elements on a matrix, and the hybridization array elements such as polynucleotide probes (such as oligonucleotides) or binding agents (such as antibodies). The matrix can be a solid matrix, such as a glass or silica glass slide, bead, fiber optic binder, or a semi-solid matrix, such as a nitrocellulose membrane. The nucleotide sequence can be DNA, RNA, or any arrangement thereof. The microarray can be prepared from gene-specific oligonucleotide probes generated from known miRNA sequences. The array can contain two different oligonucleotide probes for each miRNA, one containing the active mature sequence and the other specific for the precursor of the miRNA. The array can also contain controls, such as one or more mouse sequences that differ from human orthologs by only a few bases, which can be used as controls for hybridization stringency conditions. tRNAs from two species can also be printed on the microchip, providing an internal, relatively stable positive control for specific hybridization. One or more appropriate controls for non-specific hybridization can also be included on the microchip.
[0023] Optionally, the kit includes reagents for detecting the expression level of miR-26. The reagents include primers and / or probes specific for miR-26. Of course, it may also include primers and / or probes for diagnosing and / or predicting miRNA markers of cholangiocarcinoma that have been reported in the prior art.
[0024] Based on the nucleic acid sequence of miR-26, suitable probes for RNA blot hybridization of a given miRNA gene product can be generated, including but not limited to probes that are at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or fully complementary to miR-26. Labeled DNA and RNA are prepared by conventional methods. For example, nucleic acid probes are labeled with the following substances, such as radionuclides 3H, 32P, 33P, 14C or 35S, heavy metals, ligands that can function as members of specific binding pairs for labeling ligands such as biotin, avidin or antibodies, fluorescent molecules, chemiluminescent molecules, enzymes, etc.
[0025] By the nick translation method or the random primer method, the probe can be labeled with high specific radioactivity. The latter is a method of choice for synthesizing highly radioactive 32P-labeled probes from single-stranded DNA or from RNA templates. For example, by replacing existing nucleotides with highly radioactive nucleotides according to the nick translation method, 32P-labeled nucleic acid probes with a specific radioactivity much exceeding 108 cpm / μg can be prepared. Then, by exposing the hybridized filter membrane to photographic film, autoradiographic detection of the hybridization can be carried out. Optical density scanning of the photographic film exposed to the hybridized filter membrane provides an accurate measurement of the miRNA gene transcript level.
[0026] Placing detection primers and / or probes for multiple miRNAs, including the detection primers and / or probes for miR-26 of the present application, in the same kit for combined diagnosis and / or prediction of cholangiocarcinoma is also within the scope of protection of the present invention.
[0027] When the present invention is used in the preparation of a drug for treating cholangiocarcinoma, the drug includes an enhancer containing miR-26. The miR-26 enhancer can promote the expression of miR-26 or can promote the miR-26 to exert its physiological function. The promotion targets of the miR-26 enhancer are not limited to miR-26 itself, but also include the upstream and downstream of miR-26, such as the genomic sequence encoding miR-26, the target gene of miR-26, other proteins or genes that regulate the expression or physiological function of miR-26, etc.
[0028] Furthermore, the enhancers provided by the present invention for promoting the expression or physiological function of miR-26 include proteins, oligonucleotides, and small molecule compounds.
[0029] Preferably, the above inhibitor is an antisense oligonucleotide or antagonist of miR-26.
[0030] Furthermore, the drug for preventing and treating cholangiocarcinoma provided by the present invention further comprises a pharmaceutically acceptable carrier. The carrier includes but is not limited to: diluents, buffers, suspensions, emulsions, granules, encapsulants, excipients, fillers, binders, sprays, transdermal absorbents, wetting agents, disintegrants, absorption promoters, surfactants, colorants, flavoring agents or adsorption carriers.
[0031] The drug can be made into forms including but not limited to microinjections, forms suitable for transfection, injection solutions, tablets, powders, granules, capsules. The drugs in the above various forms can all be prepared according to the conventional methods in the pharmaceutical field. For solid drugs, conventional non-toxic solid pharmaceutically acceptable carriers such as pharmaceutical-grade mannitol, lactose, starch, magnesium stearate, saccharin sodium, talcum powder, cellulose, glucose, sucrose, magnesium carbonate, etc. can be used.
[0032] For example, solid drugs for oral administration may contain any of the above carriers and excipients, as well as promoters of miR-26. The pharmaceutical composition for inhalation aerosol administration may contain promoters of miR-26 encapsulated in the above liposomes and propellants. When necessary, carriers such as lecithin for intranasal delivery may also be included.
[0033] It should also be noted that miR-26 of the present invention can also be a functional equivalent of a constitutive nucleic acid molecule, that is, a variant. The so-called "variant" refers to a miRNA that has less than 100% identity with the corresponding wild-type miRNA gene product and has one or more biological activities of the corresponding wild-type miRNA gene product. Examples of such biological activities include but are not limited to, promotion of cell processes related to the occurrence and development of cholangiocarcinoma (such as cell differentiation, cell growth, cell death). These variants include species variants and variants generated due to one or more mutations (such as substitutions, deletions, insertions) of the miRNA gene.
[0034] In certain embodiments, the variant has at least about 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity with the corresponding wild-type miRNA gene product. It shows the same function as the complete miR-211 nucleic acid molecule. They may be mutated by deletion, substitution or insertion of nucleotide residues.
[0035] It is well-known to those skilled in the art that in order to ensure the stability of miR-26 of the present invention, protective bases (such as TT) can be added to one or both ends of the miRNA, or the miRNA bases can be modified, but without affecting the function of the miRNA. Therefore, it is well-known to those skilled in the art that under the condition of not affecting the physiological function of miR-26, the sequences obtained by base modification of miR-26 or adding bases at both ends are also included in the protection scope of the present invention.
[0036] Compared with the prior art, the beneficial effects of the present invention are as follows: The present invention provides a reagent for promoting the expression or physiological function of miR-26, or a mimic compound having the same physiological function as miR-26, and an application method for preparing a drug that can be used to treat cholangiocarcinoma. This drug is used to promote the expression or physiological function of miR-26, or to exert the same physiological function as miR-26, and ultimately enables the overexpression of miR-26 / miR-26 mimics, providing a possibility for the treatment of cholangiocarcinoma and guiding the research, development and screening of related drugs.
[0037] The present invention also provides a product for diagnosing and predicting that a subject has cholangiocarcinoma. By using this product, the expression level of miR-26 can be detected to predict the risk of suffering from cholangiocarcinoma and diagnose the severity of cholangiocarcinoma; it provides a possibility for diagnosing cholangiocarcinoma. BRIEF DESCRIPTION OF THE DRAWINGS
[0038] Figure 1-2 Effects of miR-26 mimics on the proliferation, migration and invasion of QBC939 cells. Among them, Figure 1 -A shows the expression of miR-26 in cholangiocarcinoma tissues and adjacent normal tissues detected by qRT-PCR; Figure 1 -B shows the expression of miR-26 in transfected QBC939 cells detected by qRT-PCR; Figure 1 -C represents the detection of the proliferation ability of cells by the CCK8 method. Figure 2 Shows the cell scratch assay and Tranwell for detecting the migration and invasion abilities of cells, Scale bar = 25μm; **P<0.01;
[0039] Figure 3-4 Effects of miR-26 inhibitor on the proliferation, migration and invasion of QBC939 cells. Among them, Figure 3 -A shows the expression of miR-26 in transfected QBC939 cells detected by qRT-PCR; Figure 3 -B represents the detection of the proliferation ability of cells by the CCK8 method. Figure 4Indicated the migration and invasion abilities of cells detected by the scratch assay and Transwell assay, Scale bar = 25μm; **P<0.01;
[0040] Figure 5-6 It was about the expression of CTSB gene in cholangiocarcinoma tissues and its effect on QBC939 cells. Among them, Figure 5 It was for detecting the mRNA expression of CTSB gene by qRT-PCR; Figure 6 It was for detecting the protein expression of CTSB gene by Western blot; **P<0.01;
[0041] Figure 7-10 It was about the expression of CTSB gene in cholangiocarcinoma tissues and its effect on QBC939 cells. Among them, Figure 7 It was for detecting the expression of CTSB gene in cholangiocarcinoma tissues and adjacent normal tissues by immunofluorescence, Scale bar = 50μm; Figure 8 、 9 It was for detecting the protein expression of CTSB gene by Western blot and the mRNA expression of CTSB gene by qRT-PCR; Figure 10 Indicated the proliferation ability of cells detected by the CCK8 method; **P<0.01;
[0042] Figure 11-13 It was about the regulation of miR-26 and CTSB gene on QBC939 cells. Among them, Figure 11 It was for detecting the protein expression of CTSB gene by Western blot; Figure 12 Indicated the proliferation ability of cells detected by the CCK8 method; Figure 13 Indicated the migration and invasion abilities of cells detected by the scratch assay and Transwell assay, Scale bar = 25μm; **P<0.01;
[0043] Figure 14-16 It was about the role of miR-26 in the nude mouse xenograft tumor model of cholangiocarcinoma. Among them, Figure 14 It was for detecting the expression of CTSB gene and Ki67 in the tumor tissues of nude mice by immunofluorescence, Scale bar = 50μm. Figure 15 and 16 Detected the volume and weight changes of the tumor tissues of nude mice; **P<0.01. Specific implementation manners
[0044] The technical solution of the present invention will be described clearly and completely hereinafter. Apparently, the described embodiments are only a part of the embodiments of the present invention, rather than all of them. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.
[0045] In the present invention, the term "treatment" refers to improving symptoms associated with cholangiocarcinoma, including inhibitory effects, inhibiting disease progression to a certain extent, which includes slowing down and completely inhibiting; reducing the number of disease attacks and / or symptoms; alleviating one or more symptoms associated with the disease to a certain extent; increasing the length of disease-free manifestation after treatment; reducing the mortality rate at a given time point after treatment; and / or having no side effects after treatment.
[0046] The terms "subject", "patient" or "individual" are defined herein to include animals such as mammals, including but not limited to: primates, cattle, sheep, goats, horses, dogs, cats, rabbits, guinea pigs, rats, mice or other bovine, ovine, equine, canine, feline, rodent or murine species.
[0047] Preferably, the animal is a human.
[0048] In the following specific embodiments, miR-26 is synthesized by the stem-loop method, and the required hsa-mir-26a-1 LOOP sequence for synthesis is:
[0049] gtcgtatccagtgcagggtccgaggtattcgcactggatacgaccgtgcaag, as shown in SEQ ID NO.1;
[0050] The required amplification forward and reverse primers are:
[0051] hsa-mir-26a-1F primer: 3’-tgcgccctattcttggttactt-5’; as shown in SEQ ID NO.2;
[0052] hsa-mir-26a-1R primer: 3’-ccagtgcagggtccgaggtatt-5’; as shown in SEQ ID NO.3; Experimental Example 1: Collection of research samples, cell culture and transfection
[0053] 1. Collection of research samples
[0054] A total of 74 tumor specimens and adjacent normal tissue specimens from patients undergoing cholangiocarcinoma surgery were collected as the research subjects. None of the patients received chemotherapy before surgery. After all fresh specimens were removed from the body, they were immediately frozen in liquid nitrogen and confirmed by postoperative pathology. All the above specimens were approved by the Ethics Committee of our hospital and signed by the family members, and the operations complied with the ethical norms of clinical experiments.
[0055] 2. Cell culture and transfection
[0056] The QBC939 cell line (human cholangiocarcinoma cells) was placed in a cell incubator at 37°C with 95% air and 5% CO2, and cultured in DMEM medium containing 10% fetal bovine serum, 100 U / ml penicillin and 100 μg / ml streptomycin.
[0057] Twenty-four hours before transfection, cells in good growth condition were seeded in 6-well plates at a density of 5×10 5 cells / well. When the cell growth confluence reached 70%, the cells were transfected according to the instructions of the transfection reagent Lipofectamine TM 2000 to obtain the transfected QBC939 cell line for standby.
[0058] Experimental Example 2: Detection and functional verification of miRNA
[0059] 1. Test method
[0060] (1) qRT-PCR detection
[0061] Total RNA was extracted from the QBC939 cell line or tissues (patient tumor specimens and adjacent normal tissue specimens) using Trizol; the RNA content was determined by ultraviolet spectrophotometry, and its integrity was detected by agarose gel electrophoresis.
[0062] The extracted total RNA was synthesized into cDNA using a reverse transcription kit, and the PCR reaction was carried out according to the instructions of the qRT-PCR kit (Novizan). The expression level of miR-26 was normalized to U6, and the mRNA expression level of the CTSB protein gene was normalized to GAPDH. The qRT-PCR results were obtained in the form of 2 -△△CT -ΔΔCt values.
[0063] (2) CCK8 assay
[0064] QBC939 cells (human cholangiocarcinoma cells) were seeded in 96-well plates at a density of 1×10 4 cells / well, with 200 μL of cell suspension in each well. After routine culture for 24 h, 10 μL of CCK-8 solution was added to each well according to the operation instructions of the CCK-8 kit (Novizan). After incubation at 37°C for 1-2 h, the absorbance at 450 nm was measured using an enzyme-linked immunosorbent assay reader.
[0065] (3) Cell scratch assay
[0066] Inoculate QBC939 cells onto a 6-well plate. When the cell confluence reaches 80 - 90%, use a 200 μl pipette tip to draw a straight line at the center to create a scratch between the monolayer cells. Rinse off the detached cells with PBS until there are no detached cells in the air. Place the cell culture plate under a microscope for observation and photography.
[0067] (4) Transwell assay
[0068] Place Matrigel gel at 4 °C overnight; the next day, dilute the liquefied Matrigel, take 50 μl of the Matrigel dilution to the upper chamber to coat the filter membrane; place it in an incubator for 4 h to allow the coating solution to dry. Adjust the cell density of QBC939 cells to 1×10 6 cells / ml. Add 100 μl of the cell suspension to the upper chamber; add 600 μl of the medium containing 10% fetal bovine serum to the lower chamber; culture in an incubator at 37 °C and 5% CO2 for 24 h. After taking out the chamber, rinse it 3 times with PBS; fix the chamber in 95% ethanol for 5 min; stain it in 0.5% crystal violet staining solution for 10 min, and then rinse it with PBS to remove the staining solution of unbound cells. Gently wipe off the cells on the upper layer of the filter membrane of the chamber with a cotton swab, and observe the cells on the lower layer of the filter membrane under a microscope.
[0069] (6) Western Blot assay
[0070] Extract cell or tissue proteins using RIPA lysis buffer, determine the protein concentration according to the BCA method, and denature the proteins after adding the buffer. Add 50 μg of protein to each lane, separate the proteins by 12% SDS-PAGE electrophoresis, and then transfer the proteins to a PVDF membrane. Block with 5% non-fat milk powder at 37 °C for 1 h. Add primary antibodies, anti-CTSB gene antibody (1:500) and GAPDH antibody (1:1000), with GAPDH as the internal reference. Incubate overnight at 4 °C. After rinsing 3 times with TBST, add horseradish peroxidase-labeled rabbit secondary antibody (1:1000) and incubate at room temperature for 1 h. Visualize the protein bands using ECL solution in a darkroom, collect the images and analyze.
[0071] (7) Immunofluorescence assay
[0072] Deparaffinize and hydrate the tissue (tumor, adjacent normal tissue) sections, repair the antigens by microwave heating method and then cool them naturally to room temperature. Block with 5% normal goat serum and incubate at 37 °C for 1 h. Discard the serum, add anti-CTSB gene antibody (1:500) and Ki67 antibody (1:1000), and incubate overnight at 4 °C. Add fluorescein-labeled secondary antibody and incubate at 37 °C in the dark for 1 h. Mount the sections with anti-quenching mounting medium and store them in the dark at 4 °C. Observe and photograph under a fluorescence microscope.
[0073] (8) Establish a nude mouse xenograft model of cholangiocarcinoma
[0074] Twenty-four BALB / c nude mice, 5-6 weeks old and weighing 15-18 g, were housed at a constant temperature of 22 °C under a 12 h light / dark cycle and had free access to water and food. All nude mice were randomly divided into an NC group (n = 6), a miR-26 mimics group (n = 6), an NC-inhibitor group (n = 6), and a miR-26 inhibitor group (n = 6).
[0075] The transfected QBC939 cells were prepared into a single-cell suspension with a concentration of approximately 1×10 7 cells / ml and inoculated subcutaneously at the axilla of the left forelimb of nude mice at 0.2 ml / mouse.
[0076] After inoculation, the maximum diameter a and minimum diameter b of the xenograft tumors of each nude mouse were measured with a vernier caliper every 3 days, and the tumor volume was calculated. The calculation formula was V = 1 / 2 × a × b 2 ; Three weeks later, all nude mice were sacrificed by cervical dislocation, the tumor masses were dissected, weighed, photographed, and fixed with formaldehyde.
[0077] All of the above experimental procedures were statistically analyzed using SPSS Statistics 22.0 statistical software. The data were expressed as mean ± SD. The comparison between two groups of data was performed using a t-test, and the comparison of three groups or more was performed using one-way ANOVA. P < 0.05 was considered statistically significant.
[0078] 2. Test results and analysis
[0079] (1) Effects of miR-26 on the proliferation, migration, and invasion of QBC939 cells
[0080] As Figure 1 shown in -A, qRT-PCR was used to detect the expression of miR-26 in cholangiocarcinoma tissues. The expression of miR-26 in cholangiocarcinoma tissues was significantly lower than that in adjacent normal tissues, suggesting that the change in miR-26 expression was related to cholangiocarcinoma. As Figure 1 shown in -B, after miR-26 mimics were transfected into QBC939 cells, the detection results showed that the expression of miR-26 in the cells was significantly higher than that in the control group, indicating successful transfection. As Figure 1 shown in -C, the CCK8 method was used to detect the proliferation of transfected QBC939 cells. The results showed that the proliferation ability of cells transfected with miR-26 mimics was significantly lower than that of the control group. As Figure 2 shown, the results of cell scratch experiments and Transwell assays showed that the migration and invasion abilities of cells transfected with miR-26 mimics were significantly lower than those of the control group.
[0081] Transfect miR-26 inhibitor into QBC939 cells and perform the above cell experiments. The results are as Figure 3 、 4 shown. After the expression of miR-26 was inhibited, the proliferation, migration and invasion abilities of the cells were significantly increased compared with the control group. The above Figure 1-4 results all suggest that miR-26 may have the function of inhibiting cholangiocarcinoma.
[0082] (2) miR-26 targets and regulates the expression of CTSB gene
[0083] As Figure 5 shown, in QBC939 cells transfected with pMIR-CTSB gene-wt plasmid, miR-26 mimics can significantly reduce the luciferase activity, while miR-26 inhibitor can enhance the luciferase activity. However, in cells transfected with pMIR-CTSB gene-Mut plasmid, the change in miR-26 expression has no obvious effect on the luciferase activity.
[0084] As Figure 5 、 6 shown, the results of qRT-PCR and Western blot detection show that after transfection of miR-26 mimics in QBC939 cells, the mRNA and protein expressions of CTSB gene are significantly lower than those in the control group. On the contrary, the mRNA and protein expressions of CTSB gene in cells transfected with miR-26 inhibitor are significantly higher than those in the control group. This indicates that CTSB gene is a target gene of miR-26 and is negatively regulated by it.
[0085] (3) Expression of CTSB gene in cholangiocarcinoma tissues and its effect on QBC939 cells
[0086] Immunofluorescence was used to detect the expression of CTSB gene in cholangiocarcinoma tissues. As Figure 7 shown, the expression of CTSB gene in cholangiocarcinoma tissues is significantly higher than that in adjacent normal tissues. As Figure 8 、 9 shown, the results of qRT-PCR and Western blot detection show that after transfection of CTSB gene siRNA in QBC939 cells, the mRNA and protein expressions of CTSB gene are significantly lower than those in the control group.
[0087] The CCK8 method was used to detect the proliferation of cells. As Figure 10 shown, the proliferation ability of cells with low expression of CTSB gene is significantly lower than that of the control group. These results suggest that the increased expression of CTSB gene is related to cholangiocarcinoma, and down-regulating its expression has an anti-cancer effect.
[0088] (4) Regulation of miR-26 and CTSB genes on QBC939 cells
[0089] As Figure 11 shown by the Western blot detection results, the expression of CTSB gene in cells transfected with miR-26 mimics was significantly decreased, while the expression of CTSB gene in cells co-transfected with miR-26 mimics and CTSB gene was significantly higher than that in cells with high expression of miR-26 alone.
[0090] The CCK8 method, cell scratch assay and Transwell were used to detect the effects of miR-26 and CTSB genes on QBC939 cells. As Figure 12 and 13 shown, the proliferation, migration and invasion abilities of cells co-transfected with miR-26 mimics and CTSB gene were significantly higher than those of cells with high expression of miR-26 alone. Up-regulating the expression of CTSB gene could reverse the inhibitory effect of miR-26 on cell biological behavior. This suggests that miR-26 regulates the biological behavior of QBC939 cells by inhibiting the expression of CTSB gene.
[0091] (5) Role of miR-26 in nude mouse xenograft model of cholangiocarcinoma
[0092] QBC939 cells transfected with miR-26 mimics or inhibitor were inoculated subcutaneously into nude mice to construct a nude mouse xenograft model of cholangiocarcinoma. After 21 days, immunofluorescence was used to detect the expression of CTSB gene and Ki67 in the tumor tissues of nude mice. As Figure 14 shown, the expressions of CTSB gene and Ki67 in the miR-26 mimics group were lower than those in the control group, while the expressions of CTSB gene and Ki67 in the miR-26 inhibitor group were significantly increased. And, as Figure 15 shown, the tumor volume and weight of nude mice in the miR-26 mimics group were significantly lower than those in the control group; as Figure 16 shown, inhibiting the expression of miR-26 promoted the growth of nude mouse tumors. The above experimental results indicate that miR-26 can target and regulate the CTSB gene in nude mice and inhibit tumor growth.
[0093] As a single-stranded non-coding RNA molecule with regulatory functions, miRNA participates in various physiological activities such as cell proliferation, differentiation, development and apoptosis, and plays an important role in the occurrence and development of many diseases. miRNA also plays an important role in the tumor microenvironment. The dysregulation of its expression causes the dysregulation of the regulatory network composed of its regulated target genes and related important signaling pathways, thus affecting the occurrence and development of tumors.
[0094] Although the relationships between various miRNAs and cholangiocarcinoma have been reported in the current literature, the role of miR-26 in this disease has rarely been reported. Through a large number of experimental results, the present invention confirmed that the expression of miR-26 in cholangiocarcinoma tissues was significantly lower than that in adjacent normal tissues, suggesting that the abnormal expression of miR-26 may be related to cholangiocarcinoma.
[0095] To further observe the effect of miR-26 on the biological behavior of cholangiocarcinoma cells, we transfected miR-26 mimics or inhibitor into QBC939 cells and found through cell experiments that upregulating the expression of miR-26 could inhibit cell proliferation, migration and invasion, while inhibiting the expression of miR-26 had the opposite results. These results suggest that miR-26 may have an inhibitory effect on cholangiocarcinoma.
[0096] All in all, through the above experiments of the present invention, it was found that:
[0097] High expression of miR-26 in QBC939 cells could inhibit the mRNA and protein expression of CTSB gene, while low expression of miR-26 could upregulate the expression of CTSB gene.
[0098] The experimental findings of this study showed that the expression of CTSB gene in cholangiocarcinoma tissues was significantly higher than that in adjacent normal tissues. Then, after transfecting CTSB gene siRNA (CTSB gene silencing gene) into QBC939 cells, the proliferation ability of the cells was significantly reduced, suggesting that inhibiting the expression of CTSB gene may have an anti-cancer effect.
[0099] The present invention further analyzed the effect of the interaction between miR-26 and CTSB gene on cholangiocarcinoma cells through cell experiments and found that after miR-26 downregulated the expression of CTSB gene, the proliferation, migration and invasion abilities of QBC939 cells were inhibited, and overexpressing CTSB gene could reverse the regulatory effect of miR-26, indicating that miR-26 participates in regulating the biological behavior of cholangiocarcinoma cells by inhibiting the expression of CTSB gene.
[0100] In the cholangiocarcinoma nude mouse xenograft model of the present invention, miR-26 also demonstrated an anti-tumor effect. The experimental results showed that high expression of miR-26 could inhibit the expression of CTSB gene and the growth of tumor xenografts in nude mice, while low expression of miR-26 had a promoting effect.
[0101] In summary, the expression of miR-26 is abnormally decreased in cholangiocarcinoma, and upregulating the expression of miR-26 can inhibit the proliferation, migration and invasion abilities of cholangiocarcinoma cells and the growth of tumor xenografts in animal models. Among them, CTSB gene is the key target gene for miR-26 to play a regulatory role, indicating that miR-26 may have an inhibitory effect on cholangiocarcinoma.
[0102] The above specific embodiments have described the implementation of the present invention in detail. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and the technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple variations all fall within the protection scope of the present invention.
Claims
1. Use of a reagent in the preparation of a drug for predicting and treating cholangiocarcinoma, characterized in that, The reagent is a reagent that promotes the expression of miR-26 or exerts its physiological function; and / or a mimetic compound having the same physiological function as miR-26.
2. The application according to claim 1, wherein The drug contains a promoter that promotes the expression of the miR-26 or exerts its physiological function; and / or contains a mimetic compound having the same physiological function as miR-26.
3. Use of a reagent for detecting miRNA expression level in the preparation of a product for diagnosing and / or predicting cholangiocarcinoma, characterized in that, The miRNA is miR-26.
4. The application according to claim 3, characterized in that, The product includes a product for diagnosing cholangiocarcinoma and / or predicting the risk of cholangiocarcinoma onset by detecting the expression level of the miR-26 by using qRT-PCR, blot hybridization, in situ hybridization, array hybridization, gene chip or next-generation sequencing.
5. The application according to claim 4, wherein The product includes a chip, an array or a kit.
6. The application according to claim 5, wherein The product contains or is loaded with primers and / or probes specific for the miR-26.
Citation Information
Cited By
Application of miR-26a-5p in preparation of product for preventing, repairing or treating cell aging
CN120866318A