A structural variation molecular marker associated with average feed intake per chicken and its application
By identifying the missing mutant nucleotide sequence in the intron region of the LRIG1 gene in chromosome 12 of chickens, the problem of insufficient research on average feed intake in broilers was solved, and the accuracy and economic benefits of broiler breeding were improved.
Patent Information
- Application Number
- CN202510644775.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-20
- Publication Date
- 2025-08-22
- Estimated Expiration
- 2045-05-20
AI Technical Summary
The existing technology lacks research on structural variant molecular markers for the average feed intake of chickens, resulting in a lack of precise guidance on the genetic breeding of broiler chickens, affecting production efficiency and economic benefits.
The deletion mutant nucleotide sequence located in the intron region of the LRIG1 gene in chromosome 12 of chicken was identified as a structural variant molecular marker. Low-cost and efficient typing were achieved through PCR or high-throughput sequencing, and individuals with excellent FIV traits were screened.
Successfully distinguish broiler varieties with different feed intakes in the same period, improve production efficiency and feed utilization, improve the economic benefits of the broiler industry, and promote the upgrading of livestock and poultry breeding to SV molecular marking.
Smart Images

Figure CN120210389B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of livestock and poultry genetic markers and animal genetic breeding, and particularly relates to a structural variation molecular marker related to the average feed intake of chickens and an application thereof. Background Art
[0002] Feeding behavior generally has moderate heritability, with specific levels varying by breed and rearing conditions. Selection for feeding behavior has the potential to improve poultry production management and increase livestock efficiency. For example, high-density stocking systems are more suitable for flocks that feed more frequently but less frequently to reduce competition for food. However, in tropical regions, where heat stress from feeding significantly impacts production performance, flocks that consume less feed per feeding may be better adapted.
[0003] Due to technical limitations, there has been limited research on chicken feeding behavior, and a lack of research on molecular markers of chicken feeding behavior, especially on structural variation sites. Currently, structural variation (SV) molecular markers are mostly used to identify chicken intestinal barrier function and detect chicken feather color and weight. However, there has been insufficient exploration of genetic markers related to chicken feeding behavior traits, especially specific feeding behavior traits such as feed intake per visit (FIV, g / visit). This has led to a lack of precise guidance for breeding chicken breeds with excellent feeding behavior traits, and has also been unable to provide more theoretical support and effective genetic markers for broiler genetic breeding. This has limited the precise implementation of broiler genetic breeding, making it difficult to meet the demand for improving the production efficiency of high-quality broiler breeds, and affecting the production efficiency and economic benefits of the broiler industry.
[0004] The present invention aims to solve this problem, accurately identify structural variation molecular markers related to FIV traits, and provide strong support for broiler genetic breeding. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide a structural variation molecular marker related to the average feed intake of chickens and an application thereof.
[0006] To solve the above technical problems, the present invention provides a structural variation molecular marker related to the average feed intake of chickens, wherein the structural variation molecular marker is a deletion mutation, which refers to the deletion of the nucleotide sequence shown in SEQ ID NO: 1 in the chicken genome.
[0007] The present invention provides a structural variation molecular marker related to the average feed intake per chicken. The average feed intake per chicken in which the nucleotide sequence of the structural variation molecular marker is missing in the genome is lower than the average feed intake per chicken in which the nucleotide sequence of the structural variation molecular marker is contained.
[0008] The structural variation molecular marker is located in the intron region of the LRIG1 gene (ENSGALG00000007483) on chicken chromosome 12.
[0009] The structural variation molecular marker is located at 14,881,990-14,882,295 bp of chicken chromosome 12.
[0010] The present invention provides a structural variation molecular marker related to the average feed intake per chicken. The structural variation molecular marker region is predicted to be an enhancer element in multiple tissues of chickens, such as the brain, viscera and intestines. The enhancer element may be related to the expression of the LRIG1 gene. The LRIG1 gene is expressed in many tissues, among which the expression level of the LRIG1 gene in the testicles, pituitary gland, brain, hypothalamus and skin of chickens is higher than that in other tissues.
[0011] The present invention provides an application of a structural variation molecular marker associated with average feed intake per chicken, the application comprising any one of the following applications:
[0012] 1) Assisted breeding of broiler breeds;
[0013] 2) Differentiate broiler breeds with different average feed intake.
[0014] Compared with the prior art, the present invention has the following beneficial effects:
[0015] The present invention successfully identified structural variation (SV) molecular markers and candidate genes related to the trait of average feed intake per time (FIV, grams per time) in chicken feeding behavior, providing key genetic information for broiler genetic breeding. SV molecular markers can achieve low-cost and efficient typing through PCR or high-throughput sequencing, which will help to breed broiler breeds with different average feed intake per time for different markets and breeding environments. Through the screening and utilization of this molecular marker, it is expected that individuals with excellent FIV traits can be accurately selected during the broiler breeding process, thereby improving production efficiency and feed utilization, and thus enhancing the economic benefits of the broiler industry. At the same time, this molecular marker provides a paradigm for analyzing the "structural variation-phenotype" mechanism of complex animal traits, and promotes the leap from SNP to SV molecular markers in livestock and poultry breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 These are the SVs-GWAS Manhattan plot and QQ plot of the chicken FIV trait of the present invention; A is the SVs-GWAS Manhattan plot of the chicken FIV trait, and B is the QQ plot of the SVs-GWAS analysis of the chicken FIV trait.
[0017] Figure 2Figure 1 is a boxplot of the genotyping of the potential significant sites of the SV molecular marker for the chicken FIV trait of the present invention and a predicted map of the regulatory elements of the gene LRIG1 where the SV molecular marker is located; A is a boxplot of the genotyping of the potential significant sites of the SV molecular marker for the chicken FIV trait, and B is a predicted map of the regulatory elements of the LRIG1 gene and a schematic diagram of the corresponding colors of each regulatory element type.
[0018] Figure 3 This is the expression distribution diagram of the LRIG1 gene of the present invention in different chicken tissues. DETAILED DESCRIPTION
[0019] The following is a technical solution of a structural variation molecular marker related to average feed intake per chicken and its application in the present invention, further illustrated by specific examples.
[0020] Example 1
[0021] 1. Experimental population and feeding management
[0022] A total of 205 healthy yellow-feathered broiler chickens from the same batch were housed on the floor in a semi-open shed, with fresh sawdust bedding in the pens. They were fed a corn-soybean meal diet and were not given antibiotics. The birds were fitted with radio frequency identification (RFID) chip anklets, and the feeders were equipped with RFID chip antennas, which automatically recorded individual information, entry and exit times, and feed trough weight changes. The trial lasted from 56 to 76 days of age.
[0023] 2. Sample Collection
[0024] At 76 days of age, approximately 1 mL of whole blood was collected aseptically from the sub-wing vein of chickens in a centrifuge tube containing ACD anticoagulant, mixed, and stored at -20°C for subsequent genomic DNA extraction. Fecal samples were also collected, and intestinal contents from the duodenum, jejunum, ileum, and cecum were dissected and rapidly frozen in liquid nitrogen before being stored at -80°C.
[0025] 3. DNA Extraction and Sequencing
[0026] Host genomic DNA was extracted using the TIANGEN Blood Genomic DNA Extraction Kit (DP318). After a series of processing steps, DNA concentration and quality were assessed using NanoDrop. For library construction, DNA samples were ultrasonically fragmented and end-repaired, and paired-end 150-bp sequencing was performed using the Illumina HiSeq 2500 System at a sequencing depth of at least 10×.
[0027] 4. Genetic variation detection
[0028] The resulting sequencing data were aligned to the sixth-generation chicken reference genome (Galgal6) to generate a bam file. Structural variation was detected using Manta v.1.6.0 and DELLY v.0.8.7. Readpair and split read analysis methods were used to detect structural variations, including deletions, inversions, duplications, and translocations. SV marker loci detected by both Manta and DELLY were merged using the SURVIVOR tool. SV markers with consistent variant type and direction and length greater than 50 bp were retained. The merged SV marker data were quality-controlled using the parameters -maf 0.01, -geno 0.05, and -min 0.05 to ensure high confidence in the detected SV marker data. SV annotation was performed using SnpEff software.
[0029] 5. Genome-wide association analysis of FIV traits
[0030] Genome-wide association analysis was performed using a univariate linear mixed model (ULMM) in GEMMA v.0.98.5 software. The feeding behavior trait, mean feed intake per feed (FIV, g / feast), was used as the model. The model was y = Wα + xβ + u + ∈, where y represents the individual broiler FIV phenotypic vector, W represents the covariate matrix, x represents the genotype, β represents the gene effect size, u represents the random effect, and ∈ represents the error. Because the association matrix constructed based on SV markers is less similar to that constructed based on SNPs and INDELs, a kinship matrix was constructed based on SNPs. The first four principal components (PCs) based on the SNP data were selected as covariates and included in this model. A Bonferroni-adjusted genome-wide significance threshold of -log10(0.05 / 13,303) = 5.425 was used, and a potential significance threshold of -log10(1 / 13,303) = 4.184 was used. After identifying significant or potentially significant variant sites associated with the FIV trait through GWAS analysis, SnpEff was used to annotate and mine candidate genes in combination with the chicken reference genome file. The regulatory elements involved in the variant sites and the expression levels of candidate genes were analyzed in combination with the UCSC genome browser and ChickenGTEx website data.
[0031] 6. Test results
[0032] (1) Detection of significant sites and candidate genes of SV molecular markers related to chicken FIV traits
[0033] The SVs-GWAS Manhattan plot and QQ plot of chicken FIV trait are shown in Figure 2. Figure 1As shown in (A and B), FIV-GWAS analysis based on SVs molecular markers detected a potential significant locus at position 14,881,990 on chicken chromosome 12, with a 305 bp deletion (located at 14,881,990-14,882,295, reverse strand). The nucleotide sequence (labeled as the SV molecular marker associated with FIV) is as follows:
[0034] SEQ ID NO: 1:
[0035] TGAAGAGAGTCATATAAGGCAGTCCTCCAAACAGACTGCCAGAAAACACATGGCTCTGCATTGCCTATCTGGATGGGGTCATGGGCACAGCACAGCCTCTTTGAAGGGGGCTCAATCAGCACTTAAAAGGGGTCATTCAGTTGCAGTTGCTAG AAGATGACAGGTCAGTGTTTTTATGCTATACACCTTATGTCTTTGGTCTGCCTTTGTCTCTTGCTCCAATAGTTGTTTTTCCTCATGCATTTTTACCTCAAGGGCTATTTTTCTTGCTGCTGATATCTACCAGCCAAATTCAATTCTCAATCA
[0036] Figure 1 Figure A shows the results of genome-wide association analysis based on SVs molecular markers. The horizontal axis is the chromosome position and the vertical axis is the -log10(p) value. It intuitively presents the significant distribution of SV molecular marker significant sites related to the FIV trait across the genome, and quickly locates the potential significant site on chromosome 12, which is located in the LRIG1 gene. Figure 1 Figure B shows a QQ plot based on SVs-GWAS analysis, with the horizontal axis representing the theoretical expected distribution of p-values and the vertical axis representing the actual observed values. The observed p-value region fits the theoretical distribution, indicating that the model correction is effective, verifying the Figure 1 The robustness of the analysis method in A.
[0037] The experimental results showed that the SV molecular marker related to the FIV trait in chicken feeding behavior was located at 14,881,990-14,882,295bp on chicken chromosome 12, and its candidate gene was LRIG1 gene.
[0038] (2) Genotyping of potential significant loci of SV molecular markers for chicken FIV traits and prediction of regulatory elements of the LRIG1 gene
[0039] Genotyping of potential significant loci of SV molecular markers for chicken FIV trait and prediction of regulatory elements of LRIG1 gene Figure 2 (A and B) shown. Figure 2 Figure A shows a genotyping boxplot of potential significant loci for the SV molecular marker for the FIV trait in chickens. The x-axis represents the different genotype populations, and the y-axis represents the FIV value (in grams per time). The horizontal line in the center of the colored box represents the median FIV value for the corresponding genotype population, and the red dots represent the mean FIV value for the corresponding genotype population. Population analysis results showed that the wild-type population (n=196) accounted for a larger proportion of the sample population (n=205), and the FIV value of the wild-type population was significantly higher than that of the deletion population. The difference in FIV values between the wild-type and deletion populations was extremely significant (p<0.001). This figure visually compares the differences in FIV values between different genotype populations, demonstrating the association between genotype and the FIV trait.
[0040] These experimental results indicate that the SV marker, located at bp 14,881,990-14,882,295 on chicken chromosome 12, is associated with the FIV trait in chickens. Specifically, chickens lacking the SV marker in their genomes had lower average feed intake per session, and the average feed intake per session of chickens lacking the SV marker was significantly lower than that of chickens containing the SV marker.
[0041] The predicted regulatory element map of the LRIG1 gene and the color diagram representing each regulatory element type are shown in the figure. Figure 2 As shown in B. Figure 2 Figure B shows the distribution of regulatory elements in the LRIG1 gene region. The elongated red box marks the target deletion region. The figure can distinguish different elements based on different colors. Figure 2 B shows that the SV molecular marker is located in the intron region within the LRIG1 gene. Combined with the yellow color representing the enhancer region, the analysis is based on the prediction of chicken regulatory elements in the annotation results of the UCSC website (http: / / genome.ucsc.edu / s / zhypan / galGal6_FAANG_V1). The experimental results show that the SV molecular marker is predicted to be an enhancer element in multiple tissues of chicken, including the brain, internal organs and intestines.
[0042] The expression distribution of LRIG1 gene (ENSGALG00000007483) in different tissues of chicken (Gallus gallus) is shown in the figure. Figure 3 This box plot shows the tissue-specific expression pattern of the LRIG1 gene, arranged in descending order according to the median expression level (TPM). (Data source: chickenGTEx-Portal database, http: / / chickengtex.farmgtex.org / By checking the expression of this gene on the ChickenGTEx website, the results showed that the LRIG1 gene is expressed in many tissues of chickens. Among them, the expression level of the LRIG1 gene in chicken testicles, pituitary gland, brain, hypothalamus and skin is higher than that in other tissues.
[0043] Figure 2 B provides direct support for the functional mechanism of SV molecular markers, combined with Figure 3 The expression distribution of the LRIG1 gene in different chicken tissues is shown in Figure 2. The results show that the LRIG1 gene is expressed in many chicken tissues, with higher expression in the nervous system (brain, hypothalamus) and endocrine system (such as the pituitary gland). Therefore, this SV molecular marker may regulate the expression of the LRIG1 gene, thereby affecting the chicken's neural network or hormonal signaling, ultimately regulating the chicken's feeding behavior (FIV).
[0044] The present invention can successfully distinguish individuals with different average feed intakes by utilizing SV molecular markers.
[0045] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the technical principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. Application of a reagent for detecting molecular markers of structural variation of the yellow-feathered broiler LRIG1 gene in the breeding of yellow-feathered broiler chickens, characterized in that: The structural variation molecular marker is a deletion mutation, which refers to the deletion of the nucleotide sequence shown in SEQ ID NO:1 in the chicken genome. The average feed intake of chickens whose genomes lack the nucleotide sequence shown in SEQ ID NO:1 is significantly lower than the average feed intake of chickens whose genomes contain the nucleotide sequence shown in SEQ ID NO:1; the structural variation molecular marker is located in the intron region within the LRIG1 gene on chicken chromosome 12.
2. A reagent for detecting molecular markers of structural variation in the LRIG1 gene of yellow-feathered broilers for distinguishing breeds of yellow-feathered broilers with differences in average feed intake per session, characterized in that: The structural variation molecular marker is a deletion mutation, which refers to the deletion of the nucleotide sequence shown in SEQ ID NO:1 in the chicken genome. The average feed intake of chickens whose genomes lack the nucleotide sequence shown in SEQ ID NO:1 is significantly lower than the average feed intake of chickens whose genomes contain the nucleotide sequence shown in SEQ ID NO:1; the structural variation molecular marker is located in the intron region within the LRIG1 gene on chicken chromosome 12.
Citation Information
Patent Citations
Yellow feather broiler feed conversion efficiency related gene, SNP molecular marker and application
CN117551784A
ARL13B gene-based structural variation marker applied to Wenchang chicken breeding and detection method of ARL13B gene-based structural variation marker
CN119662857A