Molecular markers and their application in the promoter of the rice grain width and shape gene GW2

Abstract

The present invention discloses a molecular marker of the promoter of the rice grain width and grain shape gene GW2 and its application, and relates to the field of biological breeding and rice molecular marker assisted breeding. GW2 InDel molecular markers in promoter regions GW2 p‑InDel, GW2 The nucleotide sequence of p-InDel is shown in SEQ ID NO.1; there is a GGCACACT sequence inserted in SEQ ID NO.1. The present invention also provides a molecular marker GW2 Detection primers, detection products, methods and applications of p-InDel. Molecular markers of the present invention GW2 p-InDel is closely linked to the narrowing of rice grain width and the increase of length-to-width ratio, and can be used to identify and screen for rice containing GW2 Novel allelic variation in gene promoter region GW2 p's rice germplasm materials, to achieve rapid, efficient and precise breeding of rice varieties with target traits of narrowed grain width and increased length-to-width ratio.

Description

Technical Field

[0001] The present invention relates to the technical field of biological breeding rice molecular marker assisted breeding, and in particular to a rice grain width and grain shape gene GW2 Molecular markers and applications of promoters. Background Art

[0002] Rice grain length, width, shape (measured as the ratio of grain length to grain width, or aspect ratio), and weight influence rice yield and quality, making them important targets for rice improvement. Rice with long, slender grains (high aspect ratios) and short, thick grains (low aspect ratios) are favored by different consumer groups. Improving rice grain width and shape to ensure yield and quality has become a key goal for rice breeders and production companies. Identifying alleles associated with genes for grain width and shape and using them to improve rice grain width and shape will facilitate rapid, efficient, and precise molecular breeding for high-yield, high-quality rice.

[0003] Grain width and length-to-width ratio in rice are quantitative traits regulated by multiple loci. Currently, few genes controlling grain width and shape have been cloned in rice for breeding applications, and even fewer have been discovered for their allelic variation across different rice germplasm materials. Sequencing and analyzing the promoter and coding regions of genes controlling grain width and shape in rice varieties with varying grain width and shape will uncover novel allelic variations in these genes. This will elucidate their distribution and functions across various rice germplasm resources, reveal the genetic basis and mechanisms of grain width and shape regulation, and provide important gene targets and theoretical support for breeding new high-quality, high-yield rice varieties with varying grain widths and shapes. Summary of the Invention

[0004] The purpose of the present invention is to solve at least one of the technical problems existing in the prior art and to provide a rice grain width and shape gene GW2 Molecular markers and applications of promoters, specifically providing a rice grain width and shape gene GW2 InDel molecular markers in promoter regions GW2 p-InDel and its detection primers, detection products, methods and applications.

[0005] InDel molecular markers of the present invention GW2 p-InDel, representing a gene controlling grain width in rice GW2 A new variant site discovered in the promoter region GW2 p, whose allele is GW2 P, the GW2 p is closely linked to rice's narrow grains and long, slender grains with a large aspect ratio, while GW2 P is closely linked to rice with wide grains and short, thick grains with a small length-to-width ratio. GW2p-InDel can be used to identify sites containing novel variants GW2 p or GW2 P's rice germplasm materials, thereby achieving efficient and precise selection of rice breeding materials with target traits of narrow grains, slender grains or wide grains, short and thick grains.

[0006] The technical solutions of the present invention are as follows:

[0007] The first aspect of the present invention provides a rice grain width and shape gene GW2 The molecular marker of the promoter, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the molecular marker is in its allele promoter GW2 The corresponding nucleotide sequence on P is shown in SEQ ID NO.2.

[0008] Specifically, there is a GGCACACT sequence inserted after the 70th base C in the SEQ ID NO.1, and there is a GGCACACT sequence deleted after the 70th base C in the SEQ ID NO.2.

[0009] The present invention discovered for the first time a gene on rice chromosome 2 that controls grain width and shape. GW2 New allelic variants in the promoter region of genes GW2 p and GW2 P, and obtained InDel molecular markers that distinguish these two alleles GW2 p-InDel, the GW2 p is closely linked to rice's narrow grains and long, slender grains with a large aspect ratio, while GW2 P is closely linked to wide rice grains and short, thick grains with a small length-to-width ratio.

[0010] The "particle width" of the present invention refers to narrow particles, wide particles and particle widths in between, and the "particle shape" refers to slender particles, thick and short particles and particle shapes in between.

[0011] Optionally, narrow-grain, slender grain shape refers to rice with an average length-to-width ratio of ≥3.2 and an average grain width of ≤2.7 mm; wide-grain, short and thick grain shape refers to rice with an average length-to-width ratio of ≤2.7 and an average grain width of ≥3.0 mm.

[0012] The second aspect of the present invention provides a primer pair for detecting the molecular marker, the primer pair comprising GW2 p-InDel-F and GW2 p-InDel-R, described GW2 The nucleotide sequence of p-InDel-F is shown in SEQ ID NO.3. GW2 The nucleotide sequence of p-InDel-R is shown in SEQ ID NO.4.

[0013] A third aspect of the present invention provides a product for detecting wide grain shape of rice grains, comprising the above primer pair.

[0014] Optionally, the product is a kit, which further comprises Taq DNA polymerase for PCR amplification, 10×Taq buffer containing 20 mM MgCl 2 , dNTPs, and nuclease-free water.

[0015] A fourth aspect of the present invention provides a method for detecting rice grain width and shape, the method comprising the following steps:

[0016] S1. Extracting genomic DNA from leaves of rice germplasm materials to be tested;

[0017] S2. Using the extracted DNA as a template, performing PCR amplification with the primer pair or the product to obtain an amplified product;

[0018] S3. Detect the amplified product using agarose gel electrophoresis, and determine the grain width and shape of the rice germplasm material to be detected based on the length of the amplified product.

[0019] Optionally, in S1, the rice germplasm materials to be tested are representative rice varieties of different origins, different ecological types, and different indica and japonica subspecies, including Longdao 24, Xiangyaxiangzhan, Wuyunjing 24, Nipponbare, Longjing 25, Kendao 14, Heijing 8, Jijing 515, Sanjiang 2, Nanguizhan, Huangguangyouzhan, Qigui B, Nongxiang 39, Huahang 38, Shuangyinzhan, Yuexiangzhan, Gan At least one of Ningjing No. 3, Jijing No. 88, Kendao No. 11, Suijing No. 18, Huangguangtaizhan, Dizhan, Yuehe Silk Seedling, Chenghui 377, Hujing 137, Longdun 103, Longjing 57, Yulong No. 7, Suiyangnian, Meitezhan, 19xiang, Fudao 88, Mudanjiang No. 26, Suijing No. 4, Longjing 40, Kendao No. 20, Guiyu No. 11, Yuebiao No. 5, Efeng Silk Seedling, and Yingxiang Silk Seedling.

[0020] Optionally, in S2,

[0021] The PCR reaction system was as follows: 5 μL of 10× Taq buffer containing 20 mM MgCl2, 2 μL of dNTPs, 0.5 μL of 10 μM forward primer GW2 p-InDel-F, 0.5 μL 10 μM reverse primer GW2 p-InDel-R, 0.25 μL 5 U / μL TaqDNA polymerase, 1 μL DNA, and nuclease-free water to a total volume of 50 μL;

[0022] The PCR reaction program was as follows: pre-denaturation at 95°C for 10 min, 35 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 15 s, and extension at 72°C for 15 s, and extension at 72°C for 10 min.

[0023] Optionally, in S3,

[0024] When the length of the amplified product is 106 bp, the grain width and shape gene in the rice germplasm material to be detected GW2 The promoter type is GW2 p, the grains are narrow and elongated;

[0025] When the length of the amplified product is 98 bp, the grain width and shape gene in the rice germplasm material to be detected GW2 The promoter type is GW2 P, the grains are wide and short;

[0026] When the amplified product is a heterozygous type with both 106 bp and 98 bp present, the grain width and shape gene in the rice germplasm material to be detected is GW2 The promoter type is GW2 p / GW2 P, the grain width is between wide grains and narrow grains, and the grain shape is between slender grains and short and thick grains.

[0027] The fifth aspect of the present invention provides an application of the molecular marker, the primer pair, the product or the method in detecting grain width and shape of rice germplasm materials.

[0028] The sixth aspect of the present invention provides an application of the molecular marker, the primer pair, the product, or the method in improving rice grain width and shape using molecular marker-assisted breeding.

[0029] The present invention has at least one of the following beneficial effects:

[0030] The present invention provides a rice grain width and shape gene GW2 InDel molecular markers of promoters GW2 p-InDel and its detection primers, detection products, methods and applications. The present invention first discovered a gene on chromosome 2 of rice that controls grain width and shape. GW2 New allelic variants in the promoter region of genes GW2 p and GW2 P, and obtained InDel molecular markers that distinguish these two alleles GW2 p-InDel. It is only necessary to detect the size of the amplified band of the above molecular markers to determine whether the rice material to be tested contains GW2 Novel allelic variants in gene promoter regions GW2 p andGW2 P, to achieve the prediction of rice germplasm grain width and shape from the gene level or molecular marker-assisted breeding to improve rice grain width and shape, such as for identifying or screening rice breeding materials with slender grain shape or short and thick grain shape phenotype. The molecular markers of the present invention can quickly and efficiently identify rice germplasm materials and their breeding offspring at the seedling stage. GW2 Gene promoter types can be used to accurately breed high-yield and high-quality rice varieties with slender grains or short and thick grains, greatly reducing the time and labor costs required for breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Rice germplasm materials with different grain widths and shapes GW2 InDel molecular markers of gene promoters GW2 Size of the p-InDel amplified product. M is a marker, indicating the 50 bp, 100 bp, and 200 bp positions. Sequence numbers 1-16 represent: 1, Longdao 24; 2, Xiangyaxiangzhan; 3, Wuyunjing 24; 4, Nipponbare; 5, Longjing 25; 6, Kendao 14; 7, Heijing 8; 8, Jijing 515; 9, Sanjiang 2; 10, Nanguizhan; 11, Huangguangyouzhan; 12, Qigui B; 13, Nongxiang 39; 14, Huahang 38; 15, Shuangyinzhan; 16, Yuexiangzhan.

[0032] Figure 2 To adopt GW2 InDel molecular markers of gene promoters GW2 p-InDel identification of 24 rice germplasm materials GW2 p allelic variation. M is a marker, indicating the 50 bp, 100 bp, and 200 bp positions. Sequence numbers 1–24 represent: 1, Ganningjing 3; 2, Jijing 88; 3, Kendao 11; 4, Suijing 18; 5, Huangguangtaizhan; 6, Dizhan; 7, Yuehe Si Miao; 8, Chenghui 377; 9, Hujing 137; 10, Longdun 103; 11, Longjing 57; 12, Yulong 7; 13, Suiyangnian; 14, Meitezhan; 15, 19xiang; 16, Fudao 88; 17, Mudanjiang 26; 18, Suijing 4; 19, Longjing 40; 20, Kendao 20; 21, Guiyu 11; 22, Yuebiao 5; 23, Efeng Si Miao; 24, Yingxiang Si Miao. DETAILED DESCRIPTION

[0033] In order to make the technical problems, technical solutions and beneficial effects solved by the present invention more clearly understood, the present invention is further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0034] The technical means used in the examples are all conventional technical means well known to those skilled in the art; the raw materials or materials used in the examples are all commercially available.

[0035] Example 1:

[0036] Rice grain width and shape gene GW2 InDel molecular markers of promoters GW2 Development and validation of p-InDel

[0037] (1) Rice grain width and shape genes GW2 Discovery and molecular markers of sequence variation sites in promoter regions GW2 The design of p-InDel is as follows:

[0038] According to reports, GW2 A major gene controlling grain width was cloned on chromosome 2 of rice, with the gene number LOC_Os02g14720. Loss of its function results in grain width (Song et al., A QTL for rice grainwidth and weight encodes a previously unknown RING-type E3 ubiquitin ligase, Nature genetics, 2007, 39:623-630. doi: 10.1038 / ng2014). Based on this, we explored the potential role of the QTL in rice grain width and weight in natural rice germplasm materials. GW2 Whether there is a sequence in the promoter region of the gene that is closely linked to the wide grain shape trait of rice regulates the wide grain shape of rice. GW2 The gene promoter region was sequenced and sequence comparison analysis revealed that the narrow-grain variety ivory incense accounted for GW2 There is a GGCACACT sequence inserted in the gene promoter region (see SEQ ID NO.1), and the wide-grain variety Longdao 24 GW2 There is a GGCACACT sequence deletion in the gene promoter region (see SEQ ID NO.2).

[0039] SEQ ID NO.1: CAAGAAAAACCAAAACCTAACACGTGGATACAAAATGCAACCTGGACCCCACGTAACCCCTCCACCTCACGGCACACTTGTACATCCAGCTAGAGATCATCCTACG.

[0040] SEQ ID NO. 2: CAAGAAAAACCAAAACCTAACACGTGGATACAAAATGCAACCTGGACCCCACGTAACCCCTCCACCTCACTGTACATCCAGCTAGAGATCATCCTACG.

[0041] Based on the sequence variation sites, the grain width and shape gene of the present invention was designed using Primer Premier 5 software. GW2 InDel molecular markers of promoters GW2 p-InDel, the primer sequences are shown in Table 1 , and the product sizes were 106 bp and 98 bp in Xiangyaxiangzhan and Longdao 24, respectively.

[0042] Table 1 Genes related to grain width and shape GW2 InDel molecular markers of promoters GW2 Primer sequence of p-InDel

[0043]

[0044] (2) Validation of molecular markers using 16 rice germplasms with different grain widths and shapes GW2 The relationship between p-InDel and grain width, aspect ratio and grain shape phenotype is as follows:

[0045] Sixteen rice germplasms with different grain widths and shapes, including Longdao 24, Xiangyaxiangzhan, Wuyunjing 24, Nipponbare, Longjing 25, Kendao 14, Heijing 8, Jijing 515, Sanjiang 2, Nanguizhan, Huangguangyouzhan, Qigui B, Nongxiang 39, Huahang 38, Shuangyinzhan, and Yuexiangzhan, were analyzed for their mature grain length, grain width, length-to-width ratio, and 1000-grain weight. It was found that there were obvious phenotypic differences in grain width and length-to-width ratio among them. The grain width of Longdao 24, Wuyunjing 24, Nipponbare, Longjing 25, Kendao 14, Heijing 8, Jijing 515 and Sanjiang 2 was wider and the length-to-width ratio was smaller; while the grain width of Xiangyaxiangzhan, Nanguizhan, Huangguangyouzhan, Qigui B, Nongxiang 39, Huahang 38, Shuangyinzhan and Yuexiangzhan was narrower and the length-to-width ratio was larger. See Table 2 for details.

[0046] The leaves of these 16 rice germplasm materials were taken and the genomic DNA of the leaves was extracted by CTAB method as a template and the InDel molecular marker was used to GW2 PCR amplification was performed using the forward and reverse primers of p-InDel.

[0047] The PCR reaction system is: 5 μL 10× Taq Buffer containing 20 mM MgCl2, 2 μL dNTPs (10 mM), 0.5 μL 10 μM forward primer GW2p-InDel-F, 0.5 μL 10 μM reverse primer GW2 p-InDel-R, 0.25 μL 5 U / μL Taq DNA polymerase, 1 μL DNA (10 pg – 1 μg), and nuclease-free water to a total volume of 50 μL.

[0048] The PCR reaction program was as follows: pre-denaturation at 95°C for 10 min, 35 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 15 s, and extension at 72°C for 15 s, and extension at 72°C for 10 min.

[0049] The above PCR products were detected by 5% (g / 100 mL, m / v) agarose gel electrophoresis. Figure 1 As shown in the figure, the PCR band pattern of wide-grained varieties with small length-to-width ratios, such as Longdao 24, Wuyunjing 24, Nipponbare, Longjing 25, Kendao 14, Heijing 8, Jijing 515, and Sanjiang 2, is about 98 bp; while the PCR band pattern of narrow-grained varieties with large length-to-width ratios, such as Xiangyaxiangzhan, Nanguizhan, Huangguangyouzhan, Qigui B, Nongxiang 39, Huahang 38, Shuangyinzhan, and Yuexiangzhan, is about 106 bp. There is an 8 bp difference in PCR band pattern between germplasm materials with wide grains and small length-to-width ratios and those with narrow grains and large length-to-width ratios.

[0050] The molecular marker amplification product electrophoresis band was 98 bp and there was a GGCACACT sequence deletion in the sequence. GW2 Gene promoter alleles are named GW2 P; the electrophoresis band of the molecular marker amplification product is 106 bp, and the GGCACACT sequence is inserted in the sequence GW2 Gene promoter alleles are named GW2 p. GW2 Gene promoter alleles are GW2 The rice germplasm materials of P, such as Longdao 24, Wuyunjing 24, Nipponbare, Longjing 25, Kendao 14, Heijing 8, Jijing 515, and Sanjiang 2, have wide grains and short and thick grains with small length-to-width ratio; GW2 Gene promoter alleles are GW2 p rice germplasm materials, such as Ivory Xiangzhan, Nanguizhan, Huangguangyouzhan, Qigui B, Nongxiang 39, Huahang 38, Shuangyinzhan, and Yuexiangzhan, have narrow grains and elongated grains with a large aspect ratio (Table 2). GW2 Gene promoter alleles GW2 The p mutation will cause the rice grains to be narrow and elongated with a large length-to-width ratio, while the allele GW2 The P mutation causes rice grains to be wide, short, and have a small length-to-width ratio.

[0051] Table 2 Analysis of grain width and shape of 16 rice germplasm materials GW2 Promoter allele identification

[0052]

[0053] Note: Data represent the mean ± standard deviation of at least 30 mature seeds of each rice germplasm material

[0054] Example 2:

[0055] Utilization of rice grain width and shape genes GW2 InDel molecular markers of promoters GW2 p-InDel identification of rice germplasm materials containing GW2 p and GW2 P allele variation was determined by taking 24 rice germplasm materials, including Ganningjing 3, Jijing 88, Kendao 11, Suijing 18, Huangguangtaizhan, Dizhan, Yuehesi Miao, Chenghui 377, Hujing 137, Longdun 103, Longjing 57, Yulong 7, Suiyangnian, Meitezhan, 19xiang, Fudao 88, Mudanjiang 26, Suijing 4, Longjing 40, Kendao 20, Guiyu 11, Yuebiao 5, Efengsi Miao, and Yingxiangsi Miao, as examples to determine whether they contained P allele variation. GW2 p and GW2 P allele variation, the specific steps are as follows:

[0056] (1) Extraction of genomic DNA from rice germplasm materials: Leaves of 24 rice germplasm materials were sampled at the seedling stage, and genomic DNA from the leaves was extracted using the CTAB method;

[0057] (2) Amplify molecular markers using a standard PCR amplification system GW2 p-InDel related fragments: using molecular marker primers GW2 p-InDel-F and GW2 p-InDel-R, using the rice genomic DNA to be detected as a template, was amplified by PCR. The system and procedure of the PCR reaction were consistent with those in step (2) of Example 1.

[0058] (3) Electrophoresis analysis of amplified products: PCR products were detected by 5% (g / 100 mL, m / v) agarose gel electrophoresis. If the molecular marker can amplify a 106 bp band, it means that the detected rice germplasm material is present. GW2 The GGCACACT sequence is inserted into the gene promoter region, and the promoter allele is GW2 If the molecular marker can expand the 98 bp band, it means that the tested rice germplasm material exists GW2 The GGCACACT sequence in the gene promoter region is missing, and the promoter allele is GW2P; If the molecular marker amplifies the 106 bp / 98 bp heterozygous band, it means that the material GW2 Gene promoter alleles are GW2 p / GW2 P;

[0059] According to the electrophoresis results ( ​ ), the PCR banding pattern of rice germplasm materials such as Huangguangtaizhan, Dizhan, Yuehesimiao, Chenghui 377, Suiyangnian, Meitezhan, 19xiang, Fudao 88, Guiyu 11, Yuebiao 5, Efengsimiao, and Yingxiangsimiao was 106 bp, ​ There is a GGCACACT sequence insertion in the gene promoter region, and the promoter allele is ​ p; while the PCR band pattern of rice germplasm materials such as Ganningjing 3, Jijing 88, Kendao 11, Suijing 18, Hujing 137, Longdun 103, Longjing 57, Yulong 7, Mudanjiang 26, Suijing 4, Longjing 40, and Kendao 20 is 98 bp, ​ There is a GGCACACT sequence deletion in the gene promoter region, and the promoter allele is ​ P.

[0060] (4) Verification and analysis of grain width and grain shape of 24 rice germplasm materials: The grain length, grain width, length-to-width ratio, 1000-grain weight and other traits of these 24 rice germplasm materials with different grain width and grain shape were verified and analyzed at maturity. The results are shown in Table 3. ​ Gene promoter alleles are ​ The rice germplasm materials of p, including Huangguangtaizhan, Dizhan, Yuehe Si Miao, Chenghui 377, Suiyangnian, Meitezhan, 19xiang, Fudao 88, Guiyu 11, Yuebiao 5, Efeng Si Miao and Yingxiang Si Miao, have narrow grains and elongated grains with large aspect ratio; ​ Gene promoter alleles are ​ The rice germplasm materials of P, Ganningjing 3, Jijing 88, Kendao 11, Suijing 18, Hujing 137, Longdun 103, Longjing 57, Yulong 7, Mudanjiang 26, Suijing 4, Longjing 40, Kendao 20, have wide grains and short and thick grains with a small aspect ratio. The rice grain widening gene of the present invention ​ InDel molecular markers of promoters ​ p-InDel can be used to identify whether rice germplasm contains grain width and shape genes ​ promoter ​ p and ​ P allele variation, thereby predicting grain width and grain shape of rice germplasm materials at the genetic level.

[0061] Table 3 contains ​ p or ​Results of P allele differences in grain width and shape in 24 rice germplasms

[0062]

[0063] Note: Data represent the mean ± standard deviation of at least 30 mature seeds of each rice germplasm material

[0064] From the above examples, it can be seen that the rice grain width and shape gene of the present invention ​ InDel molecular markers of promoters ​ p-InDel and its detection primers, detection products, and methods are mainly used to identify rice grain width and shape genes ​ Whether there is an insertion or deletion of the GGCACACT sequence in the promoter region. Through PCR detection and agarose gel electrophoresis identification, it can be determined as early as possible and accurately whether there is an allelic variation in the tested rice germplasm material that causes the grain to be narrow, elongated, and with a large aspect ratio. ​ p, and allelic variation that results in wide grains, short and thick grains with a small aspect ratio ​ P, thereby achieving rapid, efficient and accurate molecular marker-assisted breeding selection and accelerating the breeding process.

[0065] The above description is only a preferred specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any technician familiar with the technical field, within the technical scope disclosed by the present invention, who makes equivalent replacements or changes based on the technical solution and inventive concept of the present invention, should be covered by the scope of protection of the present invention.

Claims

1. A method for detecting rice grain width and shape, characterized in that: The method comprises the following steps: S1. Extracting genomic DNA from leaves of rice germplasm materials to be tested; S2. Using the extracted DNA as a template, performing PCR amplification with the primer pair or a product containing the primer pair to obtain an amplified product; S3. Detecting the amplified product by agarose gel electrophoresis, and determining the grain width and shape of the rice germplasm material to be detected based on the length of the amplified product; Wherein, in S2, the primer pair includes GW2 p-InDel-F and GW2 p-InDel-R, described GW2 The nucleotide sequence of p-InDel-F is shown in SEQ ID NO.

3. GW2 The nucleotide sequence of p-InDel-R is shown in SEQ ID NO. 4; In S3, when the length of the amplified product is 106 bp, the grain width and shape gene in the rice germplasm material to be detected GW2 The promoter type is GW2 p, the grains are narrow and elongated; when the length of the amplified product is 98 bp, the wide-grain gene in the rice germplasm material to be detected GW2 The promoter type is GW2 P, the grains are wide and short; when the amplified products are heterozygous with 106 bp and 98 bp coexisting, the wide grain gene in the rice germplasm material to be detected is GW2 The promoter type is GW2 p / GW2 P, the grain width is between wide grains and narrow grains, and the grain shape is between slender grains and short and thick grains.

2. The method according to claim 1, characterized in that In S1, The rice germplasm materials to be tested are representative rice varieties of different origins, different ecological types, and different indica and japonica subspecies, including Longdao 24, Xiangyaxiangzhan, Wuyunjing 24, Nipponbare, Longjing 25, Kendao 14, Heijing 8, Jijing 515, Sanjiang 2, Nanguizhan, Huangguangyouzhan, Qigui B, Nongxiang 39, Huahang 38, Shuangyinzhan, Yuexiangzhan, and Ganningjing 3. , Jijing 88, Kendao 11, Suijing 18, Huangguangtaizhan, Dizhan, Yuehe Silk Seedling, Chenghui 377, Hujing 137, Longdun 103, Longjing 57, Yulong 7, Suiyangnian, Meitezhan, 19xiang, Fudao 88, Mudanjiang 26, Suijing 4, Longjing 40, Kendao 20, Guiyu 11, Yuebiao 5, Efeng Silk Seedling, Yingxiang Silk Seedling, at least one of them.

3. The method according to claim 1, characterized in that In S2, The PCR reaction system was as follows: 5 μL of 10× Taq buffer containing 20 mM MgCl2, 2 μL of dNTPs, 0.5 μL of 10 μM forward primer GW2 p-InDel-F, 0.5 μL 10 μM reverse primer GW2 p-InDel-R, 0.25 μL 5 U / μL Taq DNA polymerase, 1 μL DNA, and nuclease-free water to a total volume of 50 μL; The PCR reaction program was as follows: pre-denaturation at 95°C for 10 min, 35 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 15 s, and extension at 72°C for 15 s, and extension at 72°C for 10 min.

4. Use of the method according to any one of claims 1 to 3 in detecting grain width and shape of rice germplasm materials.

5. Use of the method according to any one of claims 1 to 3 in improving rice grain width and shape using molecular marker-assisted breeding.

Images