L-proline hydroxylase and application of engineered enzyme of L-proline hydroxylase in substrate hydroxylation

Abstract

The invention discloses an L-proline hydroxylase and an application of an engineered enzyme of the L-proline hydroxylase in substrate hydroxylation. The invention provides an L-proline hydroxylase mutant. The L-proline hydroxylase mutant has the difference of amino acid residues selected from one or more of the following sites on an amino acid sequence as shown in SEQ ID NO: 1: the 68th site, the 85th site, the 86th site, the 101st site, the 108th site, the 116th site, the 139th site, the 149th site, the 152th site, the 165 site, the 171st site, the 172nd site, the 173rd site, the 176th site, the 181st site, the 184th site and the 228th site. The invention finds that the L-proline hydroxylase and the mutant thereof have the advantage of high conversion rate when being used for catalytically synthesizing the (2S, 5R)-trans-5-hydroxy-piperidinecarboxylic acid; meanwhile, the method can also be used for hydroxylation of other substrates and has a good conversion rate.

Description

Technical Field

[0001] The present invention belongs to the field of biocatalysis, and particularly relates to the application of L-proline hydroxylase and its engineered enzymes in substrate hydroxylation, especially in biocatalytic substrate hydroxylation. Background Art

[0002] Proline and its derivatives with functional groups are useful building blocks for synthesizing pharmaceutical compounds. Among them, hydroxyproline is the starting material for synthesizing various therapeutic compounds, including carbapenem antibiotics (Altamura et al., 1995, J Med Chem. 38(21):4244 - 56), angiotensin-converting enzyme inhibitors, protease inhibitors (Chen et al., 2002, J Org Chem. 67(8):2730 - 3; Chen et al., 2006, J Med Chem. 49(3):995 - 1005), nucleic acid analogs, etc. (Efimov et al., 2006, nucleic Acids Res. 34(8):2247 - 2257).

[0003] Similarly, hydroxylated derivatives of the proline homolog pipecolic acid (HPA) can also be used as building blocks for pharmaceutical compounds. For example, enzyme inhibitors such as β-lactamase inhibitors and TNF-α converting enzyme inhibitors (WO2009091856; Bioorag. Med. Chem. Lett., 12(10):1387 - 1390

[2002] ) have been found to have potential therapeutic value. 5-Hydroxy-pipecolic acid (HPA), as an active building block, can be used to synthesize pharmacologically active compounds, such as diazabicyclooctane derivatives (US2016 / 0264573). Its stereoselective synthesis has been attracting much attention.

[0004] The hydroxylated products can be obtained from natural products, but their purification methods are complex and it is difficult to obtain highly enantiopure hydroxylated products. The chemical methods for obtaining hydroxylated compounds require complex steps, and the hydroxylation positions are uncontrollable, resulting in impure hydroxylated products, and subsequent treatments such as separation and purification of the products are needed. It is difficult to be applied to large-scale industrial production. The biocatalytic method is to use the catalytic action of micro-proline hydroxylase for hydroxylation synthesis reactions. This method is green and sustainable and has high stereoselectivity for substrates.

[0005] L-proline hydroxylase is a α-ketoglutarate-dependent dioxygenase that requires the co-substrates of α-ketoglutarate, ascorbic acid, DTT, and Fe2+ as a cofactor to carry out the reaction. Currently, microbial enzymes that produce cis-hydroxyproline (WO2009139365; and EP2290065) and an enzyme that produces trans-3-hydroxyproline have been found in fungal extracts. At the same time, Klein et al. used cis-4-proline hydroxylase to convert L-pipecolic acid to (2S,5S)-cis-5-hydroxy-pipecolic acid (Adv. Synth. Catal., 353: 1375-1383

[2011] ). However, its activity is relatively low. Now, protein engineering means have been successfully used to modify proline hydroxylase to improve its catalytic activity and successfully prepare (2S,5S)-cis-5-hydroxy-pipecolic acid (CN109715817A). However, there are few reports on the preparation of (2S,5R)-trans-5-hydroxy-pipecolic acid by enzymatic catalysis method at present. Summary of the Invention

[0006] The technical problem to be solved by the present invention is that the yield of (2S,5R)-trans-5-hydroxy-pipecolic acid in the prior art is relatively low. To this end, the present invention provides an application of L-proline hydroxylase and its engineered enzyme in substrate hydroxylation. The present invention discovers that L-proline hydroxylase and its mutants have the advantage of high conversion rate when catalyzing the synthesis of (2S,5R)-trans-5-hydroxy-pipecolic acid; at the same time, it can also be used for the hydroxylation of other substrates and has a good conversion rate.

[0007] The present invention provides an L-proline hydroxylase mutant, and the L-proline hydroxylase mutant has amino acid residue differences at one or more sites selected from the following on the amino acid sequence shown in SEQ ID NO: 1: position 68, position 85, position 86, position 101, position 108, position 116, position 139, position 149, position 152, position 165, position 171, position 172, position 173, position 176, position 181, position 184, and position 228.

[0008] In one embodiment, the L-proline hydroxylase is from Dactylosporangium sp. RH1.

[0009] In one embodiment, the difference is deletion, addition or substitution, preferably substitution.

[0010] In one embodiment, the mutant is the amino acid residue at position 68 of the amino acid sequence shown in SEQ ID NO: 1 is replaced by H or Q; preferably H;

[0011] and / or, the 85th position is replaced by E or Q; preferably Q;

[0012] and / or, the 86th position is replaced by N or H;

[0013] and / or, the 101st position is replaced by L;

[0014] and / or, the 108th position is replaced by C, S or T; preferably S;

[0015] and / or, the 116th position is replaced by E, H or N; preferably H;

[0016] and / or, the 139th position is replaced by C or Q;

[0017] and / or, the 149th position is replaced by S;

[0018] and / or, the 152nd position is replaced by K or R; preferably K;

[0019] and / or, the 165th position is replaced by A, G or V;

[0020] and / or, the 171st position is replaced by E, F, S or V; preferably S;

[0021] and / or, the 172nd position is replaced by D or Q; preferably Q;

[0022] and / or, the 173rd position is replaced by N, G, L or V;

[0023] and / or, the 176th position is replaced by C, S or T;

[0024] and / or, the 181st position is replaced by D, E or S;

[0025] and / or, the 184th position is replaced by H or K; preferably H;

[0026] and / or, the 228th position is replaced by Q, S or T.

[0027] In one embodiment, the L-proline hydroxylase mutant has an amino acid residue difference at least at one site selected from the following: the 173rd position, the 181st position, and the 228th position in the amino acid sequence shown in SEQ ID NO: 1;

[0028] Preferably, it has an amino acid residue difference at the 173rd position, has an amino acid residue difference at the 181st position, has an amino acid residue difference at the 228th position, has an amino acid residue difference at the 173rd and 181st positions, has an amino acid residue difference at the 181st and 228th positions, or has an amino acid residue difference at least at the 173rd, 181st, and 228th positions.

[0029] In one embodiment, the L-proline hydroxylase mutant has differences in the amino acid residues at positions 173, 181, and 228 in the amino acid sequence shown in SEQ ID NO: 1, and also has differences in the amino acid residues at one or more of the following positions: position 68, position 85, position 86, position 101, position 108, position 116, position 139, position 149, position 152, position 165, position 171, position 172, position 176, and position 184.

[0030] In one embodiment, the L-proline hydroxylase mutant has differences in the amino acid residues at positions 173, 181, and 228 in the amino acid sequence shown in SEQ ID NO: 1, and has differences in the amino acid residues at one of the following positions: position 68, position 85, position 86, position 108, position 116, position 139, position 152, position 165, position 171, position 172, position 176, or position 184; preferably, has differences in the amino acid residues at one of the following positions: position 85, position 86, position 139, position 152, position 171, position 172, or position 184.

[0031] In one embodiment, the L-proline hydroxylase mutant has differences in the amino acid residues at positions 173, 181, and 228 in the amino acid sequence shown in SEQ ID NO: 1, and has differences in the amino acid residues at three, four, five, six, or seven of the following positions: position 68, position 85, position 101, position 116, position 139, position 149, position 171, position 172, and position 184.

[0032] In one embodiment, the differences of the L-proline hydroxylase mutant in the amino acid sequence shown in SEQ ID NO: 1 are shown in Table 1:

[0033] Table 1

[0034]

[0035]

[0036] The present invention provides a method for preparing compound I-1, which comprises the following steps: in a solvent, in the presence of an enzyme, an enzyme cofactor, and oxygen, subjecting compound II-1 to the hydroxylation reaction shown in the following formula to obtain compound I-1.

[0037]

[0038] The enzyme is L-proline hydroxylase having the amino acid sequence shown in SEQ ID NO: 1 or an L-proline hydroxylase mutant having differences in amino acid residues at one or more sites selected from the following on the amino acid sequence shown in SEQ ID NO: 1: position 68, position 85, position 86, position 101, position 108, position 116, position 139, position 149, position 152, position 165, position 171, position 172, position 173, position 176, position 181, position 184, and position 228.

[0039] In one embodiment, the L-proline hydroxylase mutant may also be as described in any one of the embodiments of the present invention.

[0040] The solvent may be a solvent conventional in such reactions in the art. Preferably, the solvent is a buffer solution, such as a phosphate buffer solution, for example, a potassium phosphate buffer solution, or for example, a dipotassium hydrogen phosphate - potassium dihydrogen phosphate buffer solution. The concentration of dipotassium hydrogen phosphate may be 0.06 mol / L, and the concentration of potassium dihydrogen phosphate may be 0.04 mol / L.

[0041] In one embodiment, the pH of the solvent is 6.0 to 8.0, such as 6.5 - 7.5, or for example, 7.0 to 7.2, and more preferably 7.0.

[0042] In one embodiment, the mass - volume ratio of the compound II - 1 to the solvent is (1 - 50) g / L, such as (1 - 25) g / L, or for example, 3.6 g / L, 4 g / L, 10 g / L, or 20 g / L.

[0043] The cofactor of the enzyme may be a cofactor conventional for such enzymes in the art. Preferably, the cofactor is α - ketoglutaric acid, ascorbic acid, and Fe 2+ ; preferably, the Fe 2+ is provided by (NH4)2Fe(SO4)2;

[0044] Preferably, the molar ratio of α - ketoglutaric acid to the compound II - 1 is (1 - 5):1, such as 1.8:1, 3.4:1, 3.9:1, or 4.4:1;

[0045] Preferably, the molar ratio of ascorbic acid to the compound II - 1 is (0.01 - 0.5):1, such as 0.015:1, 0.15:1, 0.29:1, 0.33:1, or 0.37:1;

[0046] Preferably, the Fe 2+ and the compound II - 1 have a molar ratio of (0.01 - 0.5):1, such as 0.05:1, 0.09:1, or 0.1:1.

[0047] In one embodiment, the enzyme exists alone or in combination in the form of whole-cell enzyme, homogenized enzyme solution, crude enzyme solution or solid enzyme powder.

[0048] In one embodiment, the enzyme exists in the form of a homogenized enzyme solution, and the ratio of the added mass of the wet bacterial cells used to prepare the homogenized enzyme solution to the added volume of the resuspension is 1 g:(10 - 20) mL, such as 1 g:13.5 mL.

[0049] In one embodiment, the enzyme is a crude enzyme solution, and the addition amount of the enzyme is calculated as follows according to the added mass of the wet bacterial cells used to prepare the crude enzyme solution: the mass ratio of the wet bacterial cells capable of producing the enzyme to the compound II-1 is (1 - 15):1, such as (2 - 10):1, and further such as 3:1, 3.7:1, 5.8:1 or 7.4:1.

[0050] Preferably, the resuspension is water, buffer solution or culture medium, preferably buffer solution as described above; preferably, the resuspension further comprises lysozyme and nuclease, and the mass-volume ratio of the lysozyme to the buffer solution is 2 mg:1 mL; the mass-volume ratio of the nuclease to the buffer solution is 2 mg:1 mL.

[0051] In one embodiment, the enzyme is solid enzyme powder, and the mass ratio of the solid enzyme powder to the compound II-1 is (0.01 - 0.5):1, such as (0.05 - 0.1):1, and further such as 0.3:1.

[0052] In one embodiment, the temperature of the hydroxylation reaction is 20°C to 40°C, such as 28°C to 32°C, and further such as 30°C.

[0053] The progress of the hydroxylation reaction is detected by using conventional monitoring methods for such reactions in the art (such as TLC or LC-MS). The time of the hydroxylation reaction takes the disappearance or no longer reaction of the compound II-1 as the reaction end point, and the time of the hydroxylation reaction can be 10 h - 20 h, such as 18 h.

[0054] In one embodiment, the reaction system of the hydroxylation reaction consists of the following: solvent, compound II-1, oxygen, enzyme, α-ketoglutaric acid, ascorbic acid and Fe 2+ Composition.

[0055] In one embodiment, the hydroxylation reaction includes the following steps:

[0056] (1) Mix the solvent, α-ketoglutaric acid and ascorbic acid to obtain a mixed solution;

[0057] (2) Mix the mixture obtained in step (1), the compound II-1 and Fe 2+ to obtain a mixture;

[0058] (3) Under the presence of oxygen and the enzyme, subject the mixture obtained in step (2) to a hydroxylation reaction to obtain compound I-1.

[0059] In a certain embodiment, in step (2), the pH of the mixture in step (1) is adjusted to 7.0 - 7.2 (such as 7) and then mixed with the compound II-1 and Fe 2+ . The reagent for adjusting the pH is preferably a hydroxide of an alkali metal, such as sodium hydroxide, and further preferably a 10M aqueous solution of sodium hydroxide.

[0060] The present invention provides a method for preparing compound I, which comprises the following steps: in a solvent, in the presence of an enzyme, a cofactor of the enzyme and oxygen, subject compound II to a hydroxylation reaction as shown in the following formula to obtain compound I,

[0061]

[0062] wherein X is a linking bond, CH or CHR 3 ;

[0063] represents a single bond or a double bond;

[0064] R 1 is a hydroxyl group, an amino group, C 1-6 alkoxy, (C 6-10 aryl)O-, (C 6-10 aryl)S- or C 1-6 alkyl substituted by one or more SH;

[0065] R 2 is hydrogen, optionally substituted C 1-6 alkyl, C 2-6 alkenyl or C 2-6 alkynyl;

[0066] R 3 is hydrogen or a hydroxyl group;

[0067] R 4 is a hydroxyl group; or R 3 , R 4 and the carbon atom to which they are attached together form

[0068] In the preparation method of the compound represented by Formula I, the definitions of the solvent, enzyme, and cofactor of the enzyme are as described in any of the embodiments of the preparation method of the compound represented by Formula I-1; the operations and conditions in the preparation method of the compound represented by Formula I may also be as described in any of the embodiments of the preparation method of the compound represented by Formula I-1.

[0069] In one embodiment, R 1 is hydroxy.

[0070] In one embodiment, R 2 is hydrogen.

[0071] In one embodiment, the compound II and compound I are selected from the following options:

[0072] Option 1: Compound II is Compound I is

[0073] Option 2: Compound II is Compound I is

[0074] Option 3: Compound II is Compound I is

[0075] Option 4: Compound II is Compound I is

[0076] The present invention also provides a nucleic acid, wherein the polynucleotide sequence of the nucleic acid is selected from the polynucleotide sequence encoding the L-proline hydroxylase mutant described in any of the embodiments of the present invention or its complementary sequence.

[0077] In one embodiment, the polynucleotide sequence of the nucleic acid is the polynucleotide sequence shown in SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8 or its complementary sequence.

[0078] The present invention also provides a nucleic acid construct containing the nucleic acid described in any of the embodiments of the present invention; preferably, the nucleic acid construct is an expression cassette.

[0079] The present invention also provides a recombinant vector, wherein the recombinant vector contains the nucleic acid or nucleic acid construct described in any of the embodiments of the present invention; preferably, the recombinant vector is a recombinant cloning vector or a recombinant expression vector.

[0080] The present invention also provides a host cell, which contains the nucleic acid, nucleic acid construct or recombinant vector described in any embodiment of the present invention, and / or expresses a mutant of L-proline hydroxylase described in any embodiment of the present invention; preferably, the host cell is selected from one or more of Escherichia coli cells, insect cells, yeast cells and mammalian cells, and the Escherichia coli cell can be Escherichia coli BL21(DE3) cell.

[0081] The present invention also provides an enzyme preparation, which contains a mutant of L-proline hydroxylase described in any embodiment of the present invention.

[0082] The present invention also provides a transformant, wherein the transformant contains the recombinant vector described in any embodiment of the present invention.

[0083] The present invention also provides a method for preparing a mutant of L-proline hydroxylase described in any embodiment of the present invention, which comprises culturing the transformant as described above and obtaining a culture containing the mutant of L-proline hydroxylase.

[0084] The present invention also provides the use of a mutant of L-proline hydroxylase as described above or an L-proline hydroxylase having the amino acid sequence shown in SEQ ID NO:1 in the preparation of chiral hydroxylation products. Preferably, the chiral hydroxylation product is compound I-1 or I described in any aspect of the present invention.

[0085] In the present invention, the whole-cell enzyme is produced by a cell (such as a prokaryotic cell) containing the gene encoding the enzyme; whole-cell catalysis refers to using a complete biological organism (i.e., a cell, tissue or even an individual) for catalytic transformation, and its essence is to use the enzyme inside the cell for catalysis. This method is a biocatalytic technology between the fermentation method and the free enzyme catalysis method.

[0086] In the present invention, the homogeneous enzyme solution is an enzyme solution obtained by resuspending wet bacterial cells with a resuspension solution and subjecting them to cell disruption, without heating and / or heat treatment; the wet bacterial cells are precipitates obtained by solid-liquid separation (i.e., centrifuging and discarding the supernatant, taking the precipitate) of the culture solution of the prokaryotic cell (such as Escherichia coli BL21(DE3) cell).

[0087] In the present invention, cell disruption can be carried out by any conventional method in the art, and the methods for cell disruption include but are not limited to: high-pressure disruption, ultrasonic disruption, osmotic shock disruption, repeated freezing and thawing, lysozyme treatment or cell lysate treatment.

[0088] In the present invention, the crude enzyme solution is an enzyme solution obtained by removing impurities from the homogeneous enzyme solution (i.e., centrifuging and taking the supernatant, discarding the precipitate).

[0089] In the present invention, the solid enzyme powder is a powder obtained by freeze-drying the crude enzyme solution.

[0090] The amino acid abbreviations in the present invention are all conventional in the art unless otherwise specified, and the amino acids corresponding to the specific abbreviations are shown in Table 2.

[0091] Table 2

[0092]

[0093] On the basis of not violating the common knowledge in the art, the above preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0094] The reagents and raw materials used in the present invention are all commercially available.

[0095] The positive and progressive effects of the present invention are as follows: The L-proline hydroxylase or its mutant used in the present invention can catalyze the hydroxylation of a substrate to prepare an enantiopure hydroxylated product. In order to further realize the industrial application of this enzyme in this reaction, the present invention performs engineering modification on this enzyme to provide an enzyme with enhanced catalytic activity. When preparing (2S,5R)-trans-5-hydroxy-pipecolic acid, the conversion rate can reach 21%-99.8%; at the same time, it can also be applied to the hydroxylation of other substrates and has a good conversion rate. Detailed implementation manners

[0096] The present invention will be further described below by way of examples, but the present invention is not limited to the scope of the described examples. For the experimental methods without specific conditions in the following examples, they are carried out according to conventional methods and conditions, or selected according to the product instructions. The methods, materials and reagents used in the examples are conventional methods in the art and materials and reagents that can be obtained through commercial channels unless otherwise specified.

[0097] The wild-type L-proline hydroxylase is from Dactylosporangium sp. RH1.

[0098] BL21(DE3) cells were purchased from Lucigen.

[0099] Lysozyme was purchased from Beyotime. The nuclease is a conventional nuclease in the art.

[0100] The L-proline hydroxylase or its mutant used in the present invention can also be prepared by conventional polypeptide synthesis methods in the art.

[0101] The catalytic results of the enzyme mutants provided in this paper for substrate II were analyzed by derivatized UPCC. The specific operation steps are as follows: In a 96-well deep-well plate, 20 μL of the reaction solution was mixed with 200 μL of 0.75 M boric acid solution (pH = 7.5), and then diluted with 400 μL of FMOC-Cl-acetone solution (containing 2 mg / mL FMOC-Cl in acetone). The 96-well deep-well plate was sealed, centrifuged, and placed in an incubator at 28 - 32 °C, shaken at 1000 rpm for 20 min. When the FMOC-Cl derivatization was completed, 1 mL of methanol was added to the reaction solution. The plate was centrifuged at 4000 rpm for 20 min. 250 μL of the supernatant was transferred into a shallow-well plate for UPCC analysis. The quenched reaction was subjected to UPCC analysis under the following conditions. The conversion rate of compound II (L-pipecolic acid) to compound I ((2S,5R)-trans-5-hydroxypipecolic acid) was determined from the resulting chromatogram as follows:

[0102]

[0103] This method was used to quickly identify the conversion rate of L-pipecolic acid to (2S,5R)-trans-5-hydroxypipecolic acid. The specific reaction formula is shown as follows.

[0104]

[0105] By comparing with the standard of (2S,5R)-trans-5-hydroxypipecolic acid, the (2S,5R)-trans-5-hydroxypipecolic acid obtained in this application had the same retention time as the standard. The retention time t of (2S,5R)-trans-5-hydroxypipecolic acid was 2.0 min.

[0106] Upon analysis, compounds I-2, I-3, I-4, and I-5 had the same retention time as their respective standards. The retention time of compound I-2 was 2.4 min; the retention time of compound I-3 was 1.4 min; the retention time of compound I-4 was 1.7 min; the retention time of compound I-5 was 2.1 min.

[0107] The UPCC analysis conditions for compounds I-1, I-2, I-3, and I-4 were as follows: chromatographic column, Chiralpak ID-3, 150 mm * 4.6 mm, 3 μm; mobile phase A was CO2, mobile phase B was a methanol solution of 0.1% TFA, and the ratio of A to B was 4:1; isocratic elution, detection wavelength 260 nm; column temperature 35 °C, flow rate 3 ml / min, injection volume 1 μL; running time was 3 min.

[0108] The UPCC analysis conditions for Compound I-5 are as follows: chromatographic column, Chiralpak OX-3, 150 mm * 4.6 mm, 3 μm; mobile phase A is CO2, mobile phase B is a methanol solution of 0.1% MIPA, and the ratio of A to B is 69:31; isocratic elution, detection wavelength 260 nm; column temperature 35 °C, flow rate 3 ml / min, injection volume 1 μL; running time is 3 min.

[0109] The method for mutant expression and screening in this application can be described as follows.

[0110] Using the sequence of SEQ ID NO:1 (the coding sequence is as shown in SEQ ID NO:5) as the parent, strategies such as rolling circle PCR, iterative saturation mutagenesis, and combinatorial mutagenesis were used to perform directed evolution on it. Then the mutants were transformed into Escherichia coli BL21(DE3) competent cells and evenly spread on an LB agar plate containing 50 μg / mL kanamycin, and placed in an incubator at 37 °C for 18 h. The mutants on the transformed plate were picked with toothpicks into a 96-well plate and cultured overnight in a shaker at 37 °C and 220 rpm. 50 μL of the bacterial liquid was pipetted from the wells of the primary plate into the corresponding wells of the secondary plate. After culturing at 37 °C and 220 rpm for 2 - 3 h, IPTG with a final concentration of 0.1 mM was added, and the culture was continued at 30 °C for 20 h to obtain the corresponding mutants for high-throughput screening. Combining the UPCC and derivatization detection methods, mutants with significantly improved activity and stability were identified and their gene sequencing was performed. The sequencing results of mutants with better activity are as shown in SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4, and their coding sequences are as shown in SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8.

[0111] SEQ ID NO:1, wild-type L-proline hydroxylase

[0112] MLTPTELKQYREAGYLLIEDGLGPREVDCLRRAAAALYAQDSPDRTLEKDGRTVRAVHGCHRRDPVCRDLVRHPRLLGPAMQILSGDVYVHQFKINAKAPMTGDVWPWHQDYIFWAREDGMDRPHVVNVAVLLDEATHLNGPLLFVPGTHELGLIDVERRAPAGDGDAQWLPQLSADLDYAIDADLLARLTAGRGIESATGPAGSILLFDSRIVHGSGTNMSPHPRGVVLVTYNRTDNALPAQAAPRPEFLAARDATPLVPLPAGFTLAHYV

[0113] SEQ ID NO:2, L-proline hydroxylase mutant

[0114] MLTPTELKQYREAGYLLIEDGLGPREVDCLRRAAAALYAQDSPDRTLEKDGRTVRAVHGCHRRDPVCRDLVRHPRLLGPAMQILSGDVYVHQFKINAKAPMTGDVWPWHQDYIFWAREDGMDRPHVVNVAVLLDEATHLNGPLLFVPGTHELGLIDVERRAPAGDGDAQWLPNLSADLDYEIDADLLARLTAGRGIESATGPAGSILLFDSRIVHGSGTNMSPHPRGQVLVTYNRTDNALPAQAAPRPEFLAARDATPLVPLPAGFTLAHYV

[0115] SEQ ID NO:3, L-proline hydroxylase mutant

[0116] MLTPTELKQYREAGYLLIEDGLGPREVDCLRRAAAALYAQDSPDRTLEKDGRTVRAVHGCHRRDPVCRDLVRHPRLLGPAMQILSGDVYVHQFKINAKAPMTGDVWPWHQDYIFWAREDGMDRPHVVNVAVLLDEATHLNGPLLFVPGTHELGLIDVERRAPAGDGDAQWSPNLSADLDYEIDADLLARLTAGRGIESATGPAGSILLFDSRIVHGSGTNMSPHPRGQVLVTYNRTDNALPAQAAPRPEFLAARDATPLVPLPAGFTLAHYV

[0117] SEQ ID NO:4, L-proline hydroxylase mutant

[0118] MLTPTELKQYREAGYLLIEDGLGPREVDCLRRAAAALYAQDSPDRTLEKDGRTVRAVHGCHRRDPVCRDLVRHPRLLGPAMQILSGDVYVHQFKINAKAPMTGDVWPWHQDYIFWHREDGMDRPHVVNVAVLLDEATHQNGPLLFVPGSHELGLIDVERRAPAGDGDAQWLPNLSADLDYEIDHDLLARLTAGRGIESATGPAGSILLFDSRIVHGSGTNMSPHPRGQVLVTYNRTDNALPAQAAPRPEFLAARDATPLVPLPAGFTLAHYV

[0119] SEQ ID NO:5, Coding sequence of wild-type L-proline hydroxylase

[0120] ATGCTGACCCCGACCGAACTGAAACAGTATCGTGAAGCGGGCTATCTGCTGATTGAAGATGGCCTGGGCCCGCGTGAAGTTGACTGCCTGCGTCGTGCTGCTGCTGCTCTGTACGCTCAGGACTCTCCGGACCGTACCCTGGAAAAAGACGGTCGTACCGTTCGTGCTGTTCACGGTTGCCACCGTCGTGACCCGGTTTGCCGTGACCTGGTTCGTCACCCACGTCTGCTGGGTCCGGCTATGCAGATCCTGTCTGGTGACGTTTACGTTCACCAGTTCAAAATCAACGCTAAAGCTCCGATGACCGGTGACGTTTGGCCGTGGCACCAGGACTACATCTTCTGGGCTCGTGAAGACGGTATGGACCGTCCGCACGTTGTTAACGTTGCTGTTCTGCTGGACGAAGCTACCCACCTGAACGGTCCGCTGCTGTTCGTTCCGGGTACCCACGAACTGGGTCTGATCGACGTTGAACGTCGTGCTCCGGCTGGTGACGGTGACGCTCAGTGGCTGCCGCAGCTGTCTGCTGACCTGGACTACGCTATCGACGCTGACCTGCTGGCTCGTCTGACCGCTGGTCGTGGTATCGAATCTGCTACCGGTCCGGCTGGTTCTATCCTGCTGTTCGACTCTCGTATCGTTCACGGTTCTGGTACCAACATGTCTCCGCACCCGCGTGGTGTTGTTCTGGTTACCTACAACCGTACCGACAACGCTCTGCCGGCTCAGGCTGCTCCGCGTCCGGAATTTCTGGCTGCTCGTGACGCTACCCCGCTGGTTCCGCTGCCGGCTGGTTTCACTCTGGCTCACTACGTTTAAT

[0121] SEQ ID NO:6, Coding sequence of L-proline hydroxylase mutant

[0122] ATGCTGACCCCGACCGAACTGAAACAGTATCGTGAAGCGGGCTATCTGCTGATTGAAGATGGCCTGGGCCCGCGTGAAGTTGACTGCCTGCGTCGTGCTGCTGCTGCTCTGTACGCTCAGGACTCTCCGGACCGTACCCTGGAAAAAGACGGTCGTACCGTTCGTGCTGTTCACGGTTGCCACCGTCGTGACCCGGTTTGCCGTGACCTGGTTCGTCACCCACGTCTGCTGGGTCCGGCTATGCAGATCCTGTCTGGTGACGTTTACGTTCACCAGTTCAAAATCAACGCTAAAGCTCCGCTGACCGGTGACGTTTGGCCGTGGCACCAGGACTACATCTTCTGGGCTCGTGAAGACGGTATGGACCGTCCGCACGTTGTTAACGTTGCTGTTCTGCTGGACGAAGCTACCCACCAGAACGGTCCGCTGCTGTTCGTTCCGGGTACCCACGAACTGGGTCTGATCGACGTTGAACGTCGTGCTCCGGCTTATGACGGTGACGCTCAGTGGCTGCCGAACCTGTCTGCTGACCTGGACTACGAAATCGACGCTGACCTGCTGGCTCGTCTGACCGCTGGTCGTGGTATCGAATCTGCTACCGGTCCGGCTGGTTCTATCCTGCTGTTCGACTCTCGTATCGTTCACGGTTCTGGTACCAACATGTCTCCGCACCCGCGTGGTCAGGTTCTGGTTACCTACAACCGTACCGACAACGCTCTGCCGGCTCAGGCTGCTCCGCGTCCGGAATTTCTGGCTGCTCGTGACGCTACCCCGCTGGTTCCGCTGCCGGCTGGTTTCACTCTGGCTCACTACGTTTAAT

[0123] SEQ ID NO:7, Coding sequence of L-proline hydroxylase mutant

[0124] ATGCTGACCCCGACCGAACTGAAACAGTATCGTGAAGCGGGCTATCTGCTGATTGAAGATGGCCTGGGCCCGCGTGAAGTTGACTGCCTGCGTCGTGCTGCTGCTGCTCTGTACGCTCAGGACTCTCCGGACCGTACCCTGGAAAAAGACGGTCGTACCGTTCGTGCTGTTCACGGTTGCCACCGTCGTGACCCGGTTTGCCGTGACCTGGTTCGTCACCCACGTCTGCTGGGTCCGGCTATGCAGATCCTGTCTGGTGACGTTTACGTTCACCAGTTCAAAATCAACGCTAAAGCTCCGCTGACCGGTGACGTTTGGCCGTGGCACCAGGACTACATCTTCTGGGCTCGTGAAGACGGTATGGACCGTCCGCACGTTGTTAACGTTGCTGTTCTGCTGGACGAAGCTACCCACCAGAACGGTCCGCTGCTGTTCGTTCCGGGTACCCACGAACTGGGTCTGATCGACGTTGAACGTCGTGCTCCGGCTTATGACGGTGACGCTCAGTGGAGCCCGAACCTGTCTGCTGACCTGGACTACGAAATCGACGCTGACCTGCTGGCTCGTCTGACCGCTGGTCGTGGTATCGAATCTGCTACCGGTCCGGCTGGTTCTATCCTGCTGTTCGACTCTCGTATCGTTCACGGTTCTGGTACCAACATGTCTCCGCACCCGCGTGGTCAGGTTCTGGTTACCTACAACCGTACCGACAACGCTCTGCCGGCTCAGGCTGCTCCGCGTCCGGAATTTCTGGCTGCTCGTGACGCTACCCCGCTGGTTCCGCTGCCGGCTGGTTTCACTCTGGCTCACTACGTTTAAT

[0125] SEQ ID NO:8, Coding sequence of L-proline hydroxylase mutant

[0126] ATGCTGACCCCGACCGAACTGAAACAGTATCGTGAAGCGGGCTATCTGCTGATTGAAGATGGCCTGGGCCCGCGTGAAGTTGACTGCCTGCGTCGTGCTGCTGCTGCTCTGTACGCTCAGGACTCTCCGGACCGTACCCTGGAAAAAGACGGTCGTACCGTTCGTGCTGTTCACGGTTGCCACCGTCGTGACCCGGTTTGCCGTGACCTGGTTCGTCACCCACGTCTGCTGGGTCCGGCTATGCAGATCCTGTCTGGTGACGTTTACGTTCACCAGTTCAAAATCAACGCTAAAGCTCCGCTGACCGGTGACGTTTGGCCGTGGCACCAGGACTACATCTTCTGGCATCGTGAAGACGGTATGGACCGTCCGCACGTTGTTAACGTTGCTGTTCTGCTGGACGAAGCTACCCACCAGAACGGTCCGCTGCTGTTCGTTCCGGGTAGCCACGAACTGGGTCTGATCGACGTTGAACGTCGTGCTCCGGCTTATGACGGTGACGCTCAGTGGCTGCCGAACCTGTCTGCTGACCTGGACTACGAAATCGACCAGGACCTGCTGGCTCGTCTGACCGCTGGTCGTGGTATCGAATCTGCTACCGGTCCGGCTGGTTCTATCCTGCTGTTCGACTCTCGTATCGTTCACGGTTCTGGTACCAACATGTCTCCGCACCCGCGTGGTCAGGTTCTGGTTACCTACAACCGTACCGACAACGCTCTGCCGGCTCAGGCTGCTCCGCGTCCGGAATTTCTGGCTGCTCGTGACGCTACCCCGCTGGTTCCGCTGCCGGCTGGTTTCACTCTGGCTCACTACGTTTAAT。

[0127] Example 1: Expression and screening of engineered L-proline hydroxylase

[0128] The polynucleotide sequence SEQ ID NO:5 was cloned into the pET-30a vector system and subsequently expressed in the Escherichia coli BL21(DE3) strain. The Escherichia coli BL21(DE3) strain expresses the L-proline hydroxylase polypeptide under the control of the T7 promoter. Based on sequence comparison with other proline hydroxylases and computer simulation and active site analysis of the enzyme structure docked with the substrate L-pipecolic acid, the positions of amino acid residues potentially related to activity or selectivity were identified and mutagenesis sites were rationally designed.

[0129] The first-round beneficial mutants of these enzymes were screened using L-pipecolic acid as the substrate under UPCC assay conditions. Beneficial mutants with increased activity or selectivity were identified. The beneficial mutant residues from the first-round screening were constructed into combinatorial mutants in various arrangements and screened for improved catalytic properties under UPCC assay conditions. The engineered L-proline hydroxylase polypeptide sequences obtained therefrom, specific mutations, and their catalytic efficiencies were determined.

[0130] Example 2:

[0131] For the production of the engineered L-proline hydroxylase as indicated above, the engineered L-proline hydroxylase polypeptide of Example 1 was produced in Escherichia coli BL21(DE3) under the control of the T7 promoter. For the preparation of the crude enzyme solution, the crude enzyme solution was prepared as follows.

[0132] 1. Preparation of buffer

[0133] Measure 1000 mL of purified water, add 13.921 g of dipotassium hydrogen phosphate trihydrate and 5.308 g of potassium dihydrogen phosphate, and stir until completely dissolved. Control the pH at 7.0 - 7.2, keep the temperature at 20 - 30 °C, stir until the solid is completely dissolved, and name this buffer K701.

[0134] 2. Cultivation, induction of expression, and preparation of crude enzyme solution product

[0135] Pick Escherichia coli BL21(DE3) cells containing the target gene of L-proline hydroxylase and culture them overnight in LB liquid medium containing 10 mg / L glucose and 50 mg / L kanamycin (kana) at 37 °C, 250 rpm, and 85% humidity. Then transfer 10 μL of the overnight-grown bacterial solution to a deep-well plate containing 390 μL of 3×TB growth medium with 50 mg / L kanamycin, and culture at 37 °C and 450 rpm for 2 - 3 h (OD600 = 0.6 - 1.0). Add IPTG to a final concentration of 0.1 mM and incubate at 25 °C, 450 rpm for 20 h for the induced expression of the enzyme protein. Centrifuge the cell culture at 4000 rpm and 4 °C for 12 min, and discard the culture medium. After freezing the cell pellet in an -80 °C refrigerator for 2 h, suspend the cell pellet with a wet cell mass of approximately 20 mg in 270 μL of lysis buffer K701 (2 mg / mL lysozyme and 1 mg / mL nuclease). Lyse at 37 °C for 2 h. Centrifuge at 4000 rpm for 15 min and take the supernatant to prepare the crude enzyme solution.

[0136] 3. Production of downstream process powder (DSP)

[0137] The cell lysate provided by the DSP powder is a more purified engineered L-proline hydroxylase product. The large-scale fermentation (2 L bacterial solution) of the engineered proline hydroxylase for the production of DSP powder can be carried out as a short batch followed by a fed-batch method according to standard bioprocessing methods. Briefly, the expression of L-proline hydroxylase is induced by adding IPTG (isopropyl-β-D-thiogalactoside) to a final concentration of 0.1 mM. After expression by fermentation, the bacterial cells are enriched and resuspended in 0.05 mM (pH = 7.0) phosphate buffer, and then the bacterial cells are disrupted mechanically by sonication. The suspension is clarified by centrifugation at 12000 rpm for 30 min. Pour the supernatant solution into a plate, pre-freeze it in an -80 °C refrigerator for 2 h, and then dry and package the enzyme concentrate in a freeze dryer to prepare 2 - 3 g of freeze-dried powder.

[0138] Example 3:

[0139] Method for converting compound II (L-pipecolic acid) to compound I ((2S,5R)-trans-5-hydroxy-pipecolic acid) using the crude enzyme solution product of L-proline hydroxylase.

[0140] In this example, different combinatorial mutants were constructed using WT as a template, and their catalytic activities were detected. A method for converting compound II into compound I using the crude enzyme solution prepared in Example 2 was described. The prepared crude enzyme solution was used in a 250 μL-scale reaction. The reaction system included: 8 g / L α-ketoglutaric acid, 0.8 g / L ascorbic acid, K701 buffer, 4 g / L substrate compound II, 0.4 g / L (NH4)2Fe(SO4)2, and 100 μL crude enzyme solution.

[0141] The specific steps were as follows: 200 mg of α-ketoglutaric acid and 20 mg of ascorbic acid were added to 15 mL of K701 buffer. After mixing, the pH was adjusted to 7.0 with 10 M NaOH. 100 mg of L-pipecolic acid and 10 mg of (NH4)2Fe(SO4)2 were added to the resulting solution to obtain a reddish-brown solution. 150 μL of the mixed reddish-brown solution and 100 μL of the crude enzyme solution (wet cell mass approximately 7.4 mg) were equally divided and added to a 96-well deep plate. The reaction was carried out at 30 °C for 18 h. After the reaction ended, 20 μL of the reaction mixture was equally divided into a 96-well deep plate containing 200 μL / well of 0.75 M boric acid (pH 7.5). 400 μL of 8 mg / mL FMOC-Cl-acetone was added to each well. The plate was sealed and shaken at 1000 rpm at 30 °C for 20 min, and then 1 mL of methanol was added. The plate was centrifuged at 4000 rpm for 20 min. 250 μL of the supernatant was transferred to a 96-well shallow plate for UPCC analysis.

[0142] As detected by UPCC, the conversion rates of each mutant are shown in Table 3, and the optimal mutant conversion rate was 66.9%.

[0143] Table 3: Mutant sequence information and catalytic results for Example 4

[0144]

[0145] Example 4:

[0146] A method for converting II (L-pipecolic acid) to compound I ((2S,5R)-trans-5-hydroxypipecolic acid) using a crude enzyme solution preparation of L-proline hydroxylase.

[0147] In this example, different combinatorial mutants were constructed using Q173N / A181E / V228Q as a template, and their catalytic activities were detected. A method for converting compound II into compound I using the crude enzyme solution prepared in Example 2 was described. The prepared crude enzyme solution was used in a 250 μL-scale reaction. The reaction system included: 20 g / L α-ketoglutaric acid, 2 g / L ascorbic acid, K701 buffer, 10 g / L substrate compound II, 1 g / L (NH4)2Fe(SO4)2, and 100 μL crude enzyme solution.

[0148] The specific steps are as follows: Add 500 mg of α-ketoglutaric acid and 50 mg of ascorbic acid to 15 mL of K701 buffer. After mixing, adjust the pH to 7.0 with 10 M NaOH. Add 250 mg of L-pipecolic acid and 25 mg of (NH4)2Fe(SO4)2 to the resulting solution to obtain a reddish-brown solution. Aliquot 150 μL of the mixed reddish-brown solution and 100 μL of the crude enzyme solution into a 96-well deep well plate. Place the reaction at 30 °C for 18 h. After the reaction is completed, aliquot 20 μL of the reaction mixture into a 96-well deep well plate containing 200 μL / well of 0.75 M boric acid (pH 7.5). Add 400 μL of 8 mg / mL FMOC-Cl-acetone to each well, seal the plate, shake at 1000 rpm at 30 °C for 20 min, and add 1 mL of methanol. Centrifuge the plate at 4000 rpm for 20 min. Transfer 250 μL of the supernatant to a 96-well shallow well plate for UPCC analysis.

[0149] As detected by UPCC, the conversion rates of each mutant are shown in Table 4, and the optimal mutant conversion rate is 47.2%.

[0150] Table 4: Mutant sequence information and catalytic results for Example 5

[0151]

[0152]

[0153] Example 5

[0154] A method for converting compound II (L-pipecolic acid) to compound I ((2S,5R)-trans-5-hydroxy-pipecolic acid) using a crude enzyme solution preparation of L-proline hydroxylase.

[0155] In this example, different combinations of mutants were constructed using Q173N / A181E / V228Q as a template, and their catalytic activities were detected. A method for converting compound II to compound I using the crude enzyme solution prepared in Example 2 was described. The prepared crude enzyme solution was used in a 250 μL-scale reaction. The reaction system included: 20 g / L α-ketoglutaric acid, 2 g / L ascorbic acid, K701 buffer, 3.6 g / L of substrate compound II or 4 g / L of substrate compound II, 1 g / L of (NH4)2Fe(SO4)2, 50 μL of crude enzyme solution or 70 μL of crude enzyme solution.

[0156] The specific steps are as follows: Add 500 mg of α-ketoglutaric acid and 50 mg of ascorbic acid to 20 mL of K701 buffer. After mixing evenly, adjust the pH to 7.0 with 10 M NaOH. Add 100 mg / L of L-pipecolic acid and 25 mg of (NH4)2Fe(SO4)2 to the resulting solution to obtain a reddish-brown solution. Aliquot 200 μL of the evenly mixed reddish-brown solution and 50 μL (wet cell mass is about 3.7 mg) of crude enzyme solution into a 96-well deep plate, or aliquot 180 μL of the evenly mixed reddish-brown solution and 70 μL (wet cell mass is about 5.2 mg) of crude enzyme solution into a 96-well deep plate. Place the reaction at 30 °C for 18 h. After the reaction is completed, aliquot 20 μL of the reaction mixture into a 96-well deep plate containing 200 μL / well of 0.75 M boric acid (pH 7.5). Add 400 μL of 8 mg / mL FMOC-Cl-acetone to each well, seal the plate, shake at 1000 rpm at 30 °C for 20 min, and then add 1 mL of methanol. Centrifuge the plate at 4000 rpm for 20 min. Transfer 250 μL of the supernatant to a 96-well shallow plate for UPCC analysis.

[0157] After detection by UPCC, the conversion rates of each mutant are shown in Table 5 or Table 6, and the optimal mutant conversion rate is 99.8%.

[0158] Table 5: Mutant sequence information and catalytic results for Example 5 when the crude enzyme solution is 50 μL

[0159]

[0160]

[0161] Table 6: Mutant sequence information and catalytic results for Example 5 when the crude enzyme solution is 70 μL

[0162]

[0163] Example 6:

[0164] A method for converting compound II (L-pipecolic acid) to compound I ((2S,5R)-trans-5-hydroxy-pipecolic acid) using a downstream process powder (DSP) product

[0165] In this example, a method for converting compound II to compound I using a freeze-dried enzyme powder DSP product of L-proline hydroxylase is described. The prepared freeze-dried enzyme powder of L-proline hydroxylase is used in a 4 mL-scale reaction. The reaction system includes: 40 g / L of α-ketoglutaric acid, 4 g / L of ascorbic acid, K701 buffer, 20 g / L of substrate compound II, 2 g / L of (NH4)2Fe(SO4)2, and 6 g / L of protein of the DSP enzyme powder product.

[0166] The specific steps are to add 800mg α-ketoglutaric acid and 80mg ascorbic acid to 15mL K701 buffer, mix well and adjust the pH to 7.0 with 10M NaOH. Add 400mg L-piperidinic acid and 40mg (NH4)2Fe(SO4)2 to the resulting solution to obtain a reddish-brown solution. Add 24mg protein of DSP enzyme powder product to 1mL K701 buffer. Add 3mL of mixed reddish-brown solution and 1mL DSP enzyme solution to a 50mL reaction bottle in equal parts, place the reaction at 30℃, and react for 18h. After the reaction is completed, add 4mL 0.75M boric acid (pH 7.5) to the reaction system, mix well, take 40μL of the mixed solution and place it in a 2mL EP tube, and add 180μL 0.75M boric acid (pH7.5). Add 400 μL of 8 mg / mL FMOC-Cl-acetone to the EP tube, shake on a decolorizing shaker at 20-30°C for 20 min, add 1 mL of methanol, centrifuge at 12000 rpm for 5 min, and transfer 250 μL of the supernatant to a liquid phase bottle for UPCC analysis.

[0167] According to UPCC detection, the conversion rate of the mutant with the best activity (mutant 5 in Example 6) was 52.1%.

[0168] Example 7

[0169] In this example, the ability of a crude enzyme liquid preparation of L-proline hydroxylase to catalyze substrates other than pipecolic acid was examined.

[0170] The crude enzyme solution of the mutant with the sequence shown in SEQ ID NO: 4 was put into 250 μL scale reaction. The reaction system included: 20 g / L α-ketoglutarate, 2 g / L ascorbic acid, K701 buffer, 10 g / L substrate compound II or 4 g / L substrate compound II, 1 g / L (NH4)2Fe(SO4)2, and 70 μL crude enzyme solution.

[0171] The specific steps are to add 500 mg of α-ketoglutaric acid and 50 mg of ascorbic acid to 20 mL of K701 buffer, mix well and adjust the pH to 7.0 with 10 M NaOH. Add 100 mg of substrate compound II and 25 mg of (NH4)2Fe(SO4)2 to the resulting solution to obtain a reddish-brown solution. Add 180 μL of the mixed reddish-brown solution and 70 μL (about 5.2 mg of wet bacteria) of crude enzyme solution to a 96-well plate, place the reaction at 30 ° C, and react for 18 hours. The negative control uses an enzyme product obtained by transformation with an expression vector without a proline hydroxylase gene. The specific transformation effect is shown in Table 7.

[0172] Table 7

[0173]

[0174]

Claims

1. An L-proline hydroxylase mutant, characterized in that, The L-proline hydroxylase mutant has amino acid residue differences at one or more of the following sites selected from the amino acid sequence shown in SEQ ID NO: 1: positions 68, 85, 86, 101, 108, 116, 139, 149, 152, 165, 171, 172, 173, 176, 181, 184, and 228.

2. The L-proline hydroxylase mutant according to claim 1, wherein The mutant has the amino acid residue at position 68 of the amino acid sequence shown in SEQ ID NO: 1 replaced by H or Q; preferably H; and / or, the amino acid residue at position 85 is replaced by E or Q; preferably Q; and / or, the amino acid residue at position 86 is replaced by N or H; and / or, the amino acid residue at position 101 is replaced by L; and / or, the amino acid residue at position 108 is replaced by C, S or T; preferably S; and / or, the amino acid residue at position 116 is replaced by E, H or N; preferably H; and / or, the amino acid residue at position 139 is replaced by C or Q; and / or, the amino acid residue at position 149 is replaced by S; and / or, the amino acid residue at position 152 is replaced by K or R; preferably K; and / or, the amino acid residue at position 165 is replaced by A, G or V; and / or, the amino acid residue at position 171 is replaced by E, F, S or V; preferably S; and / or, the amino acid residue at position 172 is replaced by D or Q; preferably Q; and / or, the amino acid residue at position 173 is replaced by N, G, L or V; and / or, the amino acid residue at position 176 is replaced by C, S or T; and / or, the amino acid residue at position 181 is replaced by D, E or S; and / or, the amino acid residue at position 184 is replaced by H or K; preferably H; and / or, the amino acid residue at position 228 is replaced by Q, S or T.

3. The L-proline hydroxylase mutant according to claim 1, wherein The L-proline hydroxylase mutant satisfies one or more of the following conditions: (1) The said difference is a deletion, addition or substitution, preferably a substitution; (2) The L-proline hydroxylase mutant has amino acid residue differences at least at one of the following sites selected from the amino acid sequence shown in SEQ ID NO: 1: positions 173, 181 and 228; Preferably, it has an amino acid residue difference at position 173, has an amino acid residue difference at position 181, has an amino acid residue difference at position 228, has amino acid residue differences at positions 173 and 181, has amino acid residue differences at positions 181 and 228, or has amino acid residue differences at least at positions 173, 181 and 228; Preferably, the L-proline hydroxylase mutant has amino acid residue differences at positions 173, 181 and 228 of the amino acid sequence shown in SEQ ID NO: 1, and also has amino acid residue differences at one or more of the following sites selected from: positions 68, 85, 86, 101, 108, 116, 139, 149, 152, 165, 171, 172, 176 and 184; Preferably, the L-proline hydroxylase mutant satisfies the following Scheme 1 or Scheme 2: Scheme 1: The L-proline hydroxylase mutant has differences in amino acid residues at positions 173, 181, and 228 in the amino acid sequence shown in SEQ ID NO: 1, and has differences in amino acid residues at one of the following sites: position 68, position 85, position 86, position 108, position 116, position 139, position 152, position 165, position 171, position 172, position 176, or position 184; preferably, it has differences in amino acid residues at one of the following sites: position 85, position 86, position 139, position 152, position 171, position 172, or position 184; Scheme 2: The L-proline hydroxylase mutant has differences in amino acid residues at positions 173, 181, and 228 in the amino acid sequence shown in SEQ ID NO: 1, and has differences in amino acid residues at 3, 4, 5, 6, or 7 of the following sites: position 68, position 85, position 101, position 116, position 139, position 149, position 171, position 172, and position 184.

4. The L-proline hydroxylase mutant according to claim 3, wherein The differences of the L-proline hydroxylase mutant in the amino acid sequence shown in SEQ ID NO: 1 are as follows:

5. A method for preparing compound I-1, characterized in that, It includes the following steps: In a solvent, in the presence of an enzyme, an enzyme cofactor, and oxygen, compound II-1 is subjected to the hydroxylation reaction shown in the following formula to obtain compound I-1. The enzyme is an L-proline hydroxylase having the amino acid sequence shown in SEQ ID NO: 1 or an L-proline hydroxylase mutant having differences in amino acid residues at one or more of the following sites in the amino acid sequence shown in SEQ ID NO: 1: position 68, position 85, position 86, position 101, position 108, position 116, position 139, position 149, position 152, position 165, position 171, position 172, position 173, position 176, position 181, position 184, and position 228; The L-proline hydroxylase mutant can also be as described in any one of claims 2-4; Preferably, the preparation method of compound I-1 satisfies one or more of the following conditions: (1) The solvent is a buffer solution, such as a phosphate buffer solution, such as a potassium phosphate buffer solution, such as a dipotassium hydrogen phosphate - potassium dihydrogen phosphate buffer solution. The concentration of dipotassium hydrogen phosphate can be 0.06 mol / L, and the concentration of potassium dihydrogen phosphate can be 0.04 mol / L; (2) The pH of the solvent is 6.0 - 8.0, such as 6.5 - 7.5, such as 7.0 - 7.2, and more preferably 7.0; (3) The mass-volume ratio of compound II-1 to the solvent is (1 - 50) g / L, such as (1 - 25) g / L, such as 3.6 g / L, 4 g / L, 10 g / L, or 20 g / L; (4) The cofactors described above are α-ketoglutaric acid, ascorbic acid, and Fe 2+ ; preferably, the Fe 2+ is provided by (NH4)2Fe(SO4)2; Preferably, the molar ratio of the α-ketoglutaric acid to the compound II-1 is (1-5):1, such as 1.8:1, 3.4:1, 3.9:1 or 4.4:1; Preferably, the molar ratio of the ascorbic acid to the compound II-1 is (0.01-0.5):1, such as 0.015:1, 0.15:1, 0.29:1, 0.33:1 or 0.37:1; Preferably, the molar ratio of said Fe 2+ to said Compound II-1 is (0.01 - 0.5):1, such as 0.05:1, 0.09:1 or 0.1:1; (5) The enzyme exists alone or in combination in the form of whole-cell enzyme, homogenized enzyme solution, crude enzyme solution or solid enzyme powder; preferably, the enzyme exists in the form of homogenized enzyme solution, and the mass of the wet cells added for preparing the homogenized enzyme solution and the volume of the resuspension added are in a ratio of 1 g:(10-20) mL, such as 1 g:13.5 mL; the resuspension can be water, buffer or medium, the buffer can be phosphate buffer, such as potassium phosphate buffer, or potassium hydrogen phosphate-potassium dihydrogen phosphate buffer, the concentration of potassium hydrogen phosphate can be 0.06 mol / L, and the concentration of potassium dihydrogen phosphate can be 0.04 mol / L; preferably, the resuspension further includes lysozyme and nuclease, and the mass-volume ratio of the lysozyme to the buffer is 2 mg:1 mL; the mass-volume ratio of the nuclease to the buffer is 2 mg:1 mL; (6) The temperature of the hydroxylation reaction is 20°C to 40°C, such as 28°C to 32°C, or 30°C; Preferably, the preparation method of the compound I-1 satisfies one or more of the following conditions: (1) The reaction system of the hydroxylation reaction consists of the following: a solvent, Compound II-1, oxygen, an enzyme, α-ketoglutaric acid, ascorbic acid, and Fe 2+ and; (2) In the hydroxylation reaction, the enzyme is Scheme 1 or Scheme 2. Scheme 1: The enzyme is a crude enzyme solution, and the addition amount of the enzyme is calculated according to the mass of the wet cells added for preparing the crude enzyme solution as follows: the mass ratio of the wet cells capable of producing the enzyme to the compound II-1 is (1-15):1, such as (2-10):1, or 3:1, 3.7:1, 5.8:1 or 7.4:1; Scheme 2: The enzyme is a solid enzyme powder, and the mass ratio of the solid enzyme powder to the compound II-1 is (0.01-0.5):1, such as (0.05-0.1):1, or 0.3:1; Preferably, the hydroxylation reaction includes the following steps: (1) Mix the solvent, α-ketoglutaric acid and ascorbic acid to obtain a mixed solution; (2) Mix the mixture obtained in step (1), the compound II-1, and Fe 2+ to obtain a mixed solution; (3) In the presence of oxygen and the enzyme, carry out a hydroxylation reaction on the mixed solution obtained in step (2) to obtain the compound I-1; In the said step (2), the mixed solution in step (1) can be adjusted to a pH of 7.0 - 7.2 and then mixed with the compound II-1 and Fe 2+ Preferably, the reagent for adjusting the pH is a hydroxide of an alkali metal, such as sodium hydroxide, and more preferably a 10M aqueous sodium hydroxide solution.

6. A method for preparing Compound I, characterized in that, It includes the following steps. In a solvent, in the presence of an enzyme, an enzyme cofactor and oxygen, carry out the following hydroxylation reaction on the compound II to obtain the compound I. wherein, X is a linking group, CH or CHR 3 ; represents a single bond or a double bond; R 1 is hydroxy, amino, C 1-6 alkoxy, (C 6-10 aryl)O-, (C 6-10 aryl)S- or C 1-6 alkyl substituted by one or more SH; R 2 is hydrogen, optionally substituted C 1-6 alkyl, C 2-6 alkenyl or C 2-6 alkynyl; R 3 is hydrogen or a hydroxyl group; R 4 is a hydroxyl group; or R 3 , R 4 together with the carbon atom to which it is attached forms a In the preparation method of the compound I, the definitions of the solvent, the enzyme and the enzyme cofactor can be as described in claim 5; the operations and conditions in the preparation method of the compound I can also be as described in claim 5; Preferably, the preparation method of the compound I satisfies one or more of the following conditions: (1)R 1 is a hydroxyl group; (2)R 2 is hydrogen; Preferably, the compound II and the compound I are selected from the following schemes: Scheme 1: Compound II is Compound I is Scheme 2: Compound II is Compound I is Scheme 3: Compound II is Compound I is Scheme 4: Compound II is Compound I is 7. A nucleic acid, wherein the polynucleotide sequence of the nucleic acid is selected from the polynucleotide sequences encoding the L-proline hydroxylase mutants as described in any one of claims 1-4 or their complementary sequences; the polynucleotide sequence of the nucleic acid may be: the polynucleotide sequences as shown in SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8 or their complementary sequences.

8. A nucleic acid construct, which contains the nucleic acid as described in claim 7; preferably, the nucleic acid construct is an expression cassette.

9. A recombinant vector, wherein the recombinant vector contains the nucleic acid as described in claim 7 or the nucleic acid construct as described in claim 8; preferably, the recombinant vector is a recombinant cloning vector or a recombinant expression vector.

10. A host cell, which contains the nucleic acid as described in claim 7, the nucleic acid construct as described in claim 8 or the recombinant vector as described in claim 9, and / or expresses the mutant of the L-proline hydroxylase as described in any one of claims 1-4; preferably, the host cell is selected from one or more of Escherichia coli cells, insect cells, yeast cells and mammalian cells; the Escherichia coli cell may be Escherichia coli BL21(DE3) cell.

11. An enzyme preparation, which contains the mutant of the L-proline hydroxylase as described in any one of claims 1-4.

12. A transformant, wherein the transformant contains the recombinant vector as described in claim 9.

13. A method for preparing the mutant of the L-proline hydroxylase as described in any one of claims 1-4, which comprises culturing the transformant as described in claim 12 and obtaining a culture containing the mutant of the L-proline hydroxylase.

14. Use of the mutant of the L-proline hydroxylase as described in any one of claims 1-4 or the L-proline hydroxylase having the amino acid sequence as shown in SEQ ID NO:1 in the preparation of a chiral hydroxylation product; preferably, the chiral hydroxylation product is the compound I-1 as described in claim 5 or the compound I as described in claim 6.

Images