Variants of herbicide-tolerant gene PPO and their encoded proteins and applications

By improving the PPO amino acid sequence of hard straight ryegrass, constructing a PPO variant of herbicide-tolerant gene and expressing it in transgenic plants, the problem of PPO herbicide tolerance was solved and higher yields were achieved.

CN120230766BActive Publication Date: 2025-08-26LONGPING BIOTECHNOLOGY (HAINAN) CO LTD +2
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510705614.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-29
Publication Date
2025-08-26
Estimated Expiration
2045-05-29

AI Technical Summary

Technical Problem

There have been no reports of PPO-inhibited herbicide-tolerant plants in the prior art, resulting in a decrease in the yield of plants after using PPO-inhibited herbicides.

Method used

By improving the specific site of PPO amino acids of Lolium ribidum, a variant of the herbicide-tolerant gene PPO was developed, and the amino acid sequence it encoded was inserted into the recombinant expression vector, and the chloroplast signal peptide was used to improve the tolerance of plants to PPO inhibitors, and a transgenic plant was constructed.

Benefits of technology

The plants have improved their tolerance to PPO herbicides, and the yield of transgenic plants after spraying PPO herbicides is higher than that of plants without spraying.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120230766B_ABST
    Figure CN120230766B_ABST
Patent Text Reader

Abstract

The present invention provides a herbicide-tolerant gene PPO variant, its encoded protein, and its application, belonging to the technical field of crop breeding. The amino acid sequence encoded by the herbicide-tolerant gene PPO variant is shown in SEQ ID NO. 2, and the nucleotide sequence of the herbicide-tolerant gene PPO variant is shown in SEQ ID NO. 1. The herbicide-tolerant gene PPO variant of the present invention, which incorporates a herbicide-tolerant gene PPO variant with an added chloroplast signal peptide, can improve the plant's tolerance to PPO herbicides when introduced into the plant. Furthermore, the yield of plants sprayed with PPO herbicides is higher than that of plants not sprayed with PPO herbicides, and can be applied to crop breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of crop breeding, and specifically to a herbicide-resistant gene PPO variant, its encoded protein, and application. Background Art

[0002] Weeds are a key factor affecting crop yield in agricultural production. Herbicides are the primary means of weed control. In plants, the enzyme protoporphyrinogen oxidase (PPO) is a key target for herbicides. Inhibition of PPO in plants leads to the intracellular accumulation of protoporphyrinogen, the substrate that catalyzes this reaction. Accumulation of protoporphyrinogen in chloroplasts and mitochondria leads to non-enzymatic oxidation of protoporphyrinogen by oxygen. Under light conditions, non-enzymatic oxidation of protoporphyrinogen produces singlet oxygen. Singlet oxygen oxidizes lipids in the cellular membrane system and causes oxidative disintegration of these membrane systems, thereby killing the plant cell. Plants generally have at least two PPO genes, designated PPO1 and PPO2. PPO1 is generally located in plant chloroplasts, while PPO2 is generally located in the mitochondria of plant cells. Since the 1960s, herbicides that inhibit protoporphyrinogen oxidase (referred to herein as Protox or PPO; EC: 1.3.3.4), a key enzyme in protoporphyrin IX biosynthesis, have been used for selective weed control. PPO catalyzes the oxidation of protoporphyrinogen IX to protoporphyrin IX, the final common step in the biosynthesis of chlorophyll and heme (Matringe et al., 1989. Biochem. 1. 260: 231).

[0003] Application of PPO-inhibiting herbicides results in the accumulation of protoporphyrinogen IX in chloroplasts and mitochondria. Protoporphyrinogen IX leaks into the cytoplasm, where it is oxidized by peroxidases. When exposed to light, protoporphyrin IX causes the formation of singlet oxygen and other reactive oxygen species in the cytoplasm, which may cause lipid peroxidation and membrane rupture, leading to rapid cell death (Lee et al., 1993. Plant Physiol. 102: 881).

[0004] Currently, there are no reports of PPO-inhibiting herbicide-tolerant plants in the prior art. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a variant of the herbicide-resistant gene PPO, its encoded protein and application. When the variant of the herbicide-resistant gene PPO is transferred into plants, the tolerance of the plants to PPO herbicides can be improved, and the yield of plants after spraying PPO herbicides is higher than that of plants not sprayed with PPO herbicides.

[0006] Furthermore, the present invention develops a new type of corn seed that is resistant to PPO inhibitor herbicides. Fluazifop-glufosinate-ammonium mixed herbicide, benzylpyraclostrobin herbicide The present invention relates to the above-mentioned herbicides collected from the market.

[0007] To address the current problems of eliminating weeds and developing plant tolerance to PPO inhibitors, the present invention improves specific sites of the PPO amino acids in rigid ryegrass (Lolium rigidum) to provide a method / application / product for enhancing plant tolerance to PPO inhibitors, thereby achieving the effect of improving the tolerance of plants containing the gene of the present invention to specific herbicide categories.

[0008] Specifically, the present invention provides a variant of the herbicide-tolerant gene PPO, which encodes a variant of the herbicide-tolerant protein PPO having an amino acid sequence as shown in SEQ ID NO. 2. The nucleotide sequence of the variant of the herbicide-tolerant gene PPO is shown in SEQ ID NO. 1. The original sequence of the present invention is derived from the wild-type PPO sequence of Lolium rigidum.

[0009] Furthermore, the present invention provides a recombinant expression vector comprising a chloroplast signal peptide and a variant of the herbicide-resistant gene PPO. A recombinant bacterium or recombinant cell comprising the aforementioned recombinant expression vector is also provided. Compared to a recombinant expression vector comprising only the herbicide-resistant gene PPO variant, the recombinant expression vector comprising the chloroplast signal peptide can impart a higher tolerance to herbicides to the transformed transgenic plants, thereby increasing the yield of the transformed transgenic plants when sprayed with herbicides.

[0010] The present invention also provides a method for constructing a transgenic plant, wherein the method comprises introducing a variant of the herbicide-tolerant gene PPO into the original plant. The method comprises the following steps:

[0011] (1) constructing the recombinant expression vector according to claim 4;

[0012] (2) transforming the recombinant expression vector into Agrobacterium;

[0013] (3) The recombinant expression vector is transformed into the original plant using the Agrobacterium infection method.

[0014] The present invention also provides application of the variant of the herbicide-resistant gene PPO in improving plant resistance to PPO-inhibiting herbicides.

[0015] Furthermore, variants of the herbicide-tolerant gene PPO are applied to crop breeding, including but not limited to corn, soybean, rice, sorghum, wheat and other crops.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention provides a variant of the herbicide-resistant gene PPO. When the variant of the herbicide-resistant gene PPO is introduced into a plant, the plant's tolerance to PPO herbicides can be improved, and the yield of the plant after spraying the PPO herbicide is higher than that of the plant not sprayed with the PPO herbicide. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Schematic diagram of the vector of the present invention.

[0019] Figure 2 The graph shows the results of herbicide tolerance of transgenic PPO and corn yield results.

[0020] Figure 3 The graph shows the results of herbicide tolerance of transgenic PPO and soybean yield results. DETAILED DESCRIPTION

[0021] In order to better understand the technical content of the present invention, specific examples are provided below. Unless otherwise specified, the technical means used in the examples are conventional methods. The reagents used in the examples, unless otherwise specified, can be obtained from commercial channels.

[0022] Example 1

[0023] 1. Construction, preservation and detection of recombinant expression vectors

[0024] A variant of the herbicide-tolerant gene PPO with the nucleotide sequence shown in SEQ ID NO. 1 and a wild-type nucleotide sequence of the herbicide-tolerant gene PPO were synthesized by Nanjing GenScript Biotechnology Co., Ltd. The synthesized nucleotide sequence also has an Nco I restriction site at the 5' end and an EcoR I restriction site at the 3' end.

[0025] The synthesized nucleotide sequence of SEQ ID NO. 1 was ligated into the cloning vector pEASY-T5 (Beijing TransGen Biotech Co., Ltd., Cat. No. CT501-01). The procedures were carried out according to the pEASY-T5 vector product manual to obtain the LP01-T vector. The recombinant cloning vector LP01-T was then transformed into Escherichia coli T1 competent cells (Beijing TransGen Biotech Co., Ltd., Cat. No. CD501) using the heat shock method. The heat shock conditions were:

[0026] 1) 50 μL of E. coli T1 competent cells and 10 μL of plasmid DNA (recombinant cloning vector LP01-T) were incubated in a 42°C water bath for 30 seconds; then in a 37°C water bath for 45 minutes (shaking at 200 rpm). The cells were then spread on LB plates (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 15 g / L agar, pH adjusted to 7.5 with NaOH) containing ampicillin (100 mg / L) and grown overnight.

[0027] 2) Pick a white colony and culture it in LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 100 mg / L ampicillin, pH adjusted to 7.5 with NaOH) at 37°C overnight.

[0028] 3) Alkaline extraction of plasmid: centrifuge the bacterial solution at 12000 rpm for 1 min, remove the supernatant, precipitate the bacterial cells and resuspend them in 100 μL of ice-cold solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose, pH 8.0); add 150 μL of freshly prepared solution II (0.2 M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the tube 4 times to mix, and place on ice for 3-5 minutes; add 150 μL of ice-cold solution III (4M potassium acetate, 2M acetic acid), mix thoroughly immediately, and place on ice for 5-10 minutes; centrifuge at 4°C and 12000 rpm for 5 minutes, add 2 volumes of anhydrous ethanol to the supernatant, mix well, and place at room temperature for 5 minutes; centrifuge at 4°C and 12000 rpm for 5 minutes, discard the supernatant, wash the precipitate with 70% ethanol by mass concentration, and dry it; add 30 μL of TE (10mM Tris-HCl, 1mM EDTA, pH 8.0) containing RNase (20 μg / mL) to dissolve the precipitate; digest the RNA in a water bath at 37°C for 30 minutes; store at -20°C until use.

[0029] The extracted plasmid was digested with Nco I and EcoR I, and the positive clones were sequenced and verified. The results showed that the nucleotide sequence inserted into the recombinant cloning vector LP01-T was the nucleotide sequence of the PPO variant shown in SEQ ID NO.1 in the sequence list, that is, the PPO variant nucleotide sequence was correctly inserted.

[0030] The recombinant cloning vector LP01-T and the expression vector LP-BB1 (vector backbone: pCAMBIA3301 (available from CAMBIA)) were digested with restriction endonucleases Nco I and EcoR I, respectively. The excised PPO nucleotide sequence fragment was inserted between the Nco I and EcoR I sites of the expression vector LP-BB1 to construct the recombinant expression vector LP-PT03. The vector is shown in FIG. Figure 1 As shown, KanR: kanamycin gene; Ori: pUCorigin represents the replication region sequence of plasmid pUC, which can guide the double-stranded DNA replication process; RB: right border; pZmUbi1: from the maize ubiquitin gene promoter (SEQ ID NO.3); PPO: PPO variant nucleotide sequence (SEQ ID NO.1); Nos: nopaline synthase terminator (SEQ ID NO.4); pZmUbi 1: from the maize ubiquitin gene promoter (SEQ ID NO.3); PAT: phosphinothricin acetyltransferase, used for transformation screening and conferring glufosinate herbicide resistance to transgenic plants (SEQ ID NO.5); 35S: terminator from cauliflower mosaic virus (CaMV) (SEQ ID NO.6); LB: left border.

[0031] The nucleotide sequence of the PPO variant gene, SEQ ID NO: 1, is as follows:

[0032]

[0033] MVGATMAIATVTAALPLRVRVPGRSRRGQARCAVASDATEAPAAPSARLSADCVIVGGGISGLCTAQALATKYGVSDLLVTEARARPGGNITTVERPDEGYLWEEGPNSFQPSDPVLTMAVDSGLKDELVFGDPNAPAFVLWEGKLRPVPSKPGDLPFFDLMSIPGKLRAGLGALGIRPPPPGREESVEEFVRRNLGAEVFERLIEPFCSGVYAGDPSKLSMRAAFGKVWRLEENGGSIIGGTIKAIQDKGKNPKPPRDPRLPAPKGQTVASFRKGLAMLPNAIASRLGSKVKLSWKLTSITKSENQGYVLGYETPEGVVSVQAKSVIMTIPSYIASDILRPLSSDAADGLSKFYYPPVAAVTVSYPKEAIRKECLIDGELQGFGQLHPRSQGVETLGTIYSSSLFPNRAPAGRVLLLNVIGGATNTGIVSKTESDLVEAVDRDLRKMLINPRAADPLALGVRVWPQAIPQFLIGHLDRLDAAKSALVRSGCSGLFLGGNYVAGVALGRCIEGAYDSASEVSDFLNKYAYK*

[0034] The sequence of the maize ubiquitin gene promoter, SEQ ID NO:3, is as follows:

[0035]

[0036] The sequence of the tNOS terminator, SEQ ID NO:4, is as follows:

[0037] Gatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatc

[0038] The sequence of PAT, SEQ ID NO:5, is as follows:

[0039] atgtctccggagaggagaccagttgagattaggccagctacagcagctgatatggccgcggtttgtgatatcgttaaccattacattgagacgtctacagtgaactttaggacagagccacaaacaccacaagagtggattgatgatctagagaggttgcaagatagatacccttggttggttgctgaggttgagggtgttgtggctggtattgcttacgctgggccctggaaggctaggaacgcttacgattggacagttgagagtactgtttacgtgtcacataggcatcaaaggttgggcctaggatccacattgtacacacatttgcttaagtctatggaggcgcaaggttttaagtctgtggttgctgttataggccttccaaacgatccatctgttaggttgcatgaggctttgggatacacagcccggggtacattgcgcgcagctggatacaagcatggtggatggcatgatgttggtttttggcaaagggattttgagttgccagctcctccaaggccagttaggccagttacccagatctga

[0040] The sequence of the 35s terminator, SEQ ID NO:6, is as follows:

[0041] Ctgaaatcaccagtctctctctacaaatctatctctctctataataatgtgtgagtagttcccagataagggaatt agggttcttatagggtttcgctcatgtgttgagcatataagaaacccttagtatgtatttgtatttgtaaaatacttcta tcaataaaatttctaattcctaaaaccaaaatccagtgg; The original sequence of Lolium rigidum PPO1, SEQ ID NO.11, is as follows::

[0042] MVGATMATATITTALPLRLRVPARSRRGQTRCAVASDATEAPAAPSARLSADCVIVGGGISGLCTAQALATKYGVSDLLVTEARARAGGNITTVERPDEGYLWEEGPNSFQPSDPVLTMAVDSGLKDDLVFGDPNAPRFVLWQGKLRPVPSKPGDLPFFDLMSIPGKLRAGLGALGIRPPPPGREESVEEFVRRNLGAEVFERLIEPFCSGVYAGDPSKLSMRAAFGKVWRLEENGGSIIGGTIKAIQDRGKNPKPPRDPRLPTPKGQTVASFRKGLAMLPNAIASRLGSKVKLSWKLTSITKSDNQGYVLAYETPEGVVSVQAKSVIMTIPSYIASEILRPLSSDAADGLSKFYYPPVAAVTVSYPTEAIRKECLIDGELQGFGQLHPRSQGVETLGTIYSSSLFPNRAPAGRVLLLNYIGGATNTGIVSKTESDLVEAVDRDLRKMLINPTAPDPLALGVRVWPQAIPQFLIGHLDRLDAAKSALARGGCSGLFLGGNYVAGVALGRCIEGAYESASEVSDFLTKYAYK

[0043] The sequence of the chloroplast signal peptide sequence ZmCTP, SEQ ID NO:12, is as follows:

[0044] tctagaggatcagcatggcgcccaccgtgatgatggcctcgtcggccaccgccgtcgctccgttccaggggctcaagtccaccgccagcctccccgtcgcccg ccgctcctccagaagcctcggcaacgtcagcaacggcggaaggatccggtgcatgcaggtaacaaatgcatcctagctagtagttctttgcattgcagcagctg cagctagcgagttagtaataggaagggaactgatgatccatgcatggactgatgtgtgttgcccatcccatcccaattcccaaccccaaacgaaccaaaacaca cgtactacgtgcaggtgtggccggcctacggcaacaagaagttcgagacgctgtcgtacctgccgccgctgtcgaccggcgggcgcatccgctgcatgcaggcc

[0045] Example 2

[0046] 2.1 Plant transformation and detection

[0047] Conventional Agrobacterium infection was used for transformation. Sterile transgenic maize / soybean embryos were co-cultured with the Agrobacterium described in Example 1 to transfer the T-DNA in the constructed recombinant expression vector LP-PT03 into the plant chromosomes to produce transgenic maize events.

[0048] For Agrobacterium-mediated transformation of maize, immature embryos are isolated from maize and contacted with an Agrobacterium suspension, wherein the Agrobacterium is capable of transferring the nucleic acid sequence of the PPO gene and the nucleic acid sequence of the PAT gene to at least one cell of one of the embryos (step 1: infection step). In this step, the embryos are specifically immersed in the Agrobacterium suspension (OD660 = 0.4-0.6, infection medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 68.5 g / L, glucose 36 g / L, acetosyringone (AS) 4 g / L). The embryos were co-cultured with Agrobacterium for a period of 3 days (Step 2: co-cultivation step). Specifically, after the infection step, the embryos were cultured on a solid medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 20 g / L, glucose 10 g / L, acetosyringone (AS) 100 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, agar 8 g / L, pH 5.8). After this co-cultivation phase, there can be an optional "recovery" step. In the "recovery" step, at least one antibiotic known to inhibit the growth of Agrobacterium (such as cephalosporin) is present in the recovery medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, phytagel 3 g / L, pH 5.8), and no selective agent for plant transformants is added (step 3: recovery step). Specifically, the immature embryos are grown on solid medium with antibiotics but without selective agents. The inoculated embryos are then cultured on a medium containing a selective agent (N-(phosphonomethyl)glycine) to eliminate Agrobacterium and provide a recovery period for infected cells. Next, the inoculated embryos are cultured on a medium containing a selective agent (N-(phosphonomethyl)glycine) to select for growing transformed callus (Step 4: Selection Step). Specifically, the embryos are cultured on a selective solid medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, N-(phosphonomethyl)glycine 0.25 mol / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, phytagel 3 g / L, pH 5.8) containing the selective agent, resulting in the selective growth of transformed cells. The calli are then regenerated into plants (Step 5: Regeneration Step). Specifically, calli grown on the medium containing the selective agent are cultured on solid media (MS differentiation medium and MS rooting medium) to regenerate plants.

[0049] Resistant calli obtained by screening were transferred to MS differentiation medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 6-benzyladenine 2 mg / L, N-(phosphonomethyl)glycine 0.125 mol / L, phytagel 3 g / L, pH = 5.8) and cultured at 25°C for differentiation. The differentiated seedlings were transferred to MS rooting medium (MS salts 2.15 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, indole-3-acetic acid 1 mg / L, agar 8 g / L, pH = 5.8), cultured at 25°C to a height of approximately 10 cm, and then transferred to a greenhouse for cultivation until fruiting. In the greenhouse, the seedlings were cultured at 28°C for 16 hours and at 20°C for 8 hours each day.

[0050] For Agrobacterium-mediated soybean transformation, mature JACK soybean seeds were germinated in soybean germination medium (3.1 g / L B5 salts, B5 vitamins, 20 g / L sucrose, 8 g / L agar, pH 5.6). The seeds were plated on the germination medium and incubated under the following conditions: temperature 25 ± 1°C, photoperiod (light / dark) 16 / 8 h. After 4-6 days of germination, sterile soybean seedlings with swollen cotyledonary nodes were removed. The hypocotyls were cut 3-4 mm below the nodes, the cotyledons were cut longitudinally, and the terminal buds, lateral buds, and seminal roots were removed. The cotyledonary nodes were wounded with the back of a scalpel. The wounded cotyledonary node tissue was then exposed to an Agrobacterium suspension, which is capable of transmitting the PAT gene nucleotide sequence to the wounded cotyledonary node tissue (Step 1: infection step). In this step, the cotyledonary node tissue is preferably immersed in an Agrobacterium suspension (OD660 = 0.5-0.8, infection medium (MS salts 2.15 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, acetosyringone (AS) 40 mg / L, 2-morpholineethanesulfonic acid (MES) 4 g / L, zeatin (ZT) 2 mg / L, pH 5.3) to initiate infection. The cotyledonary node tissue is co-cultivated with Agrobacterium for a period of time (3 days) (step 2: co-cultivation step). Preferably, the cotyledonary node tissue is cultured on a solid medium (MS salts 4.3 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, 2-morpholineethanesulfonic acid (MES) 4 g / L, zeatin 2 mg / L, agar 8 g / L, pH 5.6) after the infection step. After this co-cultivation period, there is a selective "recovery" In the "recovery" step, the recovery medium (3.1 g / L B5 salts, B5 vitamins, 1 g / L 2-morpholineethanesulfonic acid (MES), 30 g / L sucrose, 2 mg / L zeatin (ZT), 8 g / L agar, 150 mg / L cephalosporin, 100 mg / L glutamic acid, 100 mg / L aspartic acid, pH 5.6) contains at least one antibiotic known to inhibit the growth of Agrobacterium (150-250 mg / L cephalosporin), and no selective agent for plant transformants is added (Step 3: recovery step). Preferably, the tissue pieces regenerated from the cotyledonary nodes are cultured on a solid medium containing an antibiotic but no selective agent to eliminate Agrobacterium and provide a recovery period for infected cells. Subsequently, the tissue pieces regenerated from the cotyledonary nodes are cultured on a medium containing a selective agent (glufosinate-ammonium) and growing transformed callus is selected (Step 4: selection step).Preferably, the tissue pieces regenerated from the cotyledonary nodes are cultured on a screening solid medium with a selective agent (B5 salt 3.1 g / L, B5 vitamins, 2-morpholineethanesulfonic acid (MES) 1 g / L, sucrose 30 g / L, 6-benzyladenine (6-BAP) 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 100 mg / L, aspartic acid 100 mg / L, glufosinate ammonium 10 mg / L, pH 5.6), resulting in the transformed cells being able to continue to grow. Then, the transformed cells are regenerated into plants (step 5: regeneration step), preferably, the tissue pieces regenerated from the cotyledonary nodes grown on a medium containing a selective agent are cultured on a solid medium (B5 differentiation medium and B5 rooting medium) to regenerate plants. The resistant tissue blocks obtained by screening were transferred to the B5 differentiation medium (B5 salt 3.1 g / L, B5 vitamin, 2-morpholineethanesulfonic acid (MES) 1 g / L, sucrose 30 g / L, zeatin (ZT) 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 50 mg / L, aspartic acid 50 mg / L, gibberellin 1 mg / L, auxin 1 mg / L, glufosinate ammonium 10 mg / L, pH 5.6) and cultured for differentiation at 25°C. Differentiated seedlings were transferred to B5 rooting medium (3.1 g / L B5 salts, B5 vitamins, 1 g / L 2-morpholineethanesulfonic acid (MES), 30 g / L sucrose, 8 g / L agar, 150 mg / L cephalosporin, and 1 mg / L indole-3-butyric acid (IBA)) and cultured on a rooting medium at 25°C to a height of approximately 10 cm. The seedlings were then transferred to a greenhouse and cultured until they formed seeds. In the greenhouse, the seedlings were cultured for 16 hours each day at 26°C and 8 hours at 20°C.

[0051] 2.2 Detection of transgenic plants

[0052] 1. Verify the transgenic plants with the PPO gene using 2×EasyTaq PCRSuperMix (Cat.No: AS111-11) from Beijing TransGen Biotech Co., Ltd.

[0053] The primers for PCR are:

[0054] PPO-F: 5'-CTAGTATGGTGGGCGCTAGC-3' (SEQ ID NO: 7);

[0055] PPO-R: 5'-TCACTTGTAGGCGTACTTGTTG-3' (SEQ ID NO: 8).

[0056] PCR detection fragment size: 1596bp

[0057] The PCR reaction conditions were as follows: 30 cycles, each cycle consisting of 95°C for 30 min, 58°C for 30 min, and 72°C for 40 min.

[0058] 2. Verify the plants with PPO gene by qRT-PCR

[0059] Approximately 100 mg of leaves from maize plants transfected with the PPO nucleotide sequence (SEQ ID NO. 1) were used as samples. Genomic DNA was extracted using the EasyPure Plant Genomic DNA Kit (with RNase A) (Cat. No. EE111-01) from Beijing TransGen Biotech Co., Ltd. The PPO gene copy number was determined by TransStart Green fluorescent quantitative PCR. Wild-type plants were used as controls and analyzed using the same method as above. The experiment was repeated three times, and the average value was calculated.

[0060] The specific method for detecting the PPO gene copy number is as follows:

[0061] 1) Take 100 mg of leaves from plants transformed with the PPO nucleotide sequence and wild-type plants, grind them into homogenates in a mortar with liquid nitrogen, and take three replicates for each sample;

[0062] 2) Genomic DNA was extracted from the above samples using the EasyPure Plant Genomic DNA Kit (containing RNase A) from Beijing TransGen Biotech Co., Ltd. For specific methods, refer to the product manual.

[0063] 3) Determine the genomic DNA concentration of the above samples using NanoDrop 2000 (Thermo Scientific);

[0064] 4) adjusting the genomic DNA concentrations of the above samples to the same concentration value, which ranges from 80 to 100 ng / μL;

[0065] 5) TransStart Green fluorescent quantitative PCR was used to identify the copy number of the samples. Samples with known copy number were used as standards, and samples from wild-type corn plants were used as controls. Three replicates were performed for each sample, and the average value was taken. The sequences of the fluorescent quantitative PCR primers and probes were:

[0066] The following primers were used to detect the PPO nucleotide sequence:

[0067] Primer 1 (qF1): 5′-AAGCTCACCAGCATCACGAA-3′ (SEQ ID NO. 9);

[0068] Primer 2 (Qr1): 5′-GAGCTGGAGTAGATCGTGCC-3′ (SEQ ID NO. 10);

[0069] The PCR reaction system is:

[0070]

[0071] PCR reaction conditions are:

[0072]

[0073]

[0074] Return to step 2 and repeat 40 times.

[0075] Data were analyzed using SDS2.3 software (Applied Biosystems).

[0076] The test results showed that the PPO nucleotide sequence had been integrated into the chromosomes of the transgenic plants tested, and all the transgenic plants into which the PPO nucleotide sequence was transferred contained a single copy of the PPO gene.

[0077] Example 3

[0078] Testing genetically modified corn for herbicide resistance

[0079] This experiment used two herbicides: Qingyuan Agro-Crown's Kuai Ru Feng (a total herbicide blend of fluazifop-butyl and glufosinate-ammonium, both with different mechanisms of action) and Jiangshan Chemical's Benpyraclostrobin (a 10% contact herbicide). A randomized block design with three replications was used. Plots were 15 m² (5 m × 3 m), with 60 cm row spacing and 25 cm plant spacing. Conventional cultivation practices were employed, with 1-meter-wide isolation strips between plots. Each transgenic maize event was sprayed with the following two treatments: 1) no spraying; 2) spraying with 360 g / mu of Kuai Ru Feng (four times the recommended concentration) and 160 ml / mu of Benpyraclostrobin (four times the recommended concentration) at the V3 leaf stage. It should be noted that the following conclusions were based on the conversion of different herbicide dosages and formulations to equivalent amounts of active ingredient. Injury symptoms were assessed one and two weeks after application, and plot yields were measured at harvest. The grading of pesticide damage symptoms is shown in Table 1. The herbicide damage rate is used as an evaluation index to assess the herbicide tolerance of the transformation event. Specifically, the herbicide damage rate (%) = ∑ (number of damaged plants at the same level × number of levels) / (total number of plants × highest level); wherein the herbicide damage rate refers to the herbicide damage rate, and the damage rate is determined based on the results of the pesticide damage survey 2 weeks after the herbicide treatment. The corn yield of each plot is the total yield (weight) of corn kernels in the middle 3 rows of each plot. The yield difference between different treatments is measured in the form of yield percentage, and the yield percentage (%) = spraying yield / non-spraying yield. The results of transgenic PPO corn's tolerance to herbicides and the corn yield results are shown in the figure below. Figure 2 , as shown in Table 2.

[0080] Table 1 Classification standards for the degree of herbicide damage

[0081]

[0082] Table 2 Results of herbicide tolerance and corn yield of transgenic corn events

[0083]

[0084] Example 4. Transgenic soybean herbicide resistance test

[0085] This experiment used two herbicides: Qingyuan Agro-Crown's Kuai Ru Feng (a total herbicide blend of fluazifop-butyl and glufosinate-ammonium, both with different mechanisms of action) and Jiangshan Chemical's Benpyraclostrobin (a 10% contact herbicide). A randomized block design with three replications was used. Row spacing was 1 m, plant spacing was 10 cm, and conventional cultivation practices were followed, with 1-meter-wide isolation strips between plots. Each transgenic soybean was sprayed with the following two treatments: 1) no spraying; 2) Kuai Ru Feng herbicide (360 g / mu, 4 times the recommended concentration) and Benpyraclostrobin (160 ml / mu, 4 times the recommended concentration) at the V3 leaf stage. It should be noted that the following conclusions were based on the conversion of different herbicide dosages and formulations to equivalent amounts of active ingredient. Injury symptoms were assessed one and two weeks after application, and plot yields were measured at harvest. Injury symptom ratings are shown in Table 1. The herbicide damage rate is used as an evaluation index to assess the herbicide tolerance of the transformation event. Specifically, the herbicide damage rate (%) = ∑ (number of damaged plants at the same level × number of levels) / (total number of plants × highest level); the herbicide damage rate refers to the herbicide damage rate, which is determined based on the results of the herbicide damage survey 2 weeks after the herbicide treatment. The soybean yield of each plot is the total soybean yield (weight) of the three middle rows of each plot. The yield difference between different treatments is measured in the form of yield percentage, and the yield percentage (%) = spraying yield / non-spraying yield. The results of transgenic PPO soybean herbicide tolerance and soybean yield results are shown in Figure 2. Figure 3 , as shown in Table 3.

[0086] Table 3 Herbicide tolerance results and soybean yield results of transgenic soybean events

[0087]

[0088]

[0089] The results showed that the transgenic corn and soybeans transformed with the optimized / modified PPO variants showed significantly higher tolerance to herbicides containing fluazifop-butyl, glufosinate-ammonium, and benzylpyrazone in the field than the wild-type original sequence transgenic plants. The transgenic soybeans and corn transformed with the modified PPO variants after adding the signal peptide showed further significant improvement in tolerance to herbicides containing fluazifop-butyl, glufosinate-ammonium, and benzylpyrazone. Of course, the above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Changes, modifications, additions, or substitutions made by those skilled in the art within the scope of the present invention should all fall within the scope of protection of the present invention.

Claims

1. A variant of the herbicide-tolerant gene PPO, characterized in that: The amino acid sequence encoded by the variant of the herbicide-tolerant gene PPO is shown in SEQ ID NO.

2.

2. The variant of the herbicide-tolerant gene PPO according to claim 1, characterized in that The nucleotide sequence of the variant of the herbicide-tolerant gene PPO is shown in SEQ ID NO.

1.

3. A recombinant expression vector, characterized in that: 1) A variant containing the herbicide-tolerant gene PPO according to claim 1 or 2; 2) Contains a chloroplast signal peptide sequence, which is shown in SEQ ID NO:

12.

4. A recombinant cell, characterized in that The recombinant cell contains the recombinant expression vector according to claim 3.

5. A method for constructing a transgenic plant, characterized in that: The construction method is to transfer the variant of the herbicide-resistant gene PPO according to claim 1 or 2 into the original plant; the original plant is corn or soybean.

6. The construction method according to claim 5, characterized in that: The construction method comprises the following steps: 1) constructing the recombinant expression vector according to claim 3; 2) transforming the recombinant expression vector into Agrobacterium; 3) The recombinant expression vector is transformed into the original plant using the Agrobacterium infection method.

7. Use of the variant of the herbicide-tolerant gene PPO according to claim 1 or 2 in improving plant resistance to PPO-inhibiting herbicides, wherein the plant is transgenic corn or transgenic soybean.

Citation Information

Patent Citations

  • Plants having increased tolerance to herbicides (PPO)

    CN105814197A

  • DNA molecules encoding plant protoporphyrinogen oxidase and inhibitor-resistant mutant thereof

    CN1212724A