Application of NPFFR2 gene SNP sites in judging the resistance to metritis in dairy cows

Abstract

The present invention discloses the application of a single nucleotide polymorphism (SNP) site in the NPFFR2 gene for determining the level of resistance to metritis in dairy cows, belonging to the field of livestock and poultry molecular biology technology. The SNP site is rs110326785, and a base mutation occurs at this site, which is G>A. Cows with a genotype of GG at this site have significantly higher resistance to metritis than cows with genotypes of GA or AA. The mutation at the SNP site rs110326785 is a missense mutation, resulting in a mutation of glutamic acid at position 406 of the amino acid sequence encoded by NPFFR2 to lysine. Cows with a genotype of GG at this site have the highest resistance to metritis. This method can be used to screen and identify cows with high resistance to metritis, thereby selecting cows with high resistance to metritis for herd optimization and assisted breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of livestock and poultry molecular biology, and in particular to application of a SNP site of an NPFFR2 gene in judging the level of cow's metritis resistance. Background Art

[0002] Metritis in cattle is an inflammation of the uterus caused by a bacterial infection, typically occurring within 21 days (most commonly within 7 days) after parturition. Cows with metritis secrete a reddish-brown, watery, and foul-smelling uterine discharge and display systemic symptoms of infection, including fever, lethargy, loss of appetite, increased heart rate, and decreased milk production. Postpartum metritis is highly detrimental, severely impairing the reproductive performance of dairy cows. It can lead to lower conception rates and increased empty-bowel days, increasing reproductive costs and even infertility, increasing the risk of culling affected cows. Postpartum metritis is highly prevalent, affecting 5-20% of postpartum dairy herds. Overall, metritis causes significant economic losses to dairy farming operations.

[0003] The use of antibiotics is a common and effective treatment for bovine metritis, but there are issues with bacterial resistance and antibiotic residues in dairy products. Currently, bacterial resistance has become a major concern in global public health. The incidence of bovine metritis is influenced by both genetic and environmental factors. Genetic improvement of dairy cows to increase their metritis resistance (METR) and cultivate new metritis-resistant dairy cow germplasm can reduce the incidence of metritis and reduce the use of antibiotics, thereby reducing the problems of bacterial resistance and antibiotic residues in dairy products, reducing economic losses for dairy farming enterprises. It is also an important way to achieve cost reduction, quality improvement, and efficiency improvement for dairy farming enterprises in my country.

[0004] Metritis resistance is a trait with low heritability. It was only included in the Lifetime Net Value Index during the 2018 update of the US Genetic Selection Index. While more reliable genotype-based estimated breeding values ​​(EBVs) are now available for evaluating metritis resistance in dairy cows, there are currently few reports on the genetic mechanisms influencing metritis resistance in Holstein cattle, and the development of relevant genetic markers is urgently needed. Genome-wide association studies (GWAS) can effectively identify key candidate molecular marker loci associated with the trait and elucidate the genetic mechanisms of complex traits.

[0005] The neuropeptide FF receptor 2 gene (NPFFR2) encodes a member of the G-coupled protein neuropeptide receptor subfamily, which functions through activation by neuropeptide A-18-amide (NPAF) and F-8-amide (NPFF). Furthermore, NPFFR2, activated by NPFF, participates in anti-inflammatory activities in vitro and in vivo and can regulate the proliferation of human T lymphocytes. Public literature reports that in a study of Holstein cattle, the NPFFR2 gene was found to be one of the candidate genes for mastitis susceptibility, and a missense mutation site rs110326785 in the NPFFR2 gene may be a potential causal mutation associated with mastitis resistance in Holstein cattle (Wu et al., Association analysis for udder health based on SNP-panel and sequence data in Danish Holsteins. Genet Sel Evol. 2015 Jun 19;47(1):50.; Cai et al., Meta-analysis of six dairy cattle breeds reveals biologically relevant candidate genes for mastitis resistance. Genet Sel Evol. 2024 Jul 15;56(1):54.). In addition, using the GWAS method, three SNPs associated with body conformation traits in Holstein cattle were identified in the NPFFR2 gene, including the rs110326789 site (Li S et al., Genome-wide association analysis of body conformation traits in Chinese Holstein Cattle. BMC Genomics. 2024 Dec 3;25(1):1174).

[0006] There are currently no reports on the association between NPFFR2 and metritis resistance. In view of this, the present invention is proposed. Summary of the Invention

[0007] The purpose of the present invention is to provide a new use of the NPFFR2 gene SNP site rs110326785 for judging the level of cow metritis resistance.

[0008] The technical solution of the present invention is described in detail as follows:

[0009] In the first aspect, the present invention provides an application of a SNP site in the NPFFR2 gene for determining the resistance of dairy cows to metritis. The SNP site is rs110326785, and a base mutation G>A occurs at this site. The resistance of dairy cows with a genotype of GG at this site to metritis is significantly higher than that of dairy cows with a genotype of GA or AA.

[0010] In a second aspect, the present invention provides the use of a nucleotide sequence containing a SNP site in the NPFFR2 gene for determining the resistance of dairy cows to metritis. The nucleotide sequence is shown in SEQ ID NO: 1, wherein position 300 is a SNP site, and a base mutation G>A occurs at this site. The resistance of dairy cows with a genotype of GG at this site to metritis is significantly higher than that of dairy cows with a genotype of GA or AA.

[0011] In a third aspect, the present invention provides a primer pair for detecting a SNP site in the NPFFR2 gene for use in determining the resistance of dairy cows to metritis. The SNP site is rs110326785, and the nucleotide sequence of the primer pair is as follows:

[0012] Forward primer: 5′-TGTGGACCCTGATGATGC-3′ (SEQ ID NO: 2);

[0013] Reverse primer: 5'-GAACGAAGCCATAGACAT-3' (SEQ ID NO: 3).

[0014] In a fourth aspect, the present invention provides a kit comprising a primer pair for detecting a SNP site in the NPFFR2 gene for use in determining the resistance of dairy cows to metritis. The SNP site is rs110326785, and the nucleotide sequence of the primer pair is shown in SEQ ID NOs: 2-3. The kit may also include DNA extraction reagents, PCR amplification reagents, and the like.

[0015] In a fifth aspect, the present invention provides a method for screening dairy cows with high resistance to metritis, comprising the following steps:

[0016] (1) Extracting genomic DNA from the cows to be tested;

[0017] (2) Using the genomic DNA from step (1) as a template, a PCR reaction was performed using the primer pairs shown in SEQ ID NOs: 2-3 to obtain an amplified product;

[0018] (3) The amplified product is sequenced. When the genotype of the SNP site at position 300 of the amplified product is GG, the cow being tested is a cow with high resistance to metritis.

[0019] In a sixth aspect, the present invention provides an application of an NPFFR2 gene SNP site, a nucleotide sequence containing the NPFFR2 gene SNP site, a primer pair for detecting the NPFFR2 gene SNP site, or a kit comprising a primer pair for detecting the NPFFR2 gene SNP site in assisted breeding of dairy cows, characterized in that the SNP site is rs110326785, and the resistance of individual dairy cows with a SNP site genotype of GG is significantly higher than that of individual dairy cows with a genotype of GA or AA.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] Using genome-wide association analysis, the present invention identified the NPFFR2 gene as a candidate gene for metritis resistance in dairy cows. Furthermore, a G>A mutation SNP, rs110326785, located in the fifth exon of NPFFR2, was identified as significantly associated with metritis resistance in Holstein cows (P value of 0.0479). This is a missense mutation, resulting in a glutamic acid to lysine conversion at position 406 of the amino acid sequence encoded by NPFFR2. The GG genotype at this SNP is the dominant allele for metritis resistance, meaning individuals with this genotype have a higher resistance to metritis. This genotype can be used to screen and identify dairy cows with high metritis resistance, thereby selecting individuals with this resistance for herd optimization and assisted breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 is the electrophoresis result of PCR products, M is the DL2000 molecular weight marker, and 1-5 are PCR products of DNA samples from different individual Holstein cows.

[0023] Figure 2 This is a peak diagram for sequencing analysis of PCR products of Holstein cattle with different genotypes, where the black background highlights the rs110326785 site. DETAILED DESCRIPTION

[0024] In order to enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below in conjunction with the embodiments and drawings. Obviously, the embodiments described are only embodiments of a part of the present application, rather than all embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without making creative work should fall within the scope of protection of this application. The instruments and reagents used in the embodiments are all derived from commercial channels unless otherwise specified.

[0025] Example 1 Screening and identification of SNP sites

[0026] 1. Screening the NPFFR2 gene as a candidate gene for metritis resistance in Holstein cattle using genome-wide association analysis

[0027] (1) Hair follicle or blood samples were collected from 2,708 Holstein cows at large-scale dairy farms in Dezhou, Shandong, Linyi, Shandong, Dongying, Shandong, Tongliao, Inner Mongolia, Suqian, Jiangsu, Jinchang, Gansu, and Tacheng, Xinjiang. The samples were sent to Illumina for genotyping of the cows' genomic DNA using the Bovine 50K SNP chip, and the genotype information of the SNP sites in the 50K chip was obtained for each cow.

[0028] (2) Based on the genotype information, the estimated breeding value of metritis resistance genome for each cow was estimated.

[0029] (3) Using GEMMA software and a mixed linear model, genome-wide association analysis was performed between the metritis resistance genomic breeding values ​​of the above 2708 dairy cows and the SNP locus genotypes obtained by typing, and the FDR method was used to correct the P value for multiple testing.

[0030] (4) Through genome-wide association analysis, a G>A mutation SNP site (rs110326785) located in the fifth exon of NPFFR2 was identified for the first time, which was significantly associated with metritis resistance in Holstein cattle (P value was 0.0479). This mutation is a missense mutation, resulting in a mutation from glutamic acid to lysine at position 406 of the amino acid sequence encoded by NPFFR2.

[0031] 2. Determine the dominant genotype of the SNP site in the NPFFR2 gene

[0032] The T-test statistical method was used to analyze the estimated breeding values ​​of the metritis resistance genome corresponding to different genotypes of the rs110326785 locus in the above-mentioned Holstein cattle population. As shown in Table 1, it was found that the estimated breeding value of the metritis resistance genome of the wild homozygous genotype GG was the highest and extremely significantly (P=0.000043<0.01) higher than the breeding value of the heterozygous GA and significantly (P=0.01072<0.05) higher than the breeding value of the homozygous mutant genotype AA. However, there was no significant difference in the breeding values ​​of metritis resistance between the GA and AA genotypes (P=0.66151>0.05).

[0033] In conclusion, in the Holstein cattle population, the GG genotype is the dominant allele for the metritis resistance trait, that is, individuals with the GG genotype have higher metritis resistance.

[0034] Table 1. Genomic breeding values ​​for metritis resistance in individuals with different genotypes at rs110326785

[0035]

[0036] Example 2 Verification of the correlation between SNP sites and cow metritis resistance

[0037] To verify the association between the rs110326785 locus and metritis resistance in Holstein cows, microarray analysis and genetic evaluation were performed in 920 Holstein cows from another Holstein herd. Estimated genomic breeding values ​​for metritis resistance were obtained. T-tests were used to compare the estimated genomic breeding values ​​for metritis resistance among individuals with different genotypes. The results are shown in Table 2.

[0038] Table 2 Relationship between the genotype of the rs110326785 locus and the estimated breeding value of the metritis resistance genome in the validation population

[0039]

[0040] The test results showed that there were three genotypes in the verified Holstein dairy cow population; among all verified populations, the estimated breeding value of the metritis resistance genome of the GG genotype was the highest, which was extremely significantly (P=0.00183<0.01) higher than the estimated breeding value of the metritis resistance genome of the GA genotype, and significantly (P=0.01167<0.05) higher than the breeding value of the metritis resistance genome of the AA genotype, but the difference in the breeding values ​​of the metritis resistance genome between the GA and AA genotypes was not significant (P=0.6665), which was consistent with the results in Example 1; and there were significant differences in the mean values ​​of the estimated breeding values ​​of the two populations when comparing GG individuals with AA individuals and GA individuals.

[0041] Example 3 Method for detecting the genotype of SNP site rs110326785

[0042] (1) Select the Holstein cattle population of interest, collect venous blood, and extract genomic DNA using a kit.

[0043] (2) Design PCR primers upstream and downstream of the rs110326785 SNP site based on the sequence of the bovine NPFFR2 gene (GenBank gene accession number NC_037333):

[0044] The forward primer is NPFFR2-exon5-SNP-F: 5'-TGTGGACCCTGATGATGC-3',

[0045] The reverse primer was NPFFR2-exon5-SNP-R: 5′-GAACGAAGCCATAGACAT-3′.

[0046] (3) Genotype analysis by PCR amplification and sequencing

[0047] The PCR amplification system consisted of 20 μL of the corresponding upstream and downstream primers (1.0 μL each, 10 μmol / L), 2× Taq PCR Master Mix (10.0 μL), 1.0 μL of DNA template (50 ng), and 7.0 μL of ddH₂O. The PCR reaction procedure was as follows: 94°C pre-denaturation for 5 min; 35 cycles of 94°C denaturation for 30 s, 57.5°C annealing for 30 s, and 72°C extension for 30 s; and 72°C extension for 10 min. The PCR product was 470 bp in length, as shown on agarose gel. Figure 1 shown.

[0048] The specific sequence is as follows:

[0049] 5'-TGTGGACCCTGATGATGCTCTCAGATTATGTTGACCTGTCTGCAAATGAACTGCAGGTCATCAATATCTACATCTACCCTTTTGCACACTGGCTGGCCTTCTGCAACAGCAGCGTCAACCCCATCATTTATGGTTTCTTCAATGAAAA TTTTCGTCGTGGTTTCCAAGATGCTTTTCACCTCCAGCTCTGCCAAAAAAGAGCAAAGTCCAAGGAAGTCTACACTCTGAGAGCTAAAAACACTGTGGTCATCAACACATCTCATCTGTCAGCACAGGAATCAACAGTTAAAAACCCACAC G AGGAAACTGTGCTTTGTAGGATAAGTGCTGAAAAGCCCTTACAGGAATTAATGATGGAAGAATTAGGAGAAATTACCAGTAGCAATGAGATGTAAAAAGAGCTGGTGTGATGATTTTAACTCTGCTGTGTGATATATATTGAAATATTGTTGATGTCTATGGCTTCGTTC-3' (SEQ ID NO: 1).

[0050] In the sequence, the underlined position is the SNP (rs110326785) site associated with cow metritis resistance.

[0051] Perform Sanger sequencing on the PCR products and use SeqMan software or Chromas software to view and analyze the sequencing analysis results. Figure 2 , showing different genotypes of SNP site rs110326785.

[0052] This document uses specific examples to illustrate the inventive concept in detail. The above embodiments are only intended to help understand the core concept of the present invention. It should be noted that any obvious modifications, equivalent substitutions, or other improvements made by a person skilled in the art without departing from the inventive concept should be included within the scope of protection of the present invention.

Claims

1. The use of a reagent for detecting the SNP site of the NPFFR2 gene in the preparation of a product for judging the resistance of dairy cows to metritis, characterized in that: The SNP site is rs110326785, at which a base mutation of G>A occurs; individual dairy cows with a genotype of GG at this site have significantly higher metritis resistance than individual dairy cows with a genotype of GA or AA.

2. The use according to claim 1, characterized in that The nucleotide sequence of the SNP site of the NPFFR2 gene is shown in SEQ ID NO: 1, wherein position 300 is a SNP site, and a base mutation of G>A occurs at this site.

3. The use according to claim 1, characterized in that The reagents include a primer pair, and the nucleotide sequence of the primer pair is as follows: Forward primer: 5′-TGTGGACCCTGATGATGC-3′ (SEQ ID NO: 2); Reverse primer: 5'-GAACGAAGCCATAGACAT-3' (SEQ ID NO: 3).

4. The use according to claim 1, characterized in that The product is a kit, which includes a primer pair. The nucleotide sequence of the primer pair is as follows: Forward primer: 5′-TGTGGACCCTGATGATGC-3′ (SEQ ID NO: 2); Reverse primer: 5'-GAACGAAGCCATAGACAT-3' (SEQ ID NO: 3).

Images