Application of Foxn3 gene or protein in preparation of medicine for treating retina ciliary lesion
By specifically overexpressing the Foxn3 gene or protein in retinal non-photoreceptor neurons, and using Foxn3 as a transcriptional repressor to regulate cilia gene expression, the unknown molecular mechanism of the difference in cilia structure in retinal cells is solved, and the treatment strategy for retinal cilia lesions is provided, which inhibits abnormal cilia and reduces the risk of related diseases.
Patent Information
- Application Number
- CN202510561144.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-30
- Publication Date
- 2025-07-04
AI Technical Summary
The prior art has not yet clarified how retinal cells differentiate into photoreceptor cells with complex photoreceptor cells and non-photoreceptor cells with or without simple primary cilia, and ciliary dysfunction leads to retinal diseases such as retinal pigmentation, cone-rod dystrophy, Leber congenital melanosis and Bardet-Biedl syndrome, and lacks effective therapeutic strategies.
Using the Foxn3 gene or protein, Foxn3 is specifically overexpressed in retinal non-photoreceptor neurons through lentiviral or adeno-associated viral vectors, inhibit abnormal ciliagenesis, block the abnormal expression of cilia-associated genes, and use Foxn3 as a key transcriptional repressor to regulate the expression of cilia genes and ensure the appropriate cilia structure of retinal neurons.
Revealing the key role of Foxn3 in maintaining structural differences in retinal cilia, providing potential therapeutic targets and drugs for retinal cilia lesions, inhibiting abnormal ciliagenesis in non-photoreceptor neurons, and reducing the risk of retinal disease.
Smart Images

Figure CN120241964A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical fields of biotechnology such as neurobiology and transgenic animals, and particularly relates to the application of Foxn3 gene or protein in the preparation of drugs for treating retinal ciliopathy. Background Art
[0002] The retina is a delicate sensory neuroepithelial tissue located in the inner layer of the eyeball wall. Its main function is to convert the light signals received by photoreceptor cells (rods and cones) into electrical signals, which are transmitted to the visual cortex of the brain through the optic nerve formed by the axons of retinal ganglion cells. The mammalian retina has a clear cell stratification in structure, including three cell nuclear layers (outer nuclear layer, inner nuclear layer, and ganglion cell layer) and two plexiform layers (outer plexiform layer and inner plexiform layer), and is mainly composed of 6 types of neurons, including rod cells, cone cells, bipolar cells, horizontal cells, amacrine cells, and retinal ganglion cells (RGCs), and 1 type of glial cell (Müller cells). Each cell type has its unique physiological function. For example, rod and cone cells are photoreceptor cells located in the outermost layer of the retina. They are responsible for detecting light and color vision, capturing photons, and initiating the phototransduction process. Amacrine cells are interneurons in the inner layer of the retina. They receive inputs from bipolar cells and other amacrine cells and regulate these signals before the signals reach RGCs. Bipolar cells are also interneurons that connect all retinal neural circuits. They receive inputs from photoreceptor cells and transmit these signals to amacrine cells and RGCs. Bipolar cells not only transmit visual information but also participate in many other functions of the retina, including contrast enhancement, brightness adaptation, and preliminary image processing. Any abnormality or damage in these layers will lead to visual impairment, including ciliopathy, which is one of the main causes of irreversible blindness.
[0003] Photoreceptor cells have a unique structure, including a cell body, an inner segment, an outer segment, and a non-motile connecting cilium. The connecting cilium connects the outer segment to the inner segment and is crucial for the normal function and structural integrity of photoreceptor cells. The outer segment and the connecting cilium together constitute one of the largest and most specialized mammalian sensory cilia. Ciliary proteins help maintain the structural integrity of photoreceptor cells, especially in the outer segment filled with membranous discs, which is a key component of the phototransduction pathway. Previous studies have shown that isolated primary cilia may exist in other non-photoreceptor cell types (including amacrine cells, RGCs, and Müller cells), but may not exist in bipolar cells and horizontal cells. Although all retinal cells are differentiated from common progenitor cells, non-photoreceptor cells do not form specialized sensory cilia and express lower levels of ciliary proteins. Currently, it is still unclear how retinal cells differentiate into photoreceptor cells with complex sensory cilia and non-photoreceptor cells with or without simple primary cilia.
[0004] Cilia are slender, membrane-coated, hair-like organelles that extend from the cell surface and are present in many cell types, playing important roles in physiological development and genetic diseases. The length of cilia is generally 1-10 μm, and the diameter is about 200 nm. They are mainly composed of ciliary matrix, ciliary membrane, ciliary axoneme and basal body. Cilia are divided into two categories: motile cilia and non-motile cilia. Motile cilia generate fluid flow through wave-like oscillations, have a 9+2 microtubule structure, and are equipped with additional structures such as dynein arms and central spokes, which are crucial for their movement. In contrast, non-motile cilia are usually referred to as primary cilia or sensory cilia, with a 9+0 microtubule structure at their base, lacking central microtubule pairs and movement-related structures. Although non-motile cilia do not have motility, they serve as key sensory organelles, acting as the cell's antennae to regulate signaling pathways and maintain cell homeostasis. Primary cilia play important roles in vision, hearing, and olfaction in the sensory system. In the retina, the outer segments of photoreceptor cells are regarded as specialized primary cilia dedicated to light perception, emerging and disappearing at specific stages of the cell cycle, and they persist and are continuously renewed to meet the continuous demands of visual perception. Ciliary dysfunction leads to a series of human diseases called ciliopathies, including retinal ciliopathies that affect multiple organs and exhibit diverse symptoms. Mutations in many ciliary genes can cause retinal diseases such as retinitis pigmentosa (RP), cone-rod dystrophy (CORD), Leber congenital amaurosis (LCA), and Bardet-Biedl syndrome (BBS). Given the key functions of cilia, therapeutic strategies targeting cilia have been developed for the treatment of retinal ciliopathies, including lentivirus- or adeno-associated virus-based gene therapy, small molecule drugs, and gene editing using CRISPR-Cas9.
[0005] Forkhead box (Fox) transcription factors are an evolutionarily conserved family of proteins that regulate gene expression by binding to DNA through the Fox domain and play important roles in various developmental processes and cell functions, including the regulation of primary cilia. Studies have shown that Foxj1 is the master regulator involved in the formation of motile cilia, and several transcription factor members of the Rfx family have been proven to be essential for the expression of ciliary genes. Foxn3 is a member of the FoxN subfamily of transcription factors and is expressed in the neural crest cells and early eye fields of Xenopus laevis. Hypomorphic mutations in Foxn3 lead to congenital defects in mice, including partial lethality, growth retardation, and microphthalmia. Recently, Foxn3 was identified as a target of miR-216b and is involved in inhibiting the development of amacrine cells. However, the role of Foxn3 in retinal development and function maintenance remains unknown. Summary of the Invention
[0006] In view of the above deficiencies of the prior art, the object of the present invention is to provide the application of Foxn3 gene or protein in the preparation of drugs for treating retinal ciliopathy. Experiments of the present invention have confirmed that Foxn3 is necessary to inhibit abnormal ciliogenesis in retinal non-photoreceptor neurons, revealing that Foxn3 is a key transcriptional regulatory factor for establishing and maintaining the ciliary differences between retinal photoreceptor cells and non-photoreceptor neurons, filling a key gap in the molecular mechanism of the ciliary structure differences in retinal cells, providing new insights into the molecular mechanisms of retinal development and ciliopathy, and providing potential therapeutic targets and drugs for retinal ciliopathy.
[0007] The first object of the present invention is to provide the application of Foxn3 protein in the preparation of drugs for treating retinal ciliopathy, and the amino acid sequence of the Foxn3 protein is as shown in SEQ ID NO.7.
[0008] The second object of the present invention is to provide the application of Foxn3 gene in the preparation of drugs for treating retinal ciliopathy, and the nucleotide sequence of the Foxn3 gene is as shown in SEQ ID NO.6.
[0009] The present invention also provides the application of a recombinant vector containing the Foxn3 gene in the preparation of drugs for treating retinal ciliopathy.
[0010] Preferably, the vector is a lentiviral vector or an adeno-associated virus vector.
[0011] Preferably, the drug for treating retinal ciliopathy specifically overexpresses the Foxn3 gene and / or protein in retinal non-photoreceptor neurons.
[0012] Preferably, the drug for treating retinal ciliopathy is a drug that inhibits abnormal ciliogenesis in retinal non-photoreceptor neurons.
[0013] Preferably, the retinal non-photoreceptor neurons are retinal bipolar cells and amacrine cells.
[0014] The third object of the present invention is to provide a drug for treating retinal ciliopathy, which contains the Foxn3 protein, a recombinant vector containing the Foxn3 gene or a recombinant virus containing the Foxn3 gene.
[0015] The present invention has found that the dysregulation of Foxn3 can lead to the upregulation of its downstream targets (such as Ahi1 and Rpgr), which may trigger retinal ciliary diseases. Therefore, develop methods that can specifically express Foxn3 in specific retinal cells (such as overexpressing Foxn3 using adeno-associated virus AAV), thereby blocking the abnormal expression of cilia-related genes.
[0016] This invention utilized retina-specific Foxn3 conditional knockout mice to study the role of transcription factor Foxn3 in establishing and maintaining the ciliary structural differences between retinal photoreceptor cells and non-photoreceptor cells. The experimental results showed that Foxn3 is crucial for suppressing the expression of ciliary genes in non-photoreceptor neurons (such as bipolar cells and amacrine cells). The amplitude of the b-wave and oscillatory potentials in the electroretinogram of Foxn3CKO mice were significantly reduced, indicating impaired neuronal function within the retina. The deletion of Foxn3 led to the ectopic expression of ciliary genes and abnormal ciliogenesis in non-photoreceptor neurons. Single-cell sequencing, chromatin analysis, and dual-luciferase reporter assays showed that Foxn3 directly binds to and inhibits the promoters of ciliary genes and ciliary transcription factors, including Foxj1 and members of the Rfx family. The experimental results together emphasize that Foxn3, as a key transcriptional repressor, ensures the proper ciliary structure of retinal neurons by preventing non-photoreceptor neurons from adopting photoreceptor-like ciliary characteristics.
[0017] The present invention has the following advantages:
[0018] (1) Retinal rod and cone cells are unique in having large specialized sensory cilia, which are crucial for phototransduction, while non-photoreceptor neurons typically exhibit simpler primary cilia or lack cilia altogether. This difference in ciliary structure is the basis for the functional specialization of retinal cell types, but how this difference is generated and maintained remains unclear. The present invention reveals that Foxn3 is a key regulator in establishing and maintaining the ciliary structural differences between different retinal cell types.
[0019] (2) Previously identified ciliary gene regulators (such as Foxj1 and Rfx family transcription factors) are all positive regulators. The present invention identifies Foxn3 as a key negative regulator that can directly and indirectly inhibit ciliary gene expression.
[0020] (3) The present invention shows that the dysregulation of Foxn3 or its downstream targets may lead to retinal ciliary diseases (such as retinitis pigmentosa, cone-rod dystrophy, Leber congenital amaurosis, and Bardet-Biedl syndrome). The upregulation of ciliary genes (such as Ahi1 and Rpgr) related to retinal ciliary diseases in Foxn3 gene knockout mice further emphasizes the role of Foxn3 in preventing pathological ciliogenesis.
[0021] The present invention fills a key gap in the understanding of the molecular mechanism of the ciliary structural differences in retinal cells, is of great significance for retinal development and ciliary diseases, and Foxn3 can be developed as a new therapeutic target to provide drugs for the treatment of retinal ciliary lesions. Brief Description of the Drawings
[0022] Figure 1is the spatiotemporal expression pattern of Foxn3 in the developing and adult mouse retina; (A-F) RNA in situ hybridization was used to detect the Foxn3 RNA expression profile; at E14.5-P0, the Foxn3 RNA signal was distributed throughout the retina. From P4-P21, it became stronger in the inner layer and then was confined to the INL and GCL, weakening and disappearing in the ONL; abbreviations: L: lens; R: retina; inbl: inner neuroblast layer; onbl: outer neuroblast layer; GCL: ganglion cell layer; IPL: inner plexiform layer; INL: inner nuclear layer; OPL: outer plexiform layer; ONL: outer nuclear layer; scale bar: (A) 80 μm; (B-F) 20 μm; (G-T) Expression profile of Foxn3 in single mouse retinal cells at developmental and adult stages; t-SNE maps of single retinal cells at embryonic (E11, 14, 16, 18), postnatal (P0, 2, 5, 8, 14), and adult (3M, 3 months) stages are shown, colored by the expression of the indicated genes. The inset in (R) shows the corresponding outlined area at a higher magnification. Vsx2, Tfap2b, Sox9, and Thy1 were used as molecular markers for bipolar cells, amacrine cells and horizontal cells, Müller cells, and RGCs, respectively.
[0023] Figure 2 is the construction of retina-specific Foxn3 conditional knockout (Foxn3CKO) mice and the reduced dark-adapted ERG response in Foxn3CKO mice; (A) Schematic diagram of the construction of retina-specific Foxn3 conditional knockout (Foxn3CKO) in mice; (B) Genomic DNA PCR was used to identify mice containing wild-type (WT) alleles, fl alleles, and Cre; (C, D) qRT-PCR and Western blot were used to detect the Foxn3 mRNA (C) and protein expression levels (D) in the retinas of adult control and Foxn3CKO mice, ****p<0.0001; (E-G) Comparison of the eye ball and optic nerve size (E), optic chiasm size (F), and retinal thickness (G) between 3-month-old adult control and Foxn3CKO mice; abbreviations: ON: optic nerve; OC: optic chiasm; OT: optic tract; GCL: ganglion cell layer; IPL: inner plexiform layer; INL: inner nuclear layer; OPL: outer plexiform layer; ONL: outer nuclear layer; IS: inner segment; OS: outer segment; scale bar: (G) 20 μm; (H, K) Representative ERG waveforms of control and Foxn3CKO mice under dark adaptation (H) and light adaptation (K) at 8 months of age; (I, J) Statistical graphs of the amplitudes of the dark-adapted a wave (I) and b wave (J) in the control and Foxn3CKO mice in (H); (L, M) Statistical graphs of the amplitudes of the light-adapted a wave (L) and b wave (M) in the control and Foxn3CKO mice in (K); (N) 3 cd.s / m 2Statistical chart of dark-adapted electroretinogram oscillatory potentials (OPs) under light intensity; (Q) 3 cd·s / m² 2 Statistical chart of light-adapted electroretinogram oscillatory potentials (OPs) under light intensity; Data of I-N and L-O are expressed as mean ± standard error (n = 6 or 8), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.
[0024] Figure 3 Shows the changes in single-cell transcriptome profiles of the retinas of control and Foxn3 CKO mice; (A) UMAP plot showing different cell type clusters in the combined single-cell dataset from the retinas of 3-month-old control and Foxn3 CKO mice; (B) Comparison of UMAP plots of retinal cell types in control and Foxn3 CKO mice; (C) Percentage of cells in all cell clusters of the retinas of control and Foxn3 CKO mice; (D) Scatter plot analysis of the overall gene expression profiles of the retinas of control and Foxn3 CKO mice, with the average gene expression level represented by log10, and the diagonal indicating equal expression levels of the two genotypes; (E) Volcano plot of differentially expressed genes (DEGs) (FC ≥ 2, p-value < 0.05) in the retinas of Foxn3 CKO and control mice (significance vs. fold change (FC)), marking the top 10 downregulated and upregulated genes, with the dashed line indicating p-value = 0.05 and the two vertical dashed lines indicating log2FC = 1 or -1; (F) Expression heatmap of differentially expressed genes (DEGs) between the retinas of Foxn3 CKO mice and control mice; (G) Dot plot showing the expression patterns of the top 50 upregulated genes in single-cell clusters of bipolar cells, amacrine cells, cone cells, and rod cells in the retinas of control and Foxn3 CKO mice; (H) Top 20 gene ontology (GO) terms enriched for DEGs between the retinas of Foxn3 CKO mice and control mice; (I) Network diagram of the top 4 enriched GO terms or gene sets (nodes) and their related DEGs, with the node size indicating the gene set size; (J) Stacked violin plot of representative ciliary genes in single-cell clusters of bipolar cells, amacrine cells, cone cells, and rod cells in the retinas of control and Foxn3 CKO mice.
[0025] Figure 4Upregulation and ectopic expression of ciliary genes in the retinas of Foxn3CKO mice; (A) UMAP feature plots showing the expression patterns of the indicated ciliary genes in the retinas of control and Foxn3CKO mice; (B) qRT-PCR assay of the RNA expression levels of the indicated ciliary genes in the retinas of control and Foxn3CKO mice. Data are presented as mean ± SEM (n = 3), **p < 0.01, ***p < 0.001, ****p < 0.0001; (C) RNA in situ hybridization assay of the expression levels of the indicated ciliary genes in the retinas of control and Foxn3CKO mice. Compared with the control group, the expression of all 10 ciliary genes increased in the INL of Foxn3CKO retinas; Scale bar: (C) 20 μm; (D) Retinal sections from control and Foxn3CKO mice were immunostained with the GT335 antibody or double immunostained with GT335 and Chx10 or Tfap2a antibodies. Regions 1 and 2 are shown at higher magnification below; Scale bar: (D) 5 μm; (E) Quantification of GT335 immunoreactivity in the inner and outer halves of the inner nuclear layer of the retinas of control and Foxn3CKO mice. Data are presented as mean ± SEM (n = 3), **p < 0.01; ****p < 0.0001; Abbreviations: GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; IS, inner segment; CC, connecting cilium.
[0026] Figure 5Chromatin immunoprecipitation (ChIP) and luciferase assays revealed that Foxn3 occupies and represses the promoters of ciliary genes and ciliary regulatory transcription factors; (A) UMAP feature plots showing the expression patterns of specified ciliary transcription factor genes in the retinas of control and Foxn3 CKO mice; (B) violin plots of the expression patterns of specified ciliary transcription factor genes in single-cell clusters of bipolar and amacrine cells in the retinas of control and Foxn3 CKO mice; (C) schematic diagrams of the promoter regions of Drc1, Fam183b, Tekt1, and Foxj1 containing one or more FHL motifs (i.e., 5'-ACGC, and the FHL motif is the binding site of certain Fox transcription factors), with the transcription start site (TSS) and translation start site ATG marked in the middle, and the horizontal arrows indicating the positions of the PCR primers used to amplify the precipitated DNA fragments, and the negative control (NC) fragment is located in exon 1 of Foxj1; (D) chromatin DNA was prepared from adult mouse retinas, immunoprecipitated with an anti-Foxn3 antibody, and quantified by qRT-PCR. The data are presented as the mean ± standard error, ****p < 0.0001; ns: no difference; (E) schematic diagram of the dual-luciferase assay, with the 2-kb promoters from Cfap52, Drc1, and Foxj1 inserted into the upstream (P) region of Luc (luciferase) in the pGL3-Basic vector, and the open reading frames of the Foxj1, Rfx3, and Foxn3 transcription factors inserted into the pCI expression vector; (F) relative luciferase activities in 293T cells after co-transfection of the specified reporter plasmids with control (pCI), Foxj1, Rfx3, and / or Foxn3 expression plasmids. The bar graphs represent the mean ± standard error of triplicate analyses in a single experiment, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001; ns: no difference.
[0027] Figure 6 It is a working model diagram of Foxn3 regulating the differences in cilia of retinal photoreceptor cells and non-photoreceptor neurons. Detailed implementation methods
[0028] The following examples further illustrate the present invention rather than limiting it.
[0029] Example 1
[0030] I. Methods
[0031] 1. Construction of mouse retina-specific Foxn3 conditional knockout (Foxn3 CKO)
[0032] To obtain the Foxn3 floxed allele (Foxn3 flox / flox), we inserted loxP sites into introns 1 and 2 of the Foxn3 gene (NCBI Gene ID: 71375, the amino acid sequence of the protein it encodes is shown in SEQ ID NO.7), and inserted the frt-neo-frt structure (frt: Flippase recognition target, Flp recombinase recognition site; neo: neomycin, neomycin resistance gene) into intron 2. Using the Cre / loxP system, Six3-Cre mice specifically express Cre recombinase in retinal cells, which is used to specifically knockout the target gene in retinal cells. To specifically knockout exon 2 (Exon2) of Foxn3 in the retina, we crossed Foxn3 flox / flox mice with Six3-Cre mice to generate Foxn3 conditional knockout mice (Foxn3 flox / flox ; Six3-Cre, namely Foxn3CKO) ( Figure 2 A). The obtained Foxn3CKO mice were interbred, so that more conditional mutant mice and mice without Cre recombinase as controls (no Foxn3 gene knockout occurred) could be obtained ( Figure 2 B).
[0033] 2. Genotype identification of transgenic mice
[0034] The toes of transgenic mice were cut for labeling, and 1-2 mm of the mouse tail was placed in a 1.5 mL EP tube, 100 μL of mouse tail digestion solution (100 mM KCl, 20 mM Tris (pH 8.5), 0.1% NP40, 0.1% Tween-20) and 1 μL of proteinase K (20 mg / mL) were added, and incubated overnight in a 55 °C water bath; the next day, boiled at 95 °C for 5 min, immediately placed on ice, and then centrifuged at 12,000 rpm for 5 min. 1 μL of the supernatant was taken for PCR amplification reaction with the designed primers to identify mice containing wild-type (WT) alleles, fl alleles and Cre. The wild-type and fl alleles produced products of 246 bp and 305 bp respectively, and Cre produced a product of 480 bp. The genotype identification primers are as follows:
[0035] Foxn3-fl-F: ATGAGGCAGCTAAAGGAGTCGG,
[0036] Foxn3-fl-R: CAGGGTTTCTCTGCCTAGCCCTG;
[0037] Six3-cre-F: TCGATGCAACGAGTGATGAG,
[0038] Six3-cre-R: TTCGGCTATACGTAACAGGG。
[0039] 3. RNA in situ hybridization (ISH)
[0040] (1) Take the retinas of C57BL / 6, control group, and Foxn3 CKO mice at the corresponding time periods, fix them overnight at 4°C with 4% PFA, dehydrate them in a gradient of 10%, 20%, and 30% sucrose, and section or store them at -80°C after embedding in OCT. All materials used for in situ hybridization are RNase-free, and the reagents are prepared with DEPC water.
[0041] (2) Take out the sections, dry them in a RNase-free environment for 1 - 2 h, preheat the hybridization solution at 65°C, thaw the prepared DIG-labeled probe (probe primer sequences are shown in Table 1) on ice, prepare a probe hybridization solution with a final concentration of 0.5 - 1 μg / mL according to the probe concentration, denature it at 70°C for more than 10 min, vortex, take 150 - 200 μL and add it to the sections, carefully cover with a coverslip, and place it in a dark box containing 50% Formamide / 1×salt and hybridize overnight in a hybridization oven at 65°C.
[0042] (3) The next day, take out the sections, wash them in a washing buffer (1×SSC, 50% formamide, 0.1% Tween-20) pre-incubated at 65°C, wash at 65°C for 15 min. During this process, the coverslip will fall off. Repeat the washing step twice, 30 min each time. Transfer the sections to 1×MABT and wash them twice at room temperature, 30 min each time. This step can be paused, and the sections can be stored in 1×MABT for several hours.
[0043] (4) Wipe the liquid around the sections with lint-free paper, draw a circle around the sample with a hydrophobic pen, add an appropriate amount of ISH blocking solution (20% sheep serum, 2% blocker (Roche, 11096176001), 1×MABT), and incubate at room temperature in a humidified chamber for more than 1 h.
[0044] (5) Discard the blocking solution, add 150 - 200 μL of anti-DIG-AP antibody (Roche, 11093274910, 1:500) prepared with the blocking solution, and incubate overnight at 4°C in a humidified chamber. The next day, wash the sections 4 - 5 times with 1×MABT, 20 min each time.
[0045] (6) Add 4.5 μL of NBT and 3.5 μL of BCIP to every 1 mL of staining buffer (100 mM NaCl, 50 mM MgCl2, 100 mM Tris pH 9 - 9.5, 0.1% Tween - 20). Add an appropriate amount of chromogenic solution to the sections, incubate in the dark at room temperature, observe the degree of chromogenesis under the microscope at regular intervals. When the chromogenic color is appropriate, wash the sections several times in 1×PBS to terminate the chromogenic reaction. Finally, mount the sections with a mounting medium, observe and photograph under the microscope or store at 4°C.
[0046] Table 1 RNA in situ hybridization primer sequences
[0047]
[0048]
[0049] 4. Immunohistochemistry staining (IHC)
[0050] (1) After anesthetizing the mice, quickly remove the eyeballs, remove the muscle tissue, rinse 3 times in 1×PBS and then transfer to OCT embedding medium for cryosection embedding. Section along the vertical direction on a cryostat, with a section thickness of 14 μm, collect on glass slides, and air - dry the sections at room temperature for 30 min.
[0051] (2) Use an immunohistochemistry pen to draw a circle around the retinal sections, rinse 3 times in 1×PBS for 5 min each time. Fix with 2% PFA for 10 min, rinse 3 times in 1×PBST for 5 min each time. Then add an immunostaining blocking solution containing 10% donkey serum and 0.2% Triton X - 100, and incubate in the dark at room temperature for 1.5 h.
[0052] (3) Discard the liquid, add the primary antibody prepared with antibody diluent (5% donkey serum, 0.15% Triton X - 100), and incubate overnight at 4°C. The primary antibodies used in the experiment include: goat anti - Chx10 antibody (1:2000, catalog number: sc - 21690, Santa Cruz); rabbit anti - Tfap2a / 2b antibody (1:1000, catalog number: ab11828, Abcam); mouse anti - polyglutamylated microtubule antibody (GT335, 1:2000, catalog number: AG - 20B - 0020, AdipoGen Life Sciences).
[0053] (4) On the next day, take out the cassette and rinse it 5 times with 1×PBST for 5 min each time. Add a mixture of secondary antibodies conjugated with 488 or 594 (Life Technologies) and DAPI prepared with antibody diluent, and incubate the cassette at room temperature for 1.5 h. Discard the liquid, rinse it 5 times with 1×PBST for 5 min each time. Add a mounting medium to mount the slides (avoid generating air bubbles during mounting), and observe and photograph under an LSM700 confocal system microscope (Zeiss).
[0054] 5. Quantitative real-time RT-PCR (qRT-PCR)
[0055] Take the retinas of 3-month-old control group and Foxn3 CKO mice, extract total RNA using TRIzol reagent (Invitrogen), remove genomic DNA from 1 μg of RNA according to the RT-qPCR specific premix (Vazyme Biotech) kit, and reverse transcribe to synthesize cDNA. Subsequently, prepare the reaction system using the KAPA SYBR fast qPCR kit (Kapa) dye, and perform qRT-PCR reaction using a qTOWER 3 G real-time PCR system (Analytikjena). The obtained data is analyzed using the 2 -ΔΔct method. The primer sequences used in the experiment are shown in Table 2.
[0056] Table 2 qRT-PCR primer sequences
[0057] Gene 5' primer 3' primer Fam183b CGTGTGGGGCAGATGAAGAA GGTGATCGTCTTCCCCCAAG Tekt1 TCTCAGAGCGATGTGAACAA CCACACGCTTCTCCCTGTAT Armc2 AAACTCGAAAAGCTGGATTCC TCTTTGGGTCCTAACCGTTCT Efcab1 CAGAAGTTGACGGACACCTTA CGCTTATACAGCCATCATTG Dnah5 GATGGGCGGCATGACTATCTG GTCACGAACACCTTGGGCTT Fam92b CTGGAGGCCAAGGTCATCAG TGCTGTTGTCCCTTGAGGTC Cfap54 CAGACTCTGAGACATCGGTGT CCTCGGAGTGGGTACATTGC Drc1 GAACTGTGGGAGATGCTCAA TGATGTCTTCCGACTGTTTCT Wdr63 ACATTGAGTGTACGTCTTACC GCTACTTCAACGCTTGTGGA Rsph9 CACTGCTCACGTCCCTTATGC GCGATGTAGTAATCCGCCAC Enkur CCCAGTGACTTGAAGGAGCC TGTGCACCTCTTCCCAGTTC Kif27 ATCATCAAGTCTGTGTGAGGG CGACAGCACTAGGGGCTTTA Lrrc6 ATTAGACGGAATGCTGAGCA CCGGCACCATTTGTCAATAT
[0058] 6. Electroretinography (ERG)
[0059] Place 8-month-old control group and Foxn3 CKO mice in a dark room overnight to avoid light. On the next day, anesthetize the mice with 4.3% chloral hydrate, dilate the pupils with compound tropicamide eye drops for 3 - 5 min, and drop sodium carboxymethylcellulose eye drops to protect the cornea. Use a Roland RETI scan system device to record, with a sampling frequency of 2 kHz. Insert a needle electrode subcutaneously into the tail, and a ring recording electrode touches the cornea. A light stimulator gives a flash stimulus. Start recording according to the set program. First, perform dark adaptation recording with a light intensity of 0.0003 - 31 cd.s / m 2 , with an interval of 10 s, repeat 5 times. After that, perform light adaptation for 5 min and start light adaptation recording with a light intensity of 0.3 - 100 cd.s.m 2After recording, an ERG waveform diagram and the numerical values of the amplitudes of waves a and b were obtained, and oscillatory potentials OPs were extracted for analysis.
[0060] 7. Single-cell RNA sequencing (scRNA-seq)
[0061] Retinas of 3-month-old control group and Foxn3 CKO mice were taken. Each retina was digested with 500 μL of Accumax for 3 min, and an equal volume of medium was added to terminate the digestion. After centrifuging at 1000 rpm for 5 min to collect the cells, the cells were resuspended with 1 mL of DPBS containing 2% FBS and 1 mM EDTA, and filtered through a 40-μm (Falcon) filter. The cells were collected by centrifuging at 500 g for 5 min using a horizontal centrifuge, resuspended with DPBS containing 0.3% BSA, and then submitted to the company for viability determination and subsequent sequencing. The construction of single-cell libraries, Cell Ranger processing, and Seurat analysis refer to relevant literature. Scrublet was used to remove doublets, microglia, astrocytes, and endothelial cells, and Harmony was used to integrate single cells from the retinas of control group and Foxn3 CKO mice, and then various Seurat analyses were performed using default parameters. clusterProfiler and GSEA (gene set enrichment analysis) were used for GO term enrichment analysis.
[0062] 8. Chromatin immunoprecipitation (ChIP)
[0063] The BeyoChIP TM experimental kit was used to perform ChIP experiments. Retinas were isolated from 8-week-old adult C57BL / 6 mice and cross-linked with 1% formaldehyde at room temperature for 15 min. The reaction was terminated with 125 mM fresh glycine. A single retina cell suspension was obtained using a Dounce homogenizer. DNA was digested into fragments of 100 - 600 bp using micrococcal nuclease (MNase). Immunoprecipitation was performed with 2 μg of Foxn3 antibody or 2 μg of IgG antibody at 4°C for 16 hours. Purified DNA was analyzed using qRT-PCR. The primer amplification regions of potential Foxn3 target genes were determined by analyzing the promoters using JASPAR (http: / / jaspar.genereg.net). The ChIP primer sequences are shown in Table 3.
[0064] Table 3 ChIP primer sequences
[0065] Gene 5' primer 3' primer negative ACGCCAAGGCTCCCACTCTTC CGCGCTTCGAGATGTGCACG Foxj1 GCCAGGCACAGACTCAAACC ACGCACGCACACACACACAT Drc1 TGATGAGTGTACTTGAGTTC ATGAATATTCCTAAAAGGCA Fam183b AGGAGGCCTAATAGATACCA ACAGTTTCCAGGCAACGGAT Tekt1 CTTCTGAAAGCCACAAGATG TCATCTCATGTTCAAGGAAG
[0066] 9. Dual-luciferase reporter assay
[0067] The promoter sequences (approximately 2000 bp upstream) of Cfap52, Drc1, and Foxj1 were cloned into the pGL3-Basic reporter vector. The nucleotide sequences of the promoters of Cfap52, Drc1, and Foxj1 are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively. The open reading frames of the transcription factors Foxj1, Rfx3, and Foxn3 were inserted into the pCI expression vector. The nucleotide sequences of the open reading frames of Foxj1, Rfx3, and Foxn3 are shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively. The reporter plasmid and the expression plasmid were co-transfected into 293T cells together with the control Renilla luciferase reporter plasmid pRL-TK. After transfection and incubation, the luciferase activity was detected using the dual-luciferase reporter assay system and a luminometer.
[0068] 10. Statistical analysis
[0069] At least three retinas were analyzed for each of the control group and Foxn3 CKO mice. The quantitative reference points for each cell in the sections were the average values of 6-8 non-overlapping fields of view in similar retinal regions. Each field of view was photographed using a confocal microscope at 400x magnification. The statistical data are expressed as the mean ± standard error. Statistical analysis was performed using GraphPad Prism 8.0 and Microsoft Excel. The two-independent-sample unpaired two-tailed student’s t-test was used for comparison between the two groups. For all ERG and luciferase reporter assay data, the Benjamini-Krieger-Yekutieli corrected one-way or two-way analysis of variance was used to test for significance, and a P<0.05 was considered to indicate a significant difference.
[0070] II. Results
[0071] RNA in situ hybridization results showed that during embryonic day 14.5 (E14.5) to postnatal day 0 (P0), Foxn3 RNA transcripts were distributed throughout the retina, including progenitor cells in the outer neuroblastic layer and differentiated cells in the inner neuroblastic layer ( Figure 1 A-C). By postnatal day 4 (P4), strong in situ hybridization signals appeared in the inner nuclear layer (INL) and ganglion cell layer (GCL), while the signals in the outer nuclear layer (ONL) weakened ( Figure 1 D). At P12 and P21, Foxn3 transcripts were mainly confined to the INL and GCL and almost disappeared from the ONL ( Figure 1E, F). This dynamic expression pattern indicates that Foxn3 may be expressed in embryonic and postnatal retinal progenitor cells, as well as bipolar cells, amacrine cells, horizontal cells, Müller cells, and ganglion cells (these five cell types are located in the INL and GCL), but not in rod and cone cells (two photoreceptor cells) located in the ONL. Further analysis of single-cell RNA sequencing (scRNA-seq) data of mouse retinas at various stages, consistent with the expression of Foxn3 in embryonic and postnatal retinal progenitor cells, Foxn3 expression signals can be detected in most single cells of embryonic (E11-E18) and early postnatal (P0-P5) retinas ( Figure 1 G-M). In late postnatal and adult retinas, Foxn3 is expressed in a population of non-photoreceptor cells, while almost no expression is detected in photoreceptor cells ( Figure 1 N-P), which is consistent with the expression pattern observed by RNA in situ hybridization ( Figure 1 E, F). In gene co-expression analysis of adult retinas, it was found that Foxn3 co-localizes with Vsx2 / Chx10 in most bipolar cells, with Tfap2b in most amacrine and horizontal cells, and with Sox9 in most Müller cells ( Figure 1 Q-S). In another mouse retina dataset containing enriched single retinal ganglion cells (RGCs), it was observed that Foxn3 and Thy1 co-localize in many RGCs ( Figure 1 T). These results suggest that Foxn3 may be expressed in most non-photoreceptor cells and may play a role in their development and / or function.
[0072] We obtained mice with Foxn3 floxed alleles by homologous recombination ( Figure 2 A). These mice were further crossed with Six3-Cre transgenic mice, resulting in specific knockout of the second exon of Foxn3 in the retina (Foxn3CKO) ( Figure 2 A, B). qRT-PCR detection using primers specific for exon 2 showed that only a small amount of exon 2 expression remained in the Foxn3CKO retina compared to the control group ( Figure 2 C). Similarly, Western blotting detected only a small amount of Foxn3 protein in the Foxn3CKO retina ( Figure 2 D), which demonstrated the effectiveness of this conditional Foxn3 knockout inactivation. Adult Foxn3CKO mice appeared normal, and there were no obvious changes in the size of the eyeball, optic nerve, optic chiasm, and optic tract, as well as the retinal thickness, compared to control animals ( Figure 2E - G). To evaluate the effect of Foxn3 knockout on visual function, we recorded the electroretinogram (ERG) responses of 8 - month - old control mice and Foxn3 CKO mice. Under dark - adapted conditions and at almost all tested flash intensities (0.01 - 10.0 cd.s / m 2 ), compared with the control group, the amplitude of the dark - adapted b - wave in mutant mice was significantly reduced ( Figure 2 H, J). However, there was no significant change in the amplitude of the dark - adapted a - wave in mutant mice ( Figure 2 H, I). In addition, there were no significant differences in the amplitudes of the light - adapted a - wave and b - wave between the control group and mutant mice ( Figure 2 K - M). In addition, compared with control mice, at 3.0 cd.s / m 2 , the oscillatory potentials (OPs) in the dark - adapted ERG responses of mutant mice were significantly reduced ( Figure 2 N). There was no significant change in light - adapted OPs between the control group and mutant mice ( Figure 2 O). Since the b - wave is mainly generated by bipolar cells, and OPs reflect the interaction between retinal neuron types including amacrine cells, bipolar cells, and retinal ganglion cells (RGCs), their defects suggest that Foxn3 knockout may lead to developmental and / or functional defects in these cell types.
[0073] To explore the molecular mechanism underlying visual defects caused by Foxn3 knockout, single - cell RNA sequencing (scRNA - seq) analysis was performed on the retinas of adult control and Foxn3 CKO mice. After removing cell doublets, microglia, astrocytes, and endothelial cells, the data were integrated using Harmony, and expression data from 47,330 single cells from control and mutant retinas were obtained. Subsequently, unsupervised label - based UMAP clustering was performed using Seurat 4 to identify cell clusters of 6 major retinal neuron types and the Müller glial cell (MG) cluster ( Figure 3 A). Comparison of genotype - specific cell clusters showed that all 7 major retinal cell types were present in both control and Foxn3 CKO retinas ( Figure 3 B, C). Further differential gene expression analysis was performed using Seurat and visualized by scatter plots, volcano plots, and expression heatmaps, all of which showed that far more genes were upregulated than downregulated in Foxn3 CKO retinas compared with the control group. A total of 289 differentially expressed genes (DEGs) (change ≥ 2 and p - value < 0.05) were identified in mutant retinas, of which 170 were upregulated and 119 were downregulated ( Figure 3D-F). Dot plots of the upregulated DEGs before plotting showed that in the Foxn3 CKO retina, almost all of these genes were significantly upregulated in bipolar cells and to a lesser extent in amacrine cells; while in cone and rod cells, their expression was basically unchanged or only minimally changed ( Figure 3 G). In addition, in the control retina, most of these upregulated DEGs were not expressed or had low expression levels in bipolar cells, amacrine cells, horizontal cells, and RGCs ( Figure 3 G), indicating that Foxn3 is a transcriptional repressor of these DEGs in these non-photoreceptor neuron types, consistent with its expression pattern ( Figure 1 ). Therefore, the gene upregulation observed in the Foxn3 CKO retina showed cell type specificity, i.e., limited to non-photoreceptor neuron types in the retina. Gene ontology (GO) term enrichment analysis of the functions of Foxn3-dependent DEGs showed that these DEGs were almost completely enriched in genes related to ciliogenesis and ciliary function. They were related to numerous cilia-related GO terms, such as ciliary organization, cilia assembly, ciliary motility, cilia-dependent cell motility, axoneme assembly, and epithelial ciliary motility involved in extracellular fluid movement, etc. ( Figure 3 H, I). Visualization of dot plots and violin plots of the expression patterns of a large number of cilia genes confirmed that most of them were upregulated in bipolar cells and amacrine cells ( Figure 3 J), while the expression of these cilia genes in cone and rod cells was basically unchanged ( Figure 3 J). Notably, although most cilia genes were not expressed or had weak expression in bipolar cells and amacrine cells of the control retina, many of these genes were normally expressed in photoreceptor cells (especially cone cells) ( Figure 3 J). Therefore, the deletion of Foxn3 led to the ectopic expression of cilia genes in non-photoreceptor neurons in the retina (especially bipolar cells and amacrine cells), indicating that Foxn3 is a transcriptional repressor.
[0074] To confirm the upregulation of cilia genes in the Foxn3 CKO retina, the expression patterns of more than a dozen representative cilia genes in the control and Foxn3 CKO retinas were first compared by feature plots. Most of these genes, including Armc2, Ccdc39, Cfap52, Dnah5, Drc1, Fam183b, Ift22, Spef2, and Tekt1, were weakly expressed in bipolar cells and amacrine cells of the control retina, while their expression was significantly increased in these two cell types in the Foxn3 CKO retina ( Figure 4A). Some of the ciliary genes examined, such as Ahi1, Rpgr, and Tub, were strongly expressed in all retinal cell types (including photoreceptor and non-photoreceptor cells) of the control retina. Although the expression patterns of these genes were rather ubiquitous in the control group, there was still a significant upregulation in bipolar cells and amacrine cells of the Foxn3CKO retina, while there was no change in photoreceptor cells ( Figure 4 A). Therefore, ciliary genes seem to be ectopically overexpressed in bipolar cells and amacrine cells of the Foxn3CKO retina. Further qRT-PCR results showed that ciliary genes including Armc2, Cfap54, Dnah5, Drc1, Efcab1, Enkur, Fam92b, Fam183b, Kif27, Lrrc6, Rsph9, Tekt1, and Wdr63 were all significantly upregulated in the Foxn3CKO retina, showing a 2- to 100-fold increase compared to the control retina ( Figure 4 B). Visualization of ciliary gene transcripts by RNA in situ hybridization showed that compared to the control group, the hybridization signals of genes such as Ahi1, Armc9, Drc1, Fam183b, Ift43, Rpgr, Rsph9, Spef2, Tekt1, and Tub were significantly enhanced in the inner nuclear layer (INL) of the Foxn3CKO retina, while the signals in the outer nuclear layer (ONL) were similar ( Figure 4 C). Considering that bipolar cells and amacrine cells are located in the INL, this result indicates that these genes are likely to be upregulated in these two cell types, consistent with the single-cell RNA sequencing data ( Figure 3 J、 Figure 4 A). To determine whether the widespread upregulation of ciliary genes would lead to ectopic ciliogenesis in the Foxn3CKO retina, we used the GT335 monoclonal antibody to detect and compare cell cilia in control and mutant retinas by immunostaining. GT335 can specifically recognize polyglutamylated α- and β-tubulin located at the ciliary transition zone or connecting cilium of photoreceptor cells. The results showed that in both the control and mutant retinas, GT335 strongly labeled the connecting cilia of photoreceptor cells. Within the INL, it detected numerous cilia in both the inner and outer halves of the mutant retina, but only labeled cilia in the inner half of the control retina ( Figure 4 D). Since the GT335+ cilia were closely adjacent to the nuclei immunoreactive with the bipolar cell marker Chx10, it was inferred that the ectopic cilia in the outer half of the INL of the mutant retina were located in bipolar cells ( Figure 4 D). Similarly, since the GT335+ cilia were closely adjacent to the nuclei immunoreactive with the amacrine cell marker Tfap2a, the GT335+ cilia in the inner half of the INL of the control and mutant retinas were identified as amacrine cell cilia (Figure 4 D). The number of GT335-immunoreactive cilia in the INL was counted. The number of cilia in the outer half increased by approximately 77-fold, and that in the inner half increased by 1-fold, indicating that Foxn3 inactivation led to abnormal ciliogenesis in bipolar cells and amacrine cells ( Figure 4 E).
[0075] Studies have shown that the expression of ciliary genes is mainly activated by transcription factors of the Foxj1 and Rfx families. Our profiling maps showed that Rfx1, 2, and 5 were weakly expressed in the control retina, but were significantly upregulated in bipolar cells and amacrine cells of the Foxn3 CKO retina. Rfx3 and 7 were strongly expressed in all retinal cell types of the control retina and were significantly upregulated in bipolar cells and amacrine cells of the mutant retina ( Figure 5 A, B). Foxj1 was weakly expressed in non-photoreceptor neurons of the control group, but was significantly upregulated in bipolar cells and amacrine cells of the Foxn3 CKO retina ( Figure 5 A, B). These results suggest that Foxn3 may inhibit ciliary gene expression by regulating the expression of these ciliary gene transcriptional activators, Foxj1 and the Rfx family. To determine whether Foxn3 can bind to and occupy the promoter regions of ciliary genes, we performed chromatin immunoprecipitation (ChIP) assays using chromatin DNA prepared from adult mouse retinas. One or more FHL sequence motifs (5’-ACGC) were found within the 2 kb region upstream of the transcription start site (TSS) of the ciliary genes Drc1, Fam183b, and Tekt1, as well as the ciliary activating transcription factor Foxj1 ( Figure 5 C). Correspondingly, DNA fragments of the promoter regions of these 4 genes (containing at least one FHL motif) were specifically enriched using an anti-Foxn3 antibody, while there was no significant enrichment for the exon fragment of Foxj1 that does not contain a Fox binding motif ( Figure 5 C, D). These results indicate that Foxn3 can occupy the promoter regions of ciliary genes and their transcriptional activator Foxj1 in vivo. Further dual-luciferase activity assays showed that transient transfection of expression plasmids for the positive ciliary gene regulators Foxj1 and Rfx3 significantly increased the luciferase activity of reporter plasmids containing the Cfap52, Drc1, or Foxj1 promoter compared with the control group ( Figure 5 E, F), and this effect was essentially offset by co-transfection of the Foxn3 expression plasmid ( Figure 5 F), indicating that Foxn3 is a strong negative transcriptional regulator of ciliary gene expression.
[0076] In summary, the working model of Foxn3 regulating ciliary differences in retinal photoreceptor cells and non-photoreceptor neurons is as shown in Figure 6 as follows.
[0077] (1) In the mammalian retina, the outer segments of rod and cone cells have a large number of special sensory cilia, while non-photoreceptor neurons only have simple primary cilia (such as amacrine cells and RGCs); Foxn3 may act as a transcriptional repressor of ciliary genes and play a key role in cilia differentiation and maintenance.
[0078] (2) The ciliary gene activator Rfx family, especially Rfx3 and Rfx7, may promote the differentiation and formation of sensory cilia in photoreceptor cells. In the late postnatal and adult retina, Foxn3 is strongly expressed in non-photoreceptor neurons but not in photoreceptor cells. Foxn3 seems to prevent non-photoreceptor neurons from adopting sensory cilia similar to those of photoreceptor cells and enabling them to form only simple primary cilia or no cilia by directly inhibiting ciliary gene expression and indirectly inhibiting ciliary gene expression by suppressing the expression of Rfx genes and Foxj1.
[0079] (3) Both Foxn3 and Rfx can autoregulate their own expression, fine-tuning the expression of ciliary genes to ensure that they are maintained at appropriate levels, which is beneficial for the formation of complex sensory cilia in photoreceptor cells or simple primary cilia in non-photoreceptor neurons.
Claims
1. Use of Foxn3 protein in the preparation of a drug for treating retinal ciliary diseases, characterized in that, The amino acid sequence of the described Foxn3 protein is shown in SEQ ID NO.
7.
2. Use of the Foxn3 gene in the preparation of a drug for treating retinal ciliary diseases, characterized in that, The nucleotide sequence of the described Foxn3 gene is shown in SEQ ID NO.
6.
3. Use of a recombinant vector containing the Foxn3 gene according to claim 2 in the preparation of a drug for treating retinal ciliopathy.
4. The application according to claim 3, characterized in that, The described vector is a lentiviral vector or an adeno-associated viral vector.
5. The application according to claim 3, characterized in that, The described drug for treating retinal ciliopathy specifically overexpresses the Foxn3 gene and / or protein in retinal non-photoreceptor neurons.
6. The application according to claim 3, characterized in that, The described drug for treating retinal ciliopathy is a drug that inhibits abnormal cilium formation in retinal non-photoreceptor neurons.
7. The application according to claim 6, wherein The described retinal non-photoreceptor neurons are retinal bipolar cells and amacrine cells.
8. A drug for treating retinal ciliopathy, which contains the Foxn3 protein according to claim 1, a recombinant vector containing the Foxn3 gene according to claim 2, or a recombinant virus containing the Foxn3 gene according to claim 2.