A PRRSV monoclonal antibody and its Tibetan pig semen ELISA detection kit

Abstract

The present invention provides a detection antibody, a detection reagent, and their use for detecting pseudorabies virus in Tibetan pig semen. The monoclonal antibody can specifically identify PRRSV in Tibetan pig semen. The fluorescent test strip containing the antibody and the detection method thereof are simple to operate, capable of rapidly and simultaneously testing a large number of samples, and exhibit high sensitivity and specificity. This is the first test kit in China and internationally that can accurately and rapidly detect PRRSV in Tibetan pig semen samples.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a PRRSV monoclonal antibody and a Tibetan pig semen ELISA detection kit thereof. Background Art

[0002] The widespread prevalence of porcine reproductive and respiratory syndrome (PRRS) has caused severe economic losses to the swine industry and impacted its sustainable development. PRRS has profound impacts on multiple aspects of the swine industry, primarily manifesting in decreased production performance, reproductive problems, increased mortality, and economic losses. Pigs infected with PRRS experience a 10% to 20% slower growth rate, resulting in longer time to market, increased feeding costs, and reduced production efficiency. Studies have shown that PRRS infection can cause fetal maceration, stillbirths, and premature births in sows, leading to a 15% to 30% reduction in litter size and severely impacting reproductive performance. Furthermore, because PRRS infection reduces pig immunity, mortality can increase by 5% to 15%, further exacerbating losses and stress for farmers. Depending on the region and size of the farm, PRRS infection can result in economic losses of between US$10 and US$30 per pig for farmers. Therefore, effective preventive measures and management practices are urgently needed to ensure the sustainable development of the swine industry.

[0003] Tibetan pigs are a type of pig bred in high-altitude areas such as the Tibet Autonomous Region of my country. They are well-adapted to the cold, low-oxygen climate of the plateau and boast excellent meat quality. They are a grazing-based breed well-suited to the low-oxygen, cold climate and extensive feeding and management conditions of the plateau. They have low litter sizes, slow growth, and excellent meat quality. Their muscle is high in crude protein, unsaturated fatty acids, and essential fatty acids, making them a health-conscious meat that meets modern consumer needs. Linzhi, as the origin and main production area of ​​Tibetan pigs, has vigorously developed its Tibetan pig industry in recent years, establishing itself as a core production area. However, as Tibetan pig farming continues to expand, the harm caused by PRRS has also increased. It has become a reproductive barrier disease in large-scale pig farms, posing a threat to the healthy development of the Tibetan pig industry. Currently, reports of PRRS in Tibetan pigs are relatively rare, necessitating urgent PRRS prevention and control efforts, including PRRS serological epidemiological surveys. Implementing Tibetan pig semen purification not only increases the utilization rate of high-quality Tibetan pig breeding boars, improves sow conception rates, and litter size, but also reduces the number of breeding boars maintained, thereby lowering production costs. At the same time, it can also avoid the spread of diseases through mating, thereby improving the economic benefits of pig production. Summary of the Invention

[0004] To solve the above technical problems, the present invention provides a PRRSV monoclonal antibody, which can specifically bind to PRRSV.

[0005] Furthermore, the present invention provides a detection reagent for rapidly detecting PRRSV in Tibetan pig semen based on the antibody.

[0006] Furthermore, the amino acid sequence of the light chain variable region of the monoclonal antibody 7D12 that specifically recognizes PRRSV is: DIVMTQALSNPVTSASLGSSC RSKSLLHIRNYTSLF WYLQPDGTPQLLIY QMSLHLAS GVPDRFSSSGSGTDFTLRISSLTISNLDQC AQNNTLPYT FGGGTRVLEIK (SEQ ID NO. 1), wherein LCDR1-3 are underlined;

[0007] Its nucleotide sequence is:

[0008] gatattgtgatgacccaggcgctgagcaacccggtgaccagcgcgagcctgggcagcagctgccgcagcaaaagcctgctgcatattcgcaactataccagcctgttttggtatctgcagccggatggcaccccgcagctgctgatttatcagatgagcctgca tctggcgagcggcgtgccggatcgctttagcagcagcggcagcggcaccgattttaccctgcgcattagcagcctgaccattagcaacctggatcagtgcgcgcagaacaacaccctgccgtatacctttggcggcggcacccgcgtgctggaaattaaa(SEQ ID NO.3);

[0009] The amino acid sequence of its heavy chain variable region is:

[0010] EVQLVESGGGLVGSLKLSCALSCASGF TFSYGMS WVRQTPEKRRLELWVA TISRGTYPSYSNSG RFTIDNAKAKTL YLQMSLMNSLRSYYCTR EGIFFNFYVEYSAMY WGQTTLTVSS (SEQ ID NO. 2), wherein HCDR1-3 are underlined;

[0011] Its nucleotide sequence is:

[0012] gaagtgcagctggtggaaagcggcggcggcctggtgggcagcctgaaactgagctgcgcgctgagctgcgcgagcggctttacctttagctatggcatgagctgggtgcgccagaccccggaaaaacgccgcctggaactgtgggtggcgaccattagccgcggcacctatccgagcta tagcaacagcggccgctttaccattgataacgcgaaagcgaaaaccctgtatctgcagatgagcctgatgaacagcctgcgcagctattattgcacccgcgaaggcattttttttaacttttatgtggaatatagcgcgatgtattggggccagaccaccctgaccgtgagcagc(SEQ ID NO.4).

[0013] Furthermore, the antibody may be modified with a label; the label is preferably an enzyme, fluorescein, chemiluminescent substance or fluorescence;

[0014] Furthermore, the present invention also provides a product for detecting PRRSV in a sample, wherein the product comprises the above-mentioned monoclonal antibody. Preferably, the sample is a Tibetan pig semen sample.

[0015] Furthermore, the product is an ELISA detection kit, which includes a coated enzyme-labeled plate, a blocking solution, a sperm washing solution, an enzyme-labeled secondary antibody, a washing solution, a color developer, and a stop solution, wherein:

[0016] Coating the ELISA plate: Dilute the monoclonal antibody 7D12 to 1.0 μg / mL in CBS buffer (0.05 M carbonate-bicarbonate buffer, pH 9.6). Apply 100 μL of the solution to a 96-well ELISA plate and coat overnight at 4°C. Remove the plate the next day and wash it three times with PBST for 3 minutes each. Block the plate with 1% BSA in PBST (100 μL) per well and block at 37°C for 1 hour. After blocking, wash the plate three times with PBST for 3 minutes each. Place the plate in a 96-well ELISA plate bag, seal it with a sealing machine, and store at 4°C.

[0017] Horseradish peroxidase-labeled monoclonal antibody 7D12 was used as the enzyme-labeled antibody;

[0018] Sperm washing solution: based on 1L of system, Tris 25-35g, citric acid 8-11g, glucose 8-15g, cysteine ​​3-8mM;

[0019] Washing solution (25×PBST): NaCl 100.0 g, KCl 0.2 g, MgCl2·6H2O 2.5 g, KH2PO4 5.0 g, Na2HPO4 28.5 g, Tween-20 12.5 mL, thimerosal 2.5 g, dilute to 1000 mL with distilled water, add 0.02% sodium azide as a preservative, sterilize and filter, then aliquot;

[0020] Blocking solution (1% BSA): 1.0 g bovine serum albumin dissolved in 100 mL washing solution;

[0021] TMB colorimetric solution;

[0022] Stop solution: Take 54.3mL of 95% concentrated sulfuric acid and add distilled water to 1000mL;

[0023] Positive control: Tibetan pig PRRSV positive serum;

[0024] Negative control: Weigh an appropriate amount of BSA into PBS solution to a concentration of 2 μg / mL, add 1000 IU of penicillin and streptomycin per mL, sterilize and filter, and powder as a positive control.

[0025] Furthermore, the present invention provides an ELISA method for detecting PRRSV in Tibetan pig semen for non-diagnostic purposes, specifically:

[0026] 1) Take an ELISA plate, dilute the washing solution with distilled water, wash the plate once (200 μl / well, incubate at room temperature for 5 minutes), and pat dry.

[0027] 2) Add the sample to be tested, 100 μl / well, set up positive and negative controls, and incubate at 37°C for 1 hour;

[0028] 3) Discard the sample liquid to be tested,

[0029] 4) Pat the plate dry and add HRP-labeled antibody at a 1:3000 dilution, 100 μl / well, and incubate at 37°C for 1 hour.

[0030] 5) Discard the enzyme-labeled antibody and add washing buffer (200 μl / well) for three washes, each for 3 minutes.

[0031] 6) Add 50 μl of freshly prepared substrate A and B to each well and develop the color for 10 min at room temperature in the dark.

[0032] 7) Stop the reaction: Add 50 μl of stop solution to each well to terminate the reaction. Immediately read the absorbance of each well at 450 nm on a microplate reader. An ELISA test is considered valid if the positive control OD value is greater than 0.8 and the negative control OD value is less than 0.2. Both positive and negative controls must remain within this range; otherwise, the test results will be invalid.

[0033] Beneficial effects

[0034] The present invention provides a monoclonal antibody 7D12 that specifically recognizes PRRSV. The monoclonal antibody can specifically recognize PRRSV in Tibetan pig semen. The ELISA method using this antibody is simple to operate, capable of rapidly testing a large number of samples simultaneously, and exhibits high sensitivity, high specificity, a short detection time, and a wide range of sample detection capabilities. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 The kit specificity test results showed that the test result was positive for PPRSV, while the test results for other major viral diseases in the pig herd were all negative. Example

[0036] The present invention is described in detail below with reference to the accompanying drawings and examples. The examples described below are merely preferred embodiments of the present invention. It should be noted that the following description is merely for the purpose of explaining the present invention and does not limit the present invention in any form. Any simple modifications, equivalent changes, and modifications made to the embodiments based on the technical essence of the present invention fall within the scope of the technical solution of the present invention.

[0037] In the following examples, the materials, plasmids, reagents, etc. used were obtained from commercial sources unless otherwise specified.

[0038] Example 1 Screening and Identification of Monoclonal Antibody 7D12 That Specifically Recognizes PRRSV

[0039] Based on the early research results, ORF5 amplification primers (ORF5-F:

[0040] ATGTTGCGGAAATGCTAGACC; ORF5-R: CTACAATCGACGCCATTGTTC). RNA was extracted from the specimen using a viral RNA extraction kit and reverse transcribed into cDNA. PCR amplification was performed using the aforementioned ORF5-specific primers. GP5 protein was expressed and purified. After affinity purification using a Ni-NTA-His column, a highly pure protein was obtained. Using the purified PRRSV GP5 protein as an immunogen, the monoclonal antibody 7D12 was screened and identified using conventional methods. Sequencing results revealed the amino acid sequence of its light chain variable region to be:

[0041] DIVMTQALSNPVTSASLGSSC RSKSLLHIRNYTSLF WYLQPDGTPQLLIY QMSLHLAS GVPDRFSSSGSGTDFTLRISSLTISNLDQC AQNNTLPYTFGGGTRVLEIK (SEQ ID NO. 1), wherein the underlined residues are LCDR1-3, specifically, LCDR1 is RSKSLLHIRNYTSLF (SEQ ID NO. 5); LCDR2 is QMSLHLAS (SEQ ID NO. 6); and LCDR3 is AQNNTLPYT (SEQ ID NO. 7);

[0042] Its nucleotide sequence is:

[0043] gatattgtgatgacccaggcgctgagcaacccggtgaccagcgcgagcctgggcagcagctgccgcagcaaaagcctgctgcatattcgcaactataccagcctgttttggtatctgcagccggatggcaccccgcagctgctgatttatcagatgagcctgca tctggcgagcggcgtgccggatcgctttagcagcagcggcagcggcaccgattttaccctgcgcattagcagcctgaccattagcaacctggatcagtgcgcgcagaacaacaccctgccgtatacctttggcggcggcacccgcgtgctggaaattaaa(SEQ ID NO.3);

[0044] The amino acid sequence of its heavy chain variable region is:

[0045] EVQLVESGGGLVGSLKLSCALSCASGF TFSYGMS WVRQTPEKRRLELWVA TISRGTYPSYSNSG RFTIDNAKAKTL YLQMSLMNSLRSYYCTR EGIFFNFYVEYSAMY WGQTTLTVSS (SEQ ID NO. 2), wherein the underlined HCDR1-3, specifically, HCDR1 is TFSYGMS (SEQ ID NO. 8); HCDR2 is TISRGTYPSYSNSG (SEQ ID NO. 9); HCDR3 is EGIFFNFYVEYSAMY (SEQ ID NO. 10);

[0046] Its nucleotide sequence is:

[0047] gaagtgcagctggtggaaagcggcggcggcctggtgggcagcctgaaactgagctgcgcgctgagctgcgcgagcggctttacctttagcta

[0048] tggcatgagctgggtgcgccagaccccggaaaaacgccgcctggaactgtgggtggcgaccattagccgcggcacctatccgagctatagc

[0049] aacagcggccgctttaccattgataacgcgaaagcgaaaaccctgtatctgcagatgagcctgatgaacagcctgcgcagctattattgcacccgcgaaggcatttttttttaacttttatgtggaatatagcgcgatgtattggggccagaccaccctgaccgtgagcagc (SEQ ID NO. 4). For specific operations, please refer to the previous basic application of this application (CN2025103557710).

[0050] Example 2 Establishment and Optimization of ELISA Detection Method in Tibetan Pig Semen

[0051] Coating the ELISA plate: Dilute the monoclonal antibody 7D12 in CBS buffer (0.05 M carbonate-bicarbonate buffer, pH 9.6) and apply 100 μL to a 96-well ELISA plate. Incubate at 4°C overnight. Remove the plate the next day and wash it three times with PBST for 3 minutes each. Block the plate with 1% BSA in PBST (100 μL) per well and incubate at 37°C for 1 hour. After blocking, wash the plate three times with PBST for 3 minutes each. Place the plate in a 96-well ELISA plate bag, seal it with a sealing machine, and store at 4°C.

[0052] Horseradish peroxidase-labeled monoclonal antibody 7D12 was used as the enzyme-labeled antibody;

[0053] Sperm washing solution (based on 1L system, Tris 25-35g, citric acid 11-8g, glucose 8-15g, cysteine ​​3-8mM);

[0054] Washing solution (25×PBST): NaCl 100.0 g, KCl 0.2 g, MgCl2·6H2O 2.5 g, KH2PO4 5.0 g, Na2HPO4 28.5 g, Tween-20 12.5 mL, thimerosal 2.5 g, dilute to 1000 mL with distilled water, add 0.02% sodium azide as a preservative, sterilize and filter, then aliquot;

[0055] Blocking solution (1% BSA): 1.0 g bovine serum albumin dissolved in 100 mL washing solution;

[0056] TMB colorimetric solution;

[0057] Stop solution: Take 54.3mL of 95% concentrated sulfuric acid and add distilled water to 1000mL;

[0058] Positive control: PRRSV positive control serum (provided by China Veterinary Drug Administration);

[0059] Negative control: Weigh an appropriate amount of BSA into PBS solution to a concentration of 2 μg / mL, add 1000 IU of penicillin and streptomycin per mL, sterilize and filter, and powder as a positive control.

[0060] Optimization of ELISA detection parameters

[0061] The optimal antibody coating concentration and serum dilution were determined using the square array method. The results showed that the optimal antigen coating concentration was 1.0 μg / mL and the optimal serum dilution was 1:400 (Table 1).

[0062] Table 1 Determination of optimal antibody coating concentration and serum dilution

[0063]

[0064] The optimal action time was determined, and the results showed that the optimal action time was 1 h at 37°C (Table 2).

[0065] Table 2 Optimal action time

[0066]

[0067] The optimal working concentration of the enzyme-labeled antibody was determined. The results showed that the optimal working concentration of the enzyme-labeled antibody for ELISA was 1:3000 (Table 3).

[0068] Table 3 Optimal enzyme-labeled antibody working concentration for ELISA

[0069]

[0070]

[0071] The optimal working time of enzyme-labeled secondary antibody was determined. The results showed that the optimal enzyme-labeled secondary antibody action time for ELISA was 1 h at 37°C (Table 4).

[0072] Table 4 Optimal enzyme-labeled secondary antibody action time

[0073]

[0074] In summary, the operating steps of the ELISA detection method for PRRSV in Tibetan pig samples were finally determined

[0075] 1) Take an ELISA plate, dilute the washing solution with distilled water, wash the plate once (200 μl / well, incubate at room temperature for 5 minutes), and pat dry.

[0076] 2) Add the sample to be tested, 100 μl / well, set up positive and negative controls, and incubate at 37°C for 1 hour;

[0077] 3) Discard the sample liquid to be tested,

[0078] 4) Pat the plate dry and add HRP-labeled antibody at a 1:3000 dilution, 100 μl / well, and incubate at 37°C for 1 hour.

[0079] 5) Discard the enzyme-labeled antibody and add washing buffer (200 μl / well) for three washes, each for 3 minutes.

[0080] 6) Add 50 μl of freshly prepared substrate A and B to each well and develop the color for 10 min at room temperature in the dark.

[0081] 7) Stop the reaction: Add 50 μl of stop solution to each well to terminate the reaction. Immediately read the absorbance of each well at 450 nm on a microplate reader. An ELISA test is considered valid if the positive control OD value is greater than 0.8 and the negative control OD value is less than 0.2. Both positive and negative controls must remain within this range; otherwise, the test results will be invalid.

[0082] Kit sensitivity test

[0083] After serial dilutions of 1:2 to 1:32, 50 μL of each dilution was added to the antigen-coated wells. Then, 50 μL of the monoclonal antibody diluted according to the kit instructions was added. The inhibition rate (PI) of the positive reference serum after a 1:32 dilution was ≥30%. Strong positive serum controls, weak positive serum controls, negative serum controls, and a serum blank control were also established. Two replicate wells were prepared for each sample. The PI of the strong positive control serum was between 80% and 110%; the PI of the weak positive control serum was between 30% and 70%; and the PI of the negative control serum was between 10% and 15%. The OD450nm of the blank control was between 0.74 and 2.1.

[0084] After 10 PRRSV-positive reference sera were diluted in multiples, the sensitivity test of the ELISA detection kit prepared in the laboratory was carried out. The results showed that the maximum dilution multiple of the ELISA kit prepared by the present invention for detecting positive reference sera was 640 to 2560 times (Table 5), indicating that the trial kit has good sensitivity.

[0085] Table 5 ELISA kit test results for different dilutions of positive reference serum

[0086] sample 1:20 1:40 1:80 1:160 1:320 1:640 1:1280 1:2560 1:5120 1 + + + + + + - - - 2 + + + + + + + - - 3 + + + + + + + - - 4 + + + + + + + + - 5 + + + + + + - - - 6 + + + + + + + + - 7 + + + + + + - - - 8 + + + + + + + - - 9 + + + + + + + + - 10 + + + + + + - - -

[0087] After 10 PRRSV-positive reference semen samples were diluted in multiples, the sensitivity test of the ELISA detection kit prepared in the laboratory was carried out. The results showed that the maximum dilution factor of the ELISA kit prepared by the present invention for detecting positive reference semen was 80 to 320 times (Table 6), indicating that the trial kit can be used for semen detection and meets the requirements of clinical diagnostic kits.

[0088] Table 6 ELISA kit test results for different dilutions of positive reference semen

[0089] sample 1:10 1:20 1:40 1:80 1:160 1:320 1:640 1 + + + + + + - 2 + + + + + - - 3 + + + + + + - 4 + + + + + - - 5 + + + + + + - 6 + + + + + + - 7 + + + + + - - 8 + + + + + - - 9 + + + + + - - 10 + + + + + + -

[0090] Repeatability test results showed that the maximum intra-batch coefficient of variation of ELISA was 2.47%, and the maximum inter-batch coefficient of variation was 4.12%, both less than 5% (Table 7), indicating that the established ELISA method has high repeatability.

[0091] Table 7 ELISA repeatability test

[0092] sample Intra-assay coefficient of variation Inter-batch coefficient of variation S1 0.98 1.98 S2 2.47 2.75 S3 1.94 3.75 S4 0.84 4.12 S5 1.07 1.14

[0093] Kit-specific test

[0094] The test was performed with foot-and-mouth disease virus (FMDV), porcine parvovirus (PPV), classical swine fever virus (HCV), Japanese encephalitis virus (JEV), porcine circovirus (PCV), pseudorabies virus (PRV) and swine influenza virus (SIV), and the positive and negative controls of this kit were used as references. Figure 1 ) showed that the kit of the present invention has good specificity (PPRSV detection is positive, while the detection results of other major viral diseases of the pig herd are all negative). It shows that the kit of the present invention has good specificity and can be used for clinical detection of PRRSV.

[0095] Clinical stability test

[0096] The test kits to be tested were randomly selected from the same batch and divided into two parts. One part was placed in a 4°C refrigerator, and the other part was placed in a 37°C constant temperature box. After 15 days, it was taken out and placed in a 4°C refrigerator for equilibrium overnight. The stability test was performed using a positive quality control product. The test results of the two were the same, confirming that the test kit of this application has good stability.

[0097] The above description of the embodiments is intended to facilitate understanding and use of the present invention by those skilled in the art. Those skilled in the art will readily be able to make various modifications to these embodiments and apply the general principles described herein to other embodiments without resorting to creative effort. Therefore, the present invention is not limited to the above-described embodiments. Any improvements or modifications made by those skilled in the art based on the principles of the present invention that do not depart from the scope of the present invention should be considered within the scope of protection of the present invention.

Claims

1. A monoclonal antibody 7D12 that specifically recognizes PRRSV, characterized in that The LCDR1-3 of the light chain variable region of the monoclonal antibody are RSKSLLHIRNYTSLF, QMSLHLAS and AQNNTLPYT respectively; the HCDR1-3 of the heavy chain variable region are TFSYGMS, TISRGTYPSYSNSG and EGIFFNFYVEYSAMY respectively.

2. A product for detecting PRRSV in a sample, comprising the monoclonal antibody 7D12 according to claim 1.

3. The product according to claim 2, which is an ELISA detection kit, comprising a coated enzyme-labeled plate, a blocking solution, a sperm washing solution, an enzyme-labeled secondary antibody, a 25×PBST washing solution, a color developer, and a stop solution.

4. The product according to claim 3, wherein ELISA plate coating: Dilute monoclonal antibody 7D12 to 1.0 μg / mL in CBS buffer, apply 100 μL to a 96-well ELISA plate, and coat overnight at 4°C. Remove the plate the next day and wash it three times with PBST for 3 minutes each. Add 100 μL of 1% BSA in PBST as blocking buffer to each well and block at 37°C for 1 hour. CBS buffer is 0.05 M carbonate-bicarbonate buffer, pH 9.

6. After blocking, wash the plate three times with PBST for 3 minutes each. Place the plate in a 96-well ELISA plate packaging bag, seal it with a sealer, and store at 4°C. Horseradish peroxidase-labeled monoclonal antibody 7D12 was used as the enzyme-labeled antibody; Sperm washing solution: based on 1L of system, Tris 25-35g, citric acid 8-11g, glucose 8-15g, cysteine ​​3-8mM; 25× PBST washing solution: NaCl 100.0 g, KCl 0.2 g, MgCl2·6H2O 2.5 g, KH2PO4 5.0 g, Na2HPO4 28.5 g, Tween-20 12.5 mL, thimerosal 2.5 g, dilute to 1000 mL with distilled water, add 0.02% sodium azide as a preservative, sterilize and filter, then aliquot; Blocking solution: 1% BSA, i.e., 1.0 g of bovine serum albumin dissolved in 100 mL of diluted 25× PBST washing solution; TMB colorimetric solution; Stop solution: Take 54.3mL of 95% concentrated sulfuric acid and add distilled water to 1000mL; Positive control: Tibetan pig PRRSV positive serum; Negative control: Weigh an appropriate amount of BSA into PBS solution to a concentration of 2 μg / mL, add 1000 IU of penicillin and streptomycin per mL, sterilize and filter, and powder as a positive control.

5. An ELISA method for detecting PRRSV in Tibetan pig semen for non-diagnostic purposes, specifically: 1) Take an ELISA plate and dilute the diluted 25× PBST wash buffer with distilled water. Wash the plate once with 200 μl / well. Incubate at room temperature for 5 minutes and pat dry. 2) Add the sample to be tested, 100 μl / well, set up positive and negative controls, and incubate at 37°C for 1 hour; 3) Discard the sample liquid to be tested, 4) Pat the plate dry and add HRP-labeled antibody at a 1:3000 dilution, 100 μl / well, and incubate at 37°C for 1 hour. 5) Discard the enzyme-labeled antibody and add diluted 25× PBST washing solution (200 μl / well) for three washes, each for 3 minutes. 6) Add 50 μl of freshly prepared substrate A and B to each well and develop the color for 10 min at room temperature in the dark. 7) Stop the reaction: Add 50 μl of stop solution to each well to terminate the reaction; immediately read the absorbance of each well at OD450 nm on a microplate reader. The ELISA test is considered valid if the OD value of the positive control is greater than 0.8 and the OD value of the negative control is less than 0.2.

Images