ITPR1 gene-based SNP molecular marker related to porcine hypoxia sensitivity and use thereof

Abstract

Disclosed are an ITPR1 gene-based SNP molecular marker related to porcine hypoxia sensitivity and use thereof. The SNP molecular marker is g.-1482 A / G. A is a dominant allele under hypoxic conditions, and the nucleotide sequence of an ITPR1 gene promoter is set forth in SEQ ID NO. 15. The present invention, by means of transcriptome analysis of Tibetan pigs at high and low altitudes and a porcine skeletal muscle satellite cell model of hypoxia, finds that the ITPR1 gene plays an important role in pigs' tolerance to hypoxia.

Description

A SNP molecular marker based on the ITPR1 gene associated with porcine hypoxia sensitivity and its application Technical Field

[0001] This invention relates to the field of animal molecular biology, specifically to a SNP molecular marker based on the ITPR1 gene associated with the trait of hypoxia sensitivity in pigs and its application. Background Technology

[0002] China is the world's largest pig-producing country and one of the two major domestication centers for domestic pigs globally, possessing the world's richest resources of local pig breeds. Since pig breeding is affected by different local climates (such as temperature and oxygen levels), selecting breeds with strong resistance to adverse conditions can increase production and reduce breeding costs. Furthermore, the selection of low-oxygen-tolerant pig breeds is expected to improve the adaptability of commercial pigs or local pigs to high-altitude environments, accelerating the process of genetic improvement.

[0003] Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by a single nucleotide variation at the genomic level. It is usually a dimorphic marker and is the most widely distributed type of genetic polymorphism marker within the genome. SNPs have advantages such as large quantity, high frequency, and low mutation rate. Compared to traditional breeding methods, molecular breeding greatly accelerates selection efficiency, is unaffected by environmental factors, and can select based on genetic background, reducing linkage redundancy. This speeds up the breeding process and increases precision, enabling breeders to efficiently select superior livestock and poultry breeds.

[0004] Inositol 1,4,5-triphosphate receptor (IP3R), located on the ER membrane, intracellular Ca2+ 2+ Ion channels, composed of three distinct isoforms—IP3R1, IP3R2, and IP3R3—are encoded by three genes, ITPR1, ITPR2, and ITPR3, respectively. In mammalian cells, including humans and other vertebrates, the full-length amino acid sequences of these three isoforms share 60-80% homology overall, particularly in the internal ligand binding and pore domains. The ITPR1 gene plays a crucial role in mouse embryonic development, especially in cerebellar development. Most homozygous ITPR1 mutant mice die prenatally, and some surviving mice exhibit severe ataxia and epilepsy. Previous studies have shown that IP3R receptor blockade can restore autophagy and mitochondrial function in skeletal muscle fibers of malnourished mice (Denisse Valladares et al. 2018), while its role in hypoxia remains unclear.

[0005] Summary of the Invention

[0006] To address the shortcomings of existing technologies, the present invention aims to provide an ITPR1-based SNP molecular marker related to porcine hypoxia sensitivity and its application. This SNP molecular marker is located at position 1482 of the ITPR1 gene promoter nucleotide sequence, with bases A or G. Under hypoxic conditions, C is the dominant allele. The ITPR1 gene promoter nucleotide sequence is shown in SEQ ID NO.15.

[0007] To solve the above-mentioned technical problems, the technical solution provided by the present invention is as follows:

[0008] A SNP molecular marker based on the ITPR1 gene associated with hypoxia sensitivity in pigs.

[0009] The SNP molecular marker is located at position 1482 of the ITPR1 gene promoter nucleotide sequence, with bases A or G. The ITPR1 gene promoter nucleotide sequence is shown in SEQ ID NO.15.

[0010] Preferably, under hypoxic conditions, A is the dominant allele, and G is sensitive to hypoxia.

[0011] Primer pairs were used to amplify the SNP molecular markers based on the ITPR1 gene associated with the porcine hypoxia tolerance trait.

[0012] The forward sequence of the primer pair is shown in SEQ ID NO.20;

[0013] The reverse sequence of the primer pair is shown in SEQ ID NO.21.

[0014] Reagents or kits containing primers for the above-mentioned SNP molecular markers based on the ITPR1 gene that are associated with porcine hypoxia sensitivity.

[0015] The above-mentioned SNP molecular markers based on the ITPR1 gene, which are associated with porcine hypoxia sensitivity, are used in the assisted breeding of hypoxia-tolerant pig breeds.

[0016] A method for breeding hypoxia-tolerant pig breeds, based on the aforementioned SNP molecular markers, involves detecting the SNP molecular marker located at position 1482 in the promoter region of the ITPR1 gene, and selecting individuals with allele A at that locus for breeding.

[0017] A method for identifying the above-mentioned ITPR1 gene-based SNP molecular markers associated with porcine hypoxia sensitivity includes the following steps:

[0018] 1) Construct a hypoxia model for the proliferation of porcine skeletal muscle satellite cells;

[0019] 2) The expression of the ITPR1 gene in the porcine skeletal muscle satellite cell hypoxia model was analyzed using transcriptome data from different tissues of Tibetan pigs at high and low altitudes;

[0020] 3) qRT-PCR was used to detect the expression of the ITPR1 gene in hypoxic porcine skeletal muscle proliferating satellite cells;

[0021] 4) Construct the porcine ITPR1 gene promoter recombinant plasmid pGL3-basic-ITPR1 and the SNP site (g.-1482 A>G) mutant plasmid pGL3-basic-SNP;

[0022] 5) Transient cell transfection and dual-luciferase activity assay were performed to detect the relative activity of the porcine ITPR1 gene promoter region and to identify the mutation activity of the SNP site (g.-1482 A>G).

[0023] Preferably, the forward sequence of the primer pair amplifying the promoter region of the porcine ITPR1 gene is shown in SEQ ID NO.16, and the reverse sequence is shown in SEQ ID NO.17.

[0024] Preferably, the primer pair sequences for verifying the SNP site are shown in SEQ ID NO.20 and SEQ ID NO.21.

[0025] The beneficial effects of this invention are:

[0026] This invention provides a molecular marker based on the ITPR1 gene associated with hypoxia sensitivity in pigs. This marker enables the breeding of hypoxia-tolerant pig breeds to improve the adaptability of commercial or local pigs to high-altitude ecological environments, accelerate the genetic improvement process, and increase production by breeding pig breeds with strong stress resistance. It also reduces breeding costs and eliminates the need for large-scale population sampling and testing, thus effectively improving the efficiency of breeding hypoxia-tolerant pig breeds.

[0027] Attached Figure Description

[0028] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used in conjunction with embodiments of the invention to explain the invention and do not constitute a limitation thereof. In the drawings:

[0029] Figure 1 shows the experimental results of high expression of the ITPR1 gene in a porcine skeletal muscle satellite cell hypoxia model; where A represents the expression levels of hypoxia-related factors HIF1A, VEGF, and GLUT1, detected by qRT-PCR after satellite cells were treated with different concentrations of cobalt chloride (0, 10, 25, 50, 100, 200 μmol / L) for 24 h. B is the qRT-PCR assay used to analyze the expression level of ITPR1 transcription in satellite cells after treatment with 50 μmol / L cobalt chloride. .

[0030] Figure 2 is an electrophoresis diagram of the PCR product of the ITPR1 gene promoter fragment, with a fragment size of 1989 bp.

[0031] Figure 3 shows the pGL3-basic-ITPR1 sequencing sequence (Part I).

[0032] Figure 4 shows the pGL3-basic-ITPR1 sequencing sequence (Part II).

[0033] Figure 5 shows the pGL3-basic-ITPR1 sequencing sequence (Part III).

[0034] Figure 6 shows the pGL3-basic-ITPR1 sequencing peak diagram (Part I);

[0035] Figure 7 shows the pGL3-basic-ITPR1 sequencing peak diagram (Part II).

[0036] Figure 8 shows the validation results of the ITPR1 gene SNP site (g.-1482 A>G); where A is the electrophoresis diagram of the reverse PCR product of the mutant fragment, with a fragment size of 6782bp; B is the sequencing peak diagram of pGL3-basic-SNP (g.-1482 A>G); and C is the relative luciferase activity of the promoter expression vector of the ITPR1 SNP site (g.-1482 A>G). .

[0037] Detailed Implementation

[0038] The preferred embodiments of the present invention will be described below with reference to the accompanying drawings. It should be understood that the following embodiments are given for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.

[0039] Example 1: Expression of the ITPR1 gene in the transcriptomes of Tibetan pigs at high and low altitudes.

[0040] Transcriptome data of Tibetan pigs from different tissues at high and low altitudes (heart: GSE114779; lung: GSE88409; skeletal muscle: GSE90510) were downloaded from NCBI “GEO DataSets”. Differential gene analysis using DESeq2 revealed that the porcine ITPR1 gene was upregulated, indicating that the ITPR1 gene may play an important role in hypoxia tolerance.

[0041] Example 2: Expression of the ITPR1 gene in hypoxic porcine satellite cells.

[0042] (1) In vitro isolation and culture of porcine skeletal muscle satellite cells

[0043] Wild-type experimental pig longissimus dorsi muscle tissue was collected, digested with collagenase II and Dispase II, and porcine skeletal muscle satellite cells (PSCs) were isolated and purified by differential adhesion. PSCs were cultured at 37 ℃ and 5% CO2 in F12 medium containing 20% ​​(v / v) fetal bovine serum (FBS) and 0.1% (w / v) gentamicin / ampicillin.

[0044] (2) Constructing a hypoxia model of porcine skeletal muscle satellite cells

[0045] Pig satellite cells were distributed at 10 per well. 4 Porcine satellite cells were seeded at a density of 1000 μmol / L in 24-well plates and treated with different concentrations of cobalt chloride (0, 10, 25, 50, 100, 200 μmol / L) for 24 h, as shown in Figure 1A. qRT-PCR analysis revealed that the expression levels of hypoxia-related factors HIF1A, VEGF, and GLUT1 were significantly increased during the proliferation of porcine satellite cells treated with 50 μmol / L cobalt chloride, and were higher than at other concentrations. It is speculated that 50 μmol / L cobalt chloride is the optimal concentration for hypoxia treatment and can be used as a hypoxia model for porcine skeletal muscle satellite cells in subsequent experiments.

[0046] (3) qRT-PCR detection of ITPR1 gene expression in hypoxic porcine skeletal muscle satellite cells

[0047] Subsequently, the expression changes of the ITPR1 gene during satellite cell proliferation under hypoxia treatment with 50 μmol / L cobalt chloride were detected. As shown in Figure 1B, the qRT-PCR results showed that the expression level of the ITPR1 gene was significantly increased, indicating that ITPR1 may play an important role in porcine skeletal muscle proliferation as a hypoxia tolerance gene.

[0048] The qRT-PCR procedure is as follows: Cells were lysed using Trizol solution (500 μL Trizol per 24-well plate), and total RNA was extracted and reverse transcribed into cDNA using RT-PCR. qPCR primers for specific genes were designed, with 18S as an internal control, and amplification was performed on a real-time PCR instrument to detect mRNA expression levels. Detailed information on the primers used is as follows:

[0049] 18S-F: CCTGCGGCTTAATTTGACTC (SEQ ID NO. 1);

[0050] 18S-R: ATGCCAGAGTCTCGTTCGTT (SEQ ID NO. 2);

[0051] HIF1A-F: CTCCATTGCCTGCCTCTGAA (SEQ ID NO.3);

[0052] HIF1A-R: TGGGACTGTTAGGCTCAGGT (SEQ ID NO.4);

[0053] EPAS1-F: CTCCTGTCCTCAGTTTGCTCT (SEQ ID NO.5);

[0054] EPAS1-R: TGCTGTGTCCTGTTAGCTCC (SEQ ID NO.6);

[0055] EPO-F: GCGCGCGAATGTCCT (SEQ ID NO.7);

[0056] EPO-R: CCATCGTGGCATTTTCGCC (SEQ ID NO.8);

[0057] VEGF-F: CAACGACGAAGGTCTGGAGT (SEQ ID NO.9);

[0058] VEGF-R: CAAGGCCCACAGGGATTTTCTT (SEQ ID NO. 10);

[0059] GLUT1-F: ATCCTCATCGCCCAGGTATTT (SEQ ID NO.11);

[0060] GLUT1-R: CGGTTCTCTCATTGCGGTT (SEQ ID NO. 12);

[0061] ITPR1-F: AGTTTCAGCCCTCAGTGGAC (SEQ ID NO.13);

[0062] ITPR1-R: TGTCTCAGCCGGACATAGGA (SEQ ID NO. 14);

[0063] Example 3 Construction of a truncated version of the porcine ITPR1 gene promoter

[0064] (1) Prediction of TSS sites on the 5' flanking sequence of the porcine ITPR1 gene and truncation of the promoter sequence

[0065] Bioinformatics analysis of the 5' end 1989bp sequence of the ITPR1 gene was performed using the websites BDGP, ​​Promoter2.0, TSSG, and TSSWW to predict transcription start sites (TSS). Based on existing VCF samples from Tibetan pigs and Yorkshire pigs, SNP sites in the promoter region of the ITPR1 gene were identified using two population selection analysis methods: Fst and Xpehh.

[0066] (2) Primer design for promoter region fragments

[0067] Based on the first 1989 bp of the ITPR1 gene (Gene ID: 397454) in the NCBI database, as shown in SEQ ID NO.15, promoter region-specific primers were designed using SnapGene. The upstream and downstream primers contain KpnⅠ and XhoⅠ restriction sites, respectively, and the downstream primer (ITPR1-R) remains unchanged. The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0068] The first 1989 bp of the ITPR1 gene sequence is as follows (SEQ ID NO.15):

[0069]

[0070]

[0071] The details of the primers used are as follows:

[0072] Forward primer:

[0073] ITPR1-F: 5' CGGGGTACCGGAATAAGGCTTTAGTGCCTAGGGAC 3' (SEQ ID NO.16)

[0074] Reverse primer:

[0075] ITPR1-R:5' CCGCTCGAGACTGCACTTTGAAGCGGCTC 3' (SEQ ID NO.17)

[0076] (3) Amplification of promoter region fragments and purification and recovery of products

[0077] 50 μL PCR reaction system: 25 μL KOD FOX Buffer, 10 μL 2 M m dNTP, 1.5 μL each of 10 μM forward and reverse primers, 1 μL template DNA, 1 μL KOD FOX, and 10 μL sterile water.

[0078] The amplification conditions were as follows: 94℃ pre-denaturation for 3 min, 98℃ denaturation for 15 s, 57℃ annealing for 15 s, 68℃ extension for 60 s, 35 cycles, 68℃ final extension for 5 min, and 16℃ cooling for 2 min.

[0079] In this embodiment, a kit was used to extract genomic DNA from pigs. The extraction method was based on the instructions for the blood / cell tissue genomic DNA extraction kit (Tiangen). The DNA concentration was determined using a NanoDrop1000 micro-ultraviolet spectrophotometer.

[0080] The PCR products were identified by 1% agarose gel electrophoresis. As shown in Figure 2, the amplified product of the ITPR1 gene promoter fragment is 1989 bp in size. After verifying that the band was in the correct position, the product was extracted and purified using the Magen Agarose Gel DNA Recovery Kit. All operations were performed in accordance with the kit instructions.

[0081] (4) Promoter fragment digestion and ligation with pGL3-basic plasmid

[0082] The gel-extracted product was digested with KpnⅠ and XhoⅠ at 37℃ for 3h. The system consisted of 1 μL each of KpnⅠ and XhoⅠ, 1 μg of gel-extracted product, 5 μL of 10x Cutsmart Buffer, and sterile water to a final volume of 50 μL.

[0083] The pGL3-basic plasmid was double-digested with KpnⅠ and XhoⅠ overnight at 37℃. The system consisted of 1 μL each of KpnⅠ and XhoⅠ, 1 μg of pGL3-basic plasmid, 5 μL of 10x Cutsmart Buffer, and sterile water to a final volume of 50 μL.

[0084] The gel-recovered products after double digestion with KpnⅠ and XhoⅠ and the double pGL3-basic plasmid with KpnⅠ and XhoⅠ were purified using a PCR product purification kit (Magen).

[0085] The purified gel-extracted product and the purified pGL3-basic plasmid were ligated using an NEB T4 ligase kit. The ligation system consisted of: 2 μL T4 Buffer, 50 ng (0.020 pmol) Vecter (4 kb), 37.5 ng (0.060 pmol) Insert (1 kb), 1 μL T4 ligase, and sterile water to a final volume of 20 μL. The mixture was incubated overnight at 16°C to obtain the recombinant plasmid pGL3-basic-ITPR1.

[0086] (5) Transformation of recombinant plasmid pGL3-basic-ITPR1

[0087] Add 10 μL of recombinant plasmid pGL3-basic-ITPR1 to 100 μL of DH5α competent cells, incubate on ice for 30 min, heat shock at 42°C for 90 s, followed by ice bath for 2 min. Add 500 μL of antibiotic-free LB liquid medium and incubate at 37°C with shaking for 30 min. Spread 200 μL evenly on LB solid medium plates containing ampicillin (100 mg / ml) and incubate overnight at 37°C with inverted incubation for 12–16 h.

[0088] (6) Screening and sequencing identification of positive clones

[0089] Single colonies were streaked from plates for preservation and colony PCR detection. The 20 μL system consisted of: 0.4 μL each of forward and reverse primers, 10 μL of 2xTaq Mix, and 9.2 μL of sterile water. Amplification conditions were: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 15 s, 57℃ annealing for 30 s, 72℃ extension for 60 s / kb, 30 cycles, 72℃ final extension for 2 min, and cooling at 16℃ for 5 min. Positive single colonies were selected by 1% agarose gel electrophoresis. Detailed primer information is as follows:

[0090] Forward primer:

[0091] ITPR1-F:5'CGGGGTACCGGAATAAGGCTTTAGTGCCTAGGGAC 3' (SEQ ID NO.18)

[0092] Reverse primer:

[0093] LucNrev-R:5' CCTTATGCAGTTGCTCTCC 3' (SEQ ID NO.19)

[0094] Sequencing: The above-mentioned positive monoclonal bacterial culture was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were spliced ​​and sequence aligned using SnapGene software. The results are shown in Figures 3-7. Figure 3-5 is the pGL3-basic-ITPR1 sequencing sequence; Figure 6-7 is the pGL3-basic-ITPR1 sequencing peak diagram.

[0095] (7) Extraction of recombinant plasmid pGL3-basic-ITPR1

[0096] The recombinant plasmid pGL3-basic-ITPR1, which had the correct sequencing results, was subjected to mini-prep using the Omega Endo-free Plasmid Mini Kit II. All operations were performed in accordance with the kit instructions.

[0097] Example 4: Validation of SNP sites in the porcine ITPR1 gene

[0098] (1) Design of mutant primers

[0099] Based on the results of the previous population selection analysis, a SNP site (g.-1482 A>G) in the promoter region of the ITPR1 gene was selected for validation, and specific primers were designed as follows:

[0100] ITPR1-SNP (g.-1482 A>G)-F: GCAAAACTGGGGCAAAGAGATAAAGATGACTTGC (SEQ ID NO.20)

[0101] ITPR1-SNP (g.-1482 A>G)-R: CTTTGCCCCAGTTTTGCCATCTTAGAGGAAGAAA (SEQ ID NO.21)

[0102] (2) Amplification of target plasmid pGL3-basic-ITPR1 and purification and recovery of products

[0103] PCR reaction system of 50 μL: KOD FOX Buffer 25 μL, 2M m dNTP 10 μL, 1.5 μL each of 10 μM forward and reverse primers, 1 ng of recombinant plasmid pGL3-basic-ITPR1 DNA, 1 μL KOD FOX, and aseptically added to 50 μL.

[0104] The amplification conditions were as follows: 94℃ pre-denaturation for 3 min, 98℃ denaturation for 15 s, 57℃ annealing for 15 s, 68℃ extension for 60 s, 35 cycles, 68℃ final extension for 5 min, and 16℃ cooling for 2 min.

[0105] The PCR products were identified by 1% agarose gel electrophoresis. The verification results of the ITPR1 gene SNP site (g.-1482 A>G) are shown in Figure 8. In Figure 8, A is the electrophoresis image of the reverse PCR product of the mutant fragment, with a fragment size of 6782 bp. After verifying that the band was in the correct position, the gel was excised and purified using the Magen Agarose Gel DNA Recovery Kit. All operations were performed in accordance with the kit instructions.

[0106] (3) Digestion of the amplified product Dpn I

[0107] Add 1 μL of Dpn I enzyme to the amplification product, gently mix, briefly centrifuge, and incubate at 37℃ for 1-2 h. Then perform 1% agarose gel electrophoresis and gel recovery to remove the plasmid template and obtain the PCR product. For single-base mutations, the optimal amount of Dpn I digestion product = [0.02 × number of fragment base pairs] ng.

[0108] (4) Homologous recombination

[0109] Reaction system: 50-400 ng of Dpn I digest product, 4 μL of 5xCEⅡ buffer, 2 μL of Exnase Ⅱ, and sterile water to a final volume of 20 μL. Gently pipette and mix, then briefly centrifuge. Incubate at 37°C for 30 min, then immediately cool on ice.

[0110] According to Example 3, the recombinant plasmid pGL3-basic-ITPR1 was transformed, sequenced, identified, and extracted using the same steps. The sequencing peak diagram of pGL3-basic-SNP (g.-1482 A>G) is shown in Figure 4B.

[0111] (5) Transient cell transfection

[0112] PK15 cells were seeded into 24-well cell culture plates, with 3 replicates per group. Transfection was performed when the cell density reached approximately 70%. A DNA / liposome complex was prepared. The liposomes were allowed to stand for 5 minutes. An equal volume of plasmid solution was then mixed with the liposome solution (as shown in Table 1), gently pipetted to mix, and allowed to stand for 20 minutes to form the DNA / liposome complex.

[0113] Table 1. Target sequence and pGL3-basic vector linkage system

[0114]

[0115] Add DNA / liposome complex to each well, shake well, and incubate at 37°C for 6 hours. Then replace with complete culture medium and continue incubation. Detect fluorescence intensity after 48 hours.

[0116] (6) Dual-luciferase activity assay

[0117] The luciferase activity of the corresponding groups was measured according to the Beyotime Dual-Luciferase Reporter Gene Detection Kit II (RG029S) instructions. The relative luciferase activity value of each group was equal to the average ratio of the firefly luciferase to Renida luciferase values ​​in each independent experiment within each group. The activity assay of the control pGL3-basic was set as 1. The relative luciferase activity of the ITPR1 gene promoter region and SNP site (g.-1482 A>G) promoter expression vector was also measured. As shown in Figure 4C, the relative activity of the ITPR1 gene promoter region was significantly increased, while the activity of the SNP site (g.-1482 A>G) mutation was significantly lower than that of the unmutated fragment. This indicates that the SNP site (g.-1482 A>G) affects the expression activity of the ITPR1 gene promoter region and is related to the hypoxia sensitivity of pigs.

[0118] Therefore, this invention obtained a SNP molecular marker associated with porcine hypoxia sensitivity, g.-1482 A>G.

[0119] The contents not described in detail in this specification are existing technologies known to those skilled in the art.

[0120] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A SNP molecular marker based on the ITPR1 gene associated with porcine hypoxia sensitivity, characterized in that, The SNP molecular marker is located at position 1482 of the ITPR1 gene promoter nucleotide sequence, with bases A or G. The ITPR1 gene promoter nucleotide sequence is shown in SEQ ID NO.

15.

2. The SNP molecular marker based on the ITPR1 gene associated with porcine hypoxia sensitivity according to claim 1, characterized in that, Under hypoxic conditions, A is the dominant allele.

3. The primer pair for amplifying the SNP molecular markers related to porcine hypoxia sensitivity based on the ITPR1 gene as described in claim 1, characterized in that, The forward sequence of the primer pair is shown in SEQ ID NO.20; The reverse sequence of the primer pair is shown in SEQ ID NO.

21.

4. A reagent or kit containing primers for a porcine hypoxia-sensitive SNP molecular marker based on the ITPR1 gene as described in claim 1.

5. The application of the SNP molecular markers based on the ITPR1 gene associated with porcine hypoxia sensitivity as described in any one of claims 1-4 in the assisted breeding of hypoxia-tolerant pig breeds.

6. A method for breeding hypoxia-tolerant pig breeds, based on the SNP molecular markers described in claim 1, characterized in that, The SNP molecular marker located at position 1482 in the promoter region of the ITPR1 gene was detected, and individuals with allele A at this locus were selected for breeding.

7. A method for identifying the SNP molecular marker associated with the porcine hypoxia sensitivity based on the ITPRl gene according to claim 1, characterized in that, Includes the following steps: 1) Construct a hypoxia model for the proliferation of porcine skeletal muscle satellite cells; 2) The expression of the ITPR1 gene in the porcine skeletal muscle satellite cell hypoxia model was analyzed using transcriptome data from different tissues of Tibetan pigs at high and low altitudes; 3) qRT-PCR was used to detect the expression of the ITPR1 gene in hypoxic porcine skeletal muscle proliferating satellite cells; 4) Construct the porcine ITPR1 gene promoter recombinant plasmid pGL3-basic-ITPR1 and the SNP site (g.-1482 A>G) mutant plasmid pGL3-basic-SNP; 5) Transient cell transfection and dual-luciferase activity assay were performed to detect the relative activity of the porcine ITPR1 gene promoter region and to identify the mutation activity of the SNP site (g.-1482 A>G).

8. The method for identifying SNP molecular markers related to porcine hypoxia sensitivity based on the ITPR1 gene according to claim 7, characterized in that, The primer pair sequences for verifying the SNP site are shown in SEQ ID NO.20 and SEQ ID NO.21.

Images