Molecular marker of backfat thickness trait of tibet pig and application thereof

By screening for the SNP molecular marker at position 15982634 on chromosome 7 of Tibetan pigs through genome-wide association analysis, the problem of foreign markers not being able to adapt to the backfat thickness trait of Tibetan pigs was solved, enabling early prediction and optimized breeding of the backfat thickness trait of Tibetan pigs, and improving the production performance and economic benefits of Tibetan pigs.

CN122104944APending Publication Date: 2026-05-29BEIJING TYAR BIOLOGIC TECH CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610445158.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-07
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

In existing technologies, molecular markers from foreign pig breeds cannot be directly applied to Tibetan pig populations, resulting in invalid loci, biased effects, and low prediction accuracy, making it difficult to meet the needs of genetic improvement of Tibetan pigs, especially in terms of the genetic specificity of backfat thickness.

Method used

Through genome-wide association analysis, a SNP molecular marker at position 15982634 on chromosome 7 of Tibetan pigs was screened out. Primer pairs and kits were provided to identify the backfat thickness trait of Tibetan pigs. PCR amplification and genotyping were performed using the primer pairs to achieve early selection and breeding.

Benefits of technology

It enables early prediction of the backfat thickness trait of Tibetan pigs, avoids the problem of excessive fat, improves lean meat rate and feed conversion ratio, reduces breeding costs, meets the needs of commercial breeding, optimizes the production performance of Tibetan pigs, and serves the large-scale breeding and industrial upgrading of Tibetan pigs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104944A_ABST
    Figure CN122104944A_ABST
Patent Text Reader

Abstract

The application discloses a molecular marker related to a backfat thickness character of Tibetan pigs, is developed aiming at the unique plateau genetic background of the Tibetan pigs, avoids the problem that foreign pig molecular markers are not suitable, and performs early selection on the Tibetan pigs by determining the genotypes of SNP sites of the Tibetan pigs, so that the Tibetan pigs not only retain the excellent meat quality characteristics, but also optimize the production performance, help to improve the Tibetan pig genetic resources, better serve the large-scale breeding and industrial upgrading of the Tibetan pigs, have great economic application value and scientific research value, and fill the technical blank of Tibetan pig backfat thickness specificity molecular marker breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene detection technology, specifically relating to a molecular marker for the backfat thickness trait of Tibetan pigs and its application. Background Technology

[0002] As a major pig-producing country, my country has long ranked among the world's top producers and consumers of pork. Pork has become the most important meat product consumed by Chinese residents and a significant source of animal protein. The Tibetan pig is a unique high-altitude local pig breed in my country, belonging to the high-altitude type among the six major local pig breeds. It is mainly distributed in southeastern Tibet, Ganzi and Aba prefectures in Sichuan Province, and Diqing Prefecture in Yunnan Province, located in the heart of the Qinghai-Tibet Plateau. It is a rare breed formed through long-term natural selection and artificial domestication. Tibetan pigs possess extremely strong adaptability to high altitudes, tolerance to roughage, and resilience. Their meat is tender, has a unique flavor, and is rich in unsaturated fatty acids and essential amino acids, making it a distinctive pig breed with both germplasm conservation value and market development potential.

[0003] In recent years, molecular marker-assisted breeding technology for livestock and poultry has been widely applied to the genetic improvement of economic traits in pig breeds due to its advantages of precision, efficiency, and shortened breeding cycle. Among these applications, the discovery and application of molecular markers related to pork quality is a research hotspot. Currently, a series of molecular markers and candidate genes related to pork traits have been reported both domestically and internationally. Related research mainly focuses on commercially available exotic breeds such as Duroc and Large White pigs. Through quantitative trait locus (QTL) mapping and genome-wide association analysis, multiple genetic variation sites related to pork quality have been screened and applied to the breeding practices of these breeds, effectively improving breeding results. However, due to the unique breed characteristics and genetic background of Tibetan pigs, the commercially available molecular markers reported in existing technologies often cannot be directly applied to Tibetan pig populations. Tibetan pigs have long been in a closed breeding state, resulting in high population genetic diversity, low strain purification, and the shaping effect of unique natural selection pressures on the plateau. The regulatory pathways, allele frequencies, and key mutation sites of their fat deposition-related genes show significant genetic differentiation from those of exotic pig breeds. If molecular markers from foreign pig breeds are simply applied to Tibetan pig populations, problems such as invalid loci, effect bias, and low prediction accuracy are likely to occur, making it difficult to truly reflect the genetic basis of Tibetan pigs and failing to meet the needs of genetic improvement of Tibetan pigs.

[0004] Therefore, given the germplasm specificity of Tibetan pigs and their unique genetic background, identifying molecular markers specific to the backfat thickness trait through population resequencing and genome-wide association analysis, and constructing a molecular detection system suitable for Tibetan pigs, has become an urgent need for the protection and genetic improvement of Tibetan pig germplasm resources. This is of great significance for accelerating the breeding of superior Tibetan pig breeds and promoting the large-scale and standardized development of the Tibetan pig industry. To date, no studies have identified or reported functional mutation sites and molecular markers related to the specific backfat thickness trait of Tibetan pigs. Summary of the Invention

[0005] The primary objective of this invention is to provide a SNP molecular marker that is significantly associated with the backfat thickness trait of Tibetan pigs and its breeding and application method.

[0006] To address the needs of Tibetan pig breeding and production practices, this invention uses a purebred Tibetan pig population from the Qinghai-Tibet Plateau, measures backfat thickness data, and combines this with whole-genome resequencing data. Through genome-wide association analysis, SNP molecular markers that significantly affect backfat thickness in Tibetan pigs are screened and obtained.

[0007] Specifically, the present invention first provides a molecular marker related to the backfat thickness trait of Tibetan pigs. The SNP molecular marker corresponds to position 15982634 on chromosome 7 of Tibetan pigs and contains a nucleotide sequence with an A / T polymorphism at this site. The backfat thickness trait of Tibetan pigs refers to the thickness of subcutaneous fat on the back of adult Tibetan pigs after slaughter (unit: mm). The physical location of the above molecular marker is referenced to the Sscrofa 11.1 version of the genome (international pig genome version 11.1).

[0008] Furthermore, the genotype of the polymorphic locus is AA, which corresponds to a low level of backfat thickness (thin backfat) in the Tibetan pigs being tested; the genotype of the polymorphic locus is AT, which corresponds to a medium level of backfat thickness in the Tibetan pigs being tested; and the genotype of the polymorphic locus is TT, which corresponds to a high level of backfat thickness (thick backfat) in the Tibetan pigs being tested.

[0009] Furthermore, the present invention also provides a primer pair for amplifying the above-mentioned molecular marker, wherein the primer pair is: Upstream primer: TCTTGTGTATCGCTTTACCGT (SEQ ID NO.1); Downstream primer: GCCTATTCTCGTTCTTATGTCC (SEQ ID NO.2).

[0010] Furthermore, the present invention provides a kit containing the above-described primer pairs.

[0011] Furthermore, the present invention provides any of the above applications of the molecular markers or primer pairs or kits: (1) Application in identifying the backfat thickness phenotype of Tibetan pigs; (2) Application in early prediction of back fat thickness in Tibetan pigs; (3) Application in the identification, improvement or molecular marker-assisted breeding of Tibetan pig germplasm resources.

[0012] Furthermore, the present invention also provides a molecular breeding method for high-quality Tibetan pigs, comprising: (1) Extract genomic DNA from the Tibetan pigs to be tested; (2) Using DNA as a template, perform PCR amplification using the above primer pairs; (3) Analyze the PCR amplification products to determine the genetic potential of Tibetan pigs with thick back fat, and retain and propagate them.

[0013] The beneficial effects of this invention are as follows: This invention provides a molecular marker related to the backfat thickness trait of Tibetan pigs, developed specifically for the unique high-altitude genetic background of Tibetan pigs. This avoids the problem of mismatched molecular markers in foreign pig breeds. By determining the genotype of the SNP locus in the Tibetan pig to be tested, early selection of Tibetan pigs can be carried out. The backfat thickness phenotype can be predicted without waiting for Tibetan pigs to reach adulthood for slaughter. Superior individuals with thin or medium backfat can be precisely screened according to breeding goals. This avoids the problems caused by excessive fat, increased feed conversion ratio, increased breeding costs, and low lean meat percentage in Tibetan pigs due to thick backfat (high level, corresponding to TT genotype), which does not meet the mainstream requirements of commercial farming. It retains the excellent quality characteristics of Tibetan pork while optimizing the production performance of Tibetan pigs, helping to improve the germplasm resources of Tibetan pigs, and better serving the large-scale breeding and industrial upgrading of Tibetan pigs. It has great economic application value and scientific research value, filling the technical gap in molecular marker breeding for Tibetan pig backfat thickness. Attached Figure Description

[0014] Figure 1 shows that, Figure 1A The Manhattan plot of genome-wide association analysis (GWAS) of Tibetan pigs on chromosome 7 regarding backfat thickness is shown in a preferred embodiment of the present invention. Figure 1B This is a Quantile-quantile plot. Figure 1A The X-axis represents chromosomes 1-18 of pigs. The red dashed line in the figure represents the potential significance threshold median line at the whole genome level (-log10(1 / 9084690) = 6.87), and the black dashed line represents the significance threshold line (-log10(0.05 / 9084690) = 8.19). When the value is higher than the threshold, the SNP locus is considered to be significantly associated with the backfat thickness trait of Tibetan pigs. Figure 1B This indicates the degree of fit between the actual observed value and the expected value, and is used to verify the reliability of GWAS analysis results and reduce interference from false positive sites.

[0015] Figure 2 This is the genotyping diagram of chromosome 7, number 15982634, in this invention. Detailed Implementation

[0016] The following embodiments further illustrate the content of the present invention, but should not be construed as limiting the present invention. It should be understood that the following embodiments are given for illustrative purposes only and are not intended to limit the scope of the present invention. Modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance of the present invention are all within the scope of the present invention.

[0017] The following examples are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the equipment and reagents used in the examples are all commercially available.

[0018] Example 1: Genome-wide association analysis to mine SNP loci in Tibetan pig backfat thickness This invention uses purebred Tibetan pigs from the Qinghai-Tibet Plateau (covering major producing areas such as Ganzi in Sichuan, Lhasa in Tibet, and Yushu in Qinghai) as experimental animals. During the rearing process, an extensive feeding method conforming to the physiological characteristics of Tibetan pigs is adopted, with free access to feed and water. The diet is based on the feeding standards for local plateau pig breeds, simulating the natural growth environment of Tibetan pigs throughout the process. Tibetan pigs are slaughtered after reaching market weight (80-100kg), and backfat thickness is measured (measured at three points: shoulder, chest-waist junction, and rump; the average value is taken as the backfat thickness phenotypic value).

[0019] DNA extraction Five mL of venous blood was collected from all experimental pigs using blood collection tubes. Whole-genome DNA was extracted using the standard phenol-chloroform method. The concentration and purity of the DNA samples (OD values: OD260 / 280, OD260 / 230) were accurately determined using a Nanodrop 2000 / 2000C nucleic acid and protein analyzer. DNA samples that passed the initial test were then subjected to 0.7% agarose gel electrophoresis to assess their purity and integrity. The DNA samples were then sent to a professional sequencing company (such as Beijing Bio-Sequencing Technology Co., Ltd.) for whole-genome resequencing.

[0020] All individual genotypic data of the experimental Tibetan pigs were processed using PLINK v1.9 software for quality control. The quality control criteria were: locus detection rate (geno) > 0.90; minimum allele frequency (MAF) > 0.05; and individual detection rate (mind) > 0.90. A total of 284 qualified individuals and 9,084,690 SNP loci were ultimately retained. Genome-wide association analysis of backfat thickness was performed using GEMMA software.

[0021] Specifically:

[0022] Where y is the phenotypic vector, i.e., backfat thickness; W is the indicator matrix for fixed effects, with the first column being 1 and subsequent columns representing fixed effects or covariate values; α is the coefficient vector for fixed effects; x is the genotype vector; β is the SNP effect; and u is the vector for random effects. The residual vector; MVN n It follows an n-dimensional multivariate normal distribution. The ratio of the two variance components. Let K be the residual variance, and I be the kinship matrix calculated based on SNP. n It is an identity matrix.

[0023] GWAS analysis results are as follows Figure 1A As shown, backfat thickness is significantly associated with the target region on chromosome 7. Further site annotation was performed on all sites in the associated region of the genome, and the SNP site corresponding to position 15982634 on chromosome 7 of Tibetan pigs was finally identified as a candidate site.

[0024] By combining phenotypes to perform a significant analysis of differences between genotypes, see Figure 2 Ultimately, the SNP at position 15982634 on chromosome 7 was found to contain a favorable genotype that can be used for early selection of Tibetan pigs with thick backfat. The genotype of the polymorphic locus is AA, which corresponds to a low level of backfat thickness (thin backfat) in the Tibetan pigs to be tested; the genotype of the polymorphic locus is AT, which corresponds to a medium level of backfat thickness in the Tibetan pigs to be tested; and the genotype of the polymorphic locus is TT, which corresponds to a high level of backfat thickness (thick backfat) in the Tibetan pigs to be tested.

[0025] Example 2: Validation of the effects of molecular markers The experimental population of 194 Tibetan pigs was reconstructed according to the standard of Example 1. The effect of the A / T polymorphic SNP molecular marker at position 15982634 on chromosome 7 of Tibetan pigs was verified to clarify the association between different genotypes of this molecular marker and the backfat thickness trait of Tibetan pigs, and to verify its practicality in the early selection and breeding of Tibetan pigs with backfat thickness.

[0026] The genotypic data of the above-mentioned Tibetan pig individuals were processed using PLINK v1.9 software for quality control, with the quality control standards consistent with those in Example 1. Combined with the backfat thickness phenotypic data of these 194 Tibetan pigs, a significant difference analysis of backfat thickness among genotypes was performed. The effect verification results showed (Table 1) that the A / T polymorphism SNP locus at position 15982634 on chromosome 7 of Tibetan pigs showed three genotypes: AA, AT, and TT. There were significant differences in backfat thickness among individuals of the three genotypes (P<0.05).

[0027] Table 1. Validation results of the association between the A / T genotype at position 15982634 on chromosome 7 of Tibetan pigs and the backfat thickness trait.

[0028] The results show that Tibetan pigs generally have thick backfat. The core reason is that, as a native breed, they evolved over a long period in a cold, feed-scarce environment. Thick backfat allows them to store energy to withstand the cold and cope with food shortages, representing an adaptive evolutionary characteristic. Furthermore, traditional farming did not involve targeted lean meat percentage selection, allowing genes related to fat deposition to be preserved. Combined with their slow growth rate and the fact that energy conversion is primarily through fat accumulation, this ultimately results in significantly thicker backfat compared to large-scale bred lean-type pig breeds. Based on this, different genotypes of the A / T polymorphic SNP at position 15982634 on chromosome 7 of Tibetan pigs are stably and significantly associated with the backfat thickness trait, accurately reflecting the backfat thickness level of the tested Tibetan pigs. The AA genotype is a favorable genotype for thin backfat and can be used for early selection of Tibetan pigs to achieve this trait, providing reliable molecular marker support for the breeding of high-quality Tibetan pig breeds. By selecting Tibetan pigs with thin backfat, we can not only increase the lean meat percentage and meet the market demand for low-fat, high-quality pork, but also reduce feed consumption caused by fat deposition, improve the economic benefits of breeding, reduce high-fat-related meat quality problems, improve meat quality, and facilitate large-scale breeding and promotion.

[0029] Example 3: Early breeding method for Tibetan pig backfat traits using SNP molecular markers of the present invention. All selected individuals had venous blood collected at approximately 4 months of age, and ACD anticoagulant was added. The blood was stored at -20℃ for later use. Genomic DNA was extracted using the salting-out method, dissolved in ddH2O, and the purity and concentration of the DNA were determined by both agarose gel electrophoresis and ultraviolet spectrophotometry. The DNA was then diluted to a concentration of 50 ng / μl.

[0030] Allele sequencing of the amplified products was performed using direct sequencing to genotype SNP sites. The primers used were: Upstream primer: TCTTGTGTATCGCTTTACCGT (SEQ ID NO.1); Downstream primer: GCCTATTCTCGTTCTTATGTCC (SEQ ID NO.2).

[0031] The PCR reaction program was as follows: 94℃ for 5 min; 94℃ for 30 s, 60℃ for 30 s, 72℃ for 1 min, for a total of 35 cycles; 72℃ for 5 min. The PCR reaction volume (20 μl) consisted of: 0.5 μl template DNA, 0.5 μl upstream primer, 0.5 μl downstream primer, 10 μl 2×Taq PCR MasterMix, and ddH2O to a final volume of 20 μl.

[0032] Based on genotyping results, healthy boars and sows with the AA genotype (favorable genotype for thin backfat) at the specified locus are selected and retained. After 6-7 months of age, they are tested for common diseases such as classical swine fever and porcine reproductive and respiratory syndrome (PRRS). Individuals testing positive for these diseases are culled to improve the disease resistance of Tibetan pigs and reduce breeding risks and costs. After reaching sexual maturity at 8-10 months of age, estrus is recorded in sows, and sows that do not exhibit estrus or have irregular estrus patterns are culled. After reaching the optimal breeding period at 10-12 months of age, healthy boars and sows with the favorable genotype at the aforementioned locus are mated. Inbreeding within three generations must be avoided during mating. Individual numbers of the mated boars and sows are recorded, and a complete pedigree is established. This invention provides a new molecular marker for marker-assisted selection of the thick backfat trait in Tibetan pigs by providing GWAS analysis of the SNP at position 15982634 on chromosome 7 of Tibetan pigs, detecting the mutation site, and applying it to the selection of Tibetan pigs with thin backfat traits. This enables early and precise selection of Tibetan pigs with thin backfat traits.

[0033] Although the above embodiments have described the present invention and its implementation in detail, it should be noted that for those skilled in the art, any changes, modifications, substitutions, combinations, simplifications, etc., made to the corresponding conditions without departing from the technical principles of the present invention should be considered as equivalent substitutions, and these improvements should also be considered within the scope of protection of the present invention.

Claims

1. The application of an SNP molecular marker in the identification of the correlation between backfat thickness and other traits in Tibetan pigs, characterized in that, The SNP molecular marker corresponds to position 15982634 on chromosome 7 of Tibetan pigs, containing a nucleotide sequence with polymorphism of A / T at that site; wherein, the Tibetan pig backfat thickness trait refers to the thickness of subcutaneous fat on the back of adult Tibetan pigs after slaughter, in mm, and the physical location of the above molecular markers is referenced to the Sscrofa11.1 version of the genome.

2. The application as described in claim 1, characterized in that, The polymorphic site of the SNP molecular marker has a genotype of AA, which corresponds to a low level of backfat thickness in the Tibetan pig to be tested, i.e., thin backfat. The genotype of the polymorphic locus is AT, which corresponds to a medium level of backfat thickness in the Tibetan pigs being tested; the genotype of the polymorphic locus is TT, which corresponds to a high level of backfat thickness in the Tibetan pigs being tested, i.e., thick backfat.

3. A primer pair for amplifying the SNP molecular marker of claim 1, characterized in that, The primer pair is: Upstream primer: TCTTGTGTATCGCTTTACCGT; Downstream primer: GCCTATTCTCGTTCTTATGTCC.

4. A kit containing the primer pair of claim 3.

5. Any application of the SNP molecular marker as described in claim 1 or the primer pair as described in claim 3: (1) Application in identifying the backfat thickness phenotype of Tibetan pigs; (2) Application in early prediction of back fat thickness in Tibetan pigs; (3) Application in the identification, improvement or molecular marker-assisted breeding of Tibetan pig germplasm resources.

6. A molecular breeding method for high-quality Tibetan pigs, comprising: (1) Extract genomic DNA from the Tibetan pigs to be tested; (2) Using DNA as a template, perform PCR amplification using the primer pair described in claim 3; (3) Analyze the PCR amplification products to determine the genetic potential of Tibetan pigs with thick back fat. Based on the genotyping results, select and retain healthy boars and sows with the AA genotype, that is, the genotype that is favorable for thin back fat, for breeding and propagation.