Genetically engineered bacterium for producing 1, 3-butanediol and application of genetically engineered bacterium

Abstract

The invention discloses a genetically engineered bacterium for producing 1, 3-butanediol and application of the genetically engineered bacterium, and belongs to the technical field of genetic engineering. The invention discloses a genetically engineered bacterium for producing 1, 3-butanediol, which is characterized in that JM109 (DE3) is used as a starting strain, and a citrate synthase gene gltA is weakened; the method comprises the following steps: knocking out a D-lactic dehydrogenase gene ldhA and a pyruvate dehydrogenase-ubiquinone gene poxB; according to the invention, a phosphoketolase gene xfp and phosphotransacetylase genes pta, PhaA, PhaB, B1d *, yqhd, fdh1, nadk, pntA and pntB are overexpressed. When the genetically engineered bacterium constructed by the invention is used for producing the 1, 3-butanediol, the conversion rate is high, the economical efficiency is good, the sustainability is realized, and the industrial production is easy.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and more specifically to a genetically engineered bacterium producing 1,3 - butanediol and its application. Background Art

[0002] The molecular formula of 1,3 - butanediol is C4H 10 O2, and its chemical formula weight is 90.121. It is a four - carbon diol and has been widely used as a solvent in cosmetics and a monomer in the polymer industry. At the same time, 1,3 - butanediol can also be used as a precursor for the direct synthesis of butadiene, thus being applied to the manufacture of chemicals such as synthetic rubber, latex, and resin. In addition, R - type 1,3 - butanediol is an important intermediate for the synthesis of fragrances, pesticides, pheromones, and β - lactam antibiotics.

[0003] Currently, 1,3 - butanediol is mainly produced by chemical synthesis methods. However, chemical synthesis methods have problems such as non - renewable petroleum - based raw materials, many by - products, low optical purity, and environmental pollution. Based on this, it is necessary to research and develop a biological synthesis technology for 1,3 - butanediol with high conversion rate, good economy, sustainability, and easy industrial production.

[0004] Therefore, providing a genetically engineered bacterium producing 1,3 - butanediol and its application is an urgent problem to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides a genetically engineered bacterium producing 1,3 - butanediol and its application. This bacterium is a genetically engineered bacterium for high - conversion - rate and high - yield 1,3 - butanediol. Using this genetically engineered bacterium to produce 1,3 - butanediol has a high conversion rate, good economy, and is easy for industrial production.

[0006] To achieve the above - mentioned purpose, the present invention adopts the following technical scheme: A genetically engineered bacterium producing 1,3 - butanediol, using JM109(DE3) as the starting strain, weakening the citrate synthase gene gltA; knocking out the D - lactate dehydrogenase gene ldhA and the pyruvate dehydrogenase [ubiquinone] gene poxB; overexpressing the phosphoketolase gene xfp, the phosphotransacetylase gene pta, PhaA, PhaB, Bld*, yqhd, fdh1, nadk, pntA, pntB genes; obtaining the recombinant strain VT0006; The pCDF - tbytp plasmid carries PhaA, PhaB, Bld*, yqhd genes; the pACYC - fnp plasmid carries fdh1, nadk, pntA, pntB genes; The pCDF-tbytp plasmid and the pACYC-fnp plasmid are referred to the Chinese patent with the application number 202111158898.1; The weakened citrate synthase gene gltA is obtained by replacing the upstream UTR sequence of the citrate synthase gene gltA with the UTR-1 sequence; the UTR sequence is as shown in SEQ ID NO.4; the UTR-1 sequence is as shown in SEQ ID NO.1; The nucleotide sequence of the phosphoketolase gene xfp is as shown in SEQ ID NO.34; The nucleotide sequence of the phosphotransacetylase gene pta is as shown in SEQ ID NO.39.

[0007] Furthermore, the genetic engineering bacterium for producing 1,3-butanediol further comprises overexpressing the glucose-6-phosphate dehydrogenase gene zwf and the 6-phosphogluconate dehydrogenase gene gnd; and obtaining the recombinant strain VT0007; The nucleotide sequence of the glucose-6-phosphate dehydrogenase gene zwf is as shown in SEQ ID NO.44; The nucleotide sequence of the 6-phosphogluconate dehydrogenase gene gnd is as shown in SEQ ID NO.45.

[0008] Furthermore, the genetic engineering bacterium for producing 1,3-butanediol further comprises overexpressing the gene apfdh* of the formate dehydrogenase mutant; and obtaining the recombinant strain VT0008; The nucleotide sequence of the gene apfdh* of the formate dehydrogenase mutant is as shown in SEQ ID NO.46.

[0009] Furthermore, the genetic engineering bacterium for producing 1,3-butanediol further comprises overexpressing the polyphosphate kinase gene ppk; and obtaining the recombinant strain VT0009; The nucleotide sequence of the polyphosphate kinase gene ppk is as shown in SEQ ID NO.57.

[0010] Furthermore, the genetic engineering bacterium for producing 1,3-butanediol further comprises knocking out the pyruvate dehydrogenase complex inhibitor gene pdhR; and obtaining the recombinant strain VT0011.

[0011] Furthermore, the genetic engineering bacterium for producing 1,3-butanediol further comprises knocking out the ATP-dependent 6-phosphofructokinase isoenzyme 2 gene pfkB; and obtaining the recombinant strain VT0013.

[0012] Furthermore, the genetic engineering bacterium for producing 1,3-butanediol further comprises knocking out the glyceraldehyde-3-phosphate dehydrogenase A gene gapA; and obtaining the recombinant strain VT0015.

[0013] Furthermore, for the genetically engineered bacterium for producing 1,3-butanediol, the Bld* gene is replaced with the Bld** gene to obtain the recombinant strain VT0016; The nucleotide sequence of the Bld** gene is as shown in SEQ ID NO.92.

[0014] Furthermore, for the genetically engineered bacterium for producing 1,3-butanediol, the PhaA gene is replaced with the PhaA* gene, and the PhaB gene is replaced with the PhaB* gene to obtain the recombinant strain VT0017; The nucleotide sequence of the PhaA* gene is as shown in SEQ ID NO.97; The nucleotide sequence of the PhaB* gene is as shown in SEQ ID NO.98.

[0015] Furthermore, the application of the genetically engineered bacterium in high-yield production of 1,3-butanediol.

[0016] As can be seen from the above technical solutions, compared with the prior art, the present invention discloses a genetically engineered bacterium for producing 1,3-butanediol and its application. The obtained genetically engineered bacterium is a genetically engineered bacterium with high yield of 1,3-butanediol. Using this genetically engineered bacterium to produce 1,3-butanediol has high conversion rate, good economy, sustainability and is easy for industrial production. Specific Embodiments

[0017] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0018] Example 1 Module 1 Construction of a Metabolic Engineering Platform with Acetyl-CoA and Cofactors as the Core 1 Relief of the Side Pathway 1.1 Replace the upstream UTR sequence of the gene gltA encoding citrate synthase to reduce the diversion of acetyl coenzyme A Using the genome of Escherichia coli K-12 as a template, the upstream 500 bp (such as SEQ ID NO.3) of the gene gltA (such as SEQ ID NO.2) encoding citrate synthase is amplified by PCR with primers do-gltA-F1 / R1 carrying the UTR-1 sequence (such as SEQ ID NO.1) to replace the natural UTR sequence (such as SEQ ID NO.4) to obtain the do-gltA-1 gene fragment.

[0019] PCR amplification system: 25 µL of PrimeSTAR Premix, 2 µL of forward primer, 2 µL of reverse primer, 1 µL of template, 20 µL of ddH2O.

[0020] PCR amplification program: 98 °C for 3 min; 98 °C for 10 s, 58 °C for 15 s, 72 °C for 1 min / 1 kb, 34 cycles; 72 °C for 10 min; hold at 12 °C.

[0021] Using the genome of Escherichia coli K-12 as a template, the downstream 500 bp of the citrate synthase (gltA) gene (as shown in SEQ ID NO.5) was amplified by PCR using primers do-gltA-F2 / R2 to obtain the do-gltA-2 gene fragment.

[0022] Using the do-gltA-1 gene fragment and the do-gltA-2 gene fragment as templates, PCR amplification was performed using primers do-gltA-F1 / R2 to obtain the gltA homologous arm do-gltA gene fragment (as shown in SEQ ID NO.6).

[0023] Using plasmid pECgRNA as a template, amplification was performed using primers gRNA-gltA-F / gRNA-R to obtain the DNA fragment gRNA-gltA (SEQ ID NO.7).

[0024] The primer sequences used are as follows: do-gltA-F1: 5’- CGCTGGGTGGCTCGGGAT -3’; SEQ ID NO.8.

[0025] do-gltA-R1: 5’-GCAATAGCTCAAAGGAGCATCAGCA CGTAAGACTGCCGGAACTTAAAT -3’; SEQID NO.9.

[0026] do-gltA-F2: 5’-TGCTGATGCTCCTTTGAGCTATTGC ATGGCTGATACAAAAGCAAAACTCACC -3’; SEQ ID NO.10.

[0027] do-gltA-R2: 5’- GACAGCAGGCGGAACGCG -3’; SEQ ID NO.11.

[0028] gRNA-gltA-F: 5’- GGACTAGTAGCAAAACTCACCCTCAACGGTTTTAGAGCTAGAAATAGCAAGTT -3’; SEQ ID NO.12.

[0029] gRNA-R: 5’-CCGCTCGAGTAGGGATAACAGGGT -3'; SEQ ID NO. 13.

[0030] Digest the DNA fragments gRNA-phdR and plasmid pECgRNA with restriction endonucleases SpeI-HF and XhoI respectively.

[0031] Digestion system: 40 μL of DNA fragment gRNA-gltA / plasmid pECgRNA, 5 μL of rCutsmart buffer, 1 μL of SpeI-HF, 1 μL of XhoI, 3 μL of ddH2O.

[0032] Digestion procedure: 37°C for 15 min.

[0033] Ligate the DNA fragment gRNA-gltA recovered by digestion with the plasmid pECgRNA recovered by digestion using T4 ligation to obtain plasmid gRNA-gltA.

[0034] Ligation system: 1 μL of T4 DNA Ligase, 1 μL, 2 μL of DNA fragment gRNA-gltA recovered by digestion, 1 μL of plasmid pECgRNA recovered by digestion, 5 μL of ddH2O.

[0035] Ligation procedure: 22°C for 3 h.

[0036] Prepare competent cells of the original strain VT0001 (E. coli JM109(DE3)), and electrotransfer plasmid gRNA-gltA, plasmid pEcCas9, and do-gltA gene fragment into the competent cells of the original strain VT0001 to obtain the recombinant strain VT0002 with the gltA gene knocked out by CRISPR-Cas9.

[0037] The CRISPR-Cas9 gene knockout procedure is as follows: First, electrotransfer the pEcCas9 plasmid into the VT0001 host strain to be knocked out; second, express the Cas9 protein under the induction of 10 mM arabinose to prepare the chassis competent cells with plasmid pEcCas9; then, co-electrotransfer the gRNA-gltA plasmid and do-gltA gene fragment into the above-mentioned competent cells to achieve gene knockout; finally, pick 1 knocked-out colony and transfer it into an LB medium containing 10 mM rhamnose and culture at 37°C and 200 rpm for 12 h to eliminate gRNA-gltA, and then transfer it into an LB medium containing 10 g / L sucrose and culture at 37°C and 200 rpm for 12 h to eliminate the pEcCas9 plasmid.

[0038] 1.2 Knockout of the D-lactate dehydrogenase gene ldhA Using the genome of Escherichia coli K-12 as a template, the upstream 500 bp (as shown in SEQ ID NO.15) of the gene ldhA (as shown in SEQ ID NO.14) of D-lactate dehydrogenase was amplified by PCR using primers do-ldhA-F1 / R1 to obtain the do-ldhA-1 gene fragment.

[0039] Using the genome of Escherichia coli K-12 as a template, the downstream 500 bp (as shown in SEQ ID NO.16) of the D-lactate dehydrogenase gene ldhA was amplified by PCR using primers do-ldhA-F2 / R2 to obtain the do-ldhA-2 gene fragment.

[0040] Using the do-ldhA-1 gene fragment and the do-ldhA-2 gene fragment as templates, PCR amplification was carried out using primers do-ldhA-F1 / R2 to obtain the ldhA homologous arm do-ldhA gene fragment (as shown in SEQ ID NO.17).

[0041] Using the plasmid pECgRNA as a template, amplification was carried out using primers gRNA-ldhA-F / gRNA-R to obtain the DNA fragment gRNA-ldhA (SEQ ID NO.18).

[0042] The primer sequences used are as follows: do-ldhA-F1: 5’- CAAGCAGAATCAAGTTCTACCGTG -3’; SEQ ID NO.19.

[0043] do-ldhA-R1: 5’-AATGCAGGGGAGCGGCAAGA AAGACTTTCTCCAGTGATGTTGAATC -3’; SEQID NO.20.

[0044] do-ldhA-F2: 5’- TCTTGCCGCTCCCCTGCATTC -3’; SEQ ID NO.21.

[0045] do-ldhA-R2: 5’- TGTCTGTTTTGCGGTCGC -3’; SEQ ID NO.22.

[0046] gRNA-ldhA-F: 5’- GGACTAGTGATACGCGCGGTGAATACGGGTTTTAGAGCTAGAAATAGCAAGTT -3’; SEQ ID NO.23.

[0047] gRNA-R: same as SEQ ID NO.13.

[0048] Digest the DNA fragment gRNA-ldhA and the plasmid pECgRNA with the restriction enzymes SpeI-HF and XhoI, respectively.

[0049] Ligate the DNA fragment gRNA-ldhA recovered by digestion with the plasmid pECgRNA recovered by digestion using T4 ligase to obtain the plasmid gRNA-ldhA.

[0050] Prepare competent cells of the recombinant strain VT0002, and electrotransfer the plasmid gRNA-ldhA, the plasmid pEcCas9, and the do-ldhA gene fragment into the competent cells of the recombinant strain VT0002 to obtain the recombinant strain VT0003 with the ldhA gene knocked out by CRISPR-Cas9.

[0051] 1.3 Knock out the pyruvate dehydrogenase [ubiquinone] gene poxB Using the genome of Escherichia coli K-12 as a template, perform PCR amplification on 500 bp upstream (as shown in SEQ ID NO. 25) of the gene poxB (as shown in SEQ ID NO. 24) of pyruvate dehydrogenase [ubiquinone] using the primers do-poxB-F1 / R1 to obtain the do-poxB-1 gene fragment.

[0052] Using the genome of Escherichia coli K-12 as a template, perform PCR amplification on 500 bp downstream (as shown in SEQ ID NO. 26) of the gene poxB of pyruvate dehydrogenase [ubiquinone] using the primers do-poxB-F2 / R2 to obtain the do-poxB-2 gene fragment.

[0053] Using the do-poxB-1 gene fragment and the do-poxB-2 gene fragment as templates, perform PCR amplification using the primers do-poxB-F1 / R2 to obtain the poxB homologous arm do-poxB gene fragment (as shown in SEQ ID NO. 27).

[0054] Using the plasmid pECgRNA as a template, perform amplification using the primers gRNA-poxB-F / gRNA-R to obtain the DNA fragment gRNA-poxB (SEQ ID NO. 28).

[0055] The primer sequences used are as follows: do-poxB-F1: 5’- GCGGCCCGGCTCCGTATAT -3’; SEQ ID NO. 29.

[0056] do-poxB-R1: 5’-GACGGGAAATGCCACCCTTT GGTTCTCCATCTCCTGAATGTGAT -3'; SEQ ID NO. 30.

[0057] do-poxB-F2: 5’- AAAGGGTGGCATTTCCCGTCAT -3'; SEQ ID NO. 31.

[0058] do-poxB-R2: 5’- AATTCCCATGCTTCTTTCAGGTATTCCC -3'; SEQ ID NO. 32.

[0059] gRNA-poxB-F : 5’- GGACTAGTGCCAAAACACTCGAATCGGCGTTTTAGAGCTAGAAATAGCAAGTT -3'; SEQ ID NO. 33.

[0060] gRNA-R: same as SEQ ID NO. 13.

[0061] Digest the DNA fragments gRNA-poxB and plasmid pECgRNA with restriction endonucleases speI-HF and Xhol respectively.

[0062] Ligate the digested and recovered DNA fragment gRNA-poxB with the digested and recovered plasmid pECgRNA using T4 ligase to obtain plasmid gRNA-poxB.

[0063] Prepare competent cells of recombinant strain VT0003, and electrotransfer plasmid gRNA-poxB, plasmid pEcCas9, and do-poxB gene fragment into the competent cells of recombinant strain VT0003 to obtain recombinant strain VT0004 with the poxB gene knocked out by CRISPR-Cas9.

[0064] Construction of the 2-phosphoketolase pathway 2.1 Construction of the overexpression plasmid and strain of the phosphoketolase gene Using the codon-optimized phosphoketolase (Phosphoketolase) gene xfp (as shown in SEQ ID NO. 34) from Clostridium acetobutylicum synthesized by BGI as a template, perform PCR amplification using primers xfp-ca-F / R to obtain the xfp gene fragment.

[0065] Using plasmid pCOLADuet-1 as a template, perform amplification using primers cola-ca-F / R to obtain the linearized plasmid pCOLADuet-1.

[0066] Perform homologous recombination ligation of the xfp gene fragment with the linearized plasmid pCOLADuet-1 to obtain plasmid pCOLA-xfpCA.

[0067] The plasmids pCOLA-xfpCA, pACYC-fnp, and pCDF-tbytp were electrotransformed into the competent cells of the recombinant strain VT0004 to obtain a new recombinant strain VT0005.

[0068] For the homologous recombination system and procedure, refer to the Beijing TransGen Biotech Basic Edition Homologous Recombination Seamless Cloning Kit.

[0069] The primer sequences used are as follows: xfp-ca-F: 5’-AAGGAGATATACAT ATGCAGAGCATCATTGGTAAGCATAAGG -3’; SEQ ID NO.35.

[0070] xfp-ca-R: 5’-GAGATCTGC TTAAACATGCCACTGCCAATTGGTAATTTC -3’; SEQ ID NO.36.

[0071] cola-ca-F: 5’-GGCATGTTTAAGCAGATCTCAATTGGATATCGGCCG-3’; SEQ ID NO.37.

[0072] cola-ca-R: 5’-GCTCTGCATATGTATATCTCCTTCTTATACTTAACTAATATACTAAGATGGGGAATT-3’; SEQ ID NO.38.

[0073] The recombinant strain VT0005 was fermented in a shake flask. A 250 mL conical flask was used as the culture container for the shake flask fermentation system. A single colony was inoculated into 4 mL of LB liquid medium and activated at 37°C and 250 rpm for 12 h to obtain a seed culture. The seed culture (initial OD600 = 0.01) was transferred to M9 medium at an inoculation amount of 1% and cultured with shaking at 37°C and 250 rpm. When OD600 ≈ 0.8, 0.05 mM IPTG was added to induce the expression of foreign genes, and simultaneously the culture temperature was adjusted to 30°C for continued fermentation. The self-induction time was recorded as 0 h. After continuous culture for 48 h, samples were taken to detect the yield and conversion rate of 1,3-butanediol.

[0074] M9 medium: 30 g / L glucose monohydrate, 5 g / L yeast powder, 11.3 g / L M9 low-salt medium (5-fold concentrated), 0.25 g / L MgCl2·7H2O, 0.11 g / L CaCl2, 0.05 g / L EDTA, 8.3 mg / L FeCl2·6H2O, 0.83 mg / L ZnCl2, 0.13 mg / L CuCl2·2H2O, 0.1 mg / L CoCl2·2H2O, 0.1 mg / L H3BO3, 0.016 mg / L MnCl2·4H2O.

[0075] Calculation formula for conversion rate: Conversion rate = concentration of 1,3-butanediol (g / L) / (initial glucose concentration (g / L) - remaining glucose concentration (g / L)).

[0076] Fermentation result: the yield of 1,3-butanediol was 11.18 g / L, and the conversion rate was 0.388 g / g.

[0077] 2.2 Construction of overexpression plasmid and strain of phosphate acetyltransferase gene Using the genome of Escherichia coli (E. coli) K-12 as a template, the phosphate acetyltransferase (pta) gene (as shown in SEQ ID NO. 39) was amplified by PCR using primers pta-ec-F / R to obtain the pta gene fragment.

[0078] Using the plasmid pCOLA-xfpCA as a template, amplification was carried out using primers co-xpEC-F / R to obtain the linearized plasmid pCOLA-xfpCA.

[0079] The PCR amplification system and amplification program were the same as above.

[0080] The pta gene fragment was ligated to the linearized plasmid pCOLA-xfpCA by homologous recombination to obtain the plasmid pCOLA-xfpCA-ptaEC.

[0081] The plasmids pCOLA-xfpCA-ptaEC, pACYC-fnp, and pCDF-tbytp were electrotransformed into the competent cells of the recombinant strain VT0004 to obtain a new recombinant strain VT0006.

[0082] The primer sequences used are as follows: pta-ec-F: 5’-CATGTTTAATAAAGGAGATATACC ATGCTGATCCCTACCGGAACC -3’; SEQ ID NO. 40.

[0083] pta-ec-R: 5’-TTACTGCTGCTGTGCAGACTGAAT -3'; SEQ ID NO. 41.

[0084] co-xpEC-F: 5'-GTCTGCACAGCAGCAGTAAGCAGATCTCAATTGGATATCGGCCG-3'; SEQ ID NO. 42.

[0085] co-xpEC-R: 5'-GGGATCAGCATGGTATATCTCCTTTATTAAACATGCCACTGCCAATTGGTAATTTC-3'; SEQ ID NO. 43.

[0086] Flask fermentation of recombinant strain VT0006: The flask fermentation system and process are the same as above.

[0087] Fermentation result: The yield of 1,3-butanediol is 11.98 g / L, and the conversion rate is 0.412 g / g.

[0088] Rational construction of the cofactor regeneration network 3.1 Construction of overexpression plasmids and strains for enhancing cofactor NADPH Using the genome of Escherichia coli K-12 as a template, the glucose-6-phosphate 1-dehydrogenase gene zwf (as shown in SEQ ID NO. 44) was amplified by PCR using primers zwf-F / R to obtain the zwf gene fragment.

[0089] Using the genome of Escherichia coli K-12 as a template, the 6-phosphogluconate dehydrogenase, decarboxylating gene gnd (as shown in SEQ ID NO. 45) was amplified by PCR using primers gnd-F / R to obtain the gnd gene fragment.

[0090] From Azospirillum palustre ( ) with codon optimization and synthesis by BGI, the mutant gene apfdh D222Q-A199G / H380S-C256A / C146S (as shown in SEQ ID NO. 46) of formate dehydrogenase (hereinafter referred to as apfdh*) was used as a template, and amplified by PCR using primers apdfh-F / R to obtain the apfdh* gene fragment.

[0091] Using plasmid pCOLA-xfpCA-ptaEC as a template, amplification was carried out using primers cola-zg-F / R to obtain linearized plasmid pCOLA-xfpCA-ptaEC.

[0092] The PCR amplification system and amplification program were the same as above.

[0093] The zwf and gnd gene fragments were ligated by homologous recombination with linearized plasmid pCOLA-xfpCA-ptaEC to obtain plasmid pCOLA-zgxp.

[0094] Plasmids pCOLA-zgxp, pACYC-fnp, and pCDF-tbytp were electrotransformed into the competent cells of recombinant strain VT0004 to obtain a new recombinant strain VT0007.

[0095] Using plasmid pACYC-fnp as a template, amplification was carried out using primers op-apf-F / R to obtain linearized plasmid pACYC-fnp.

[0096] The apfdh* gene fragment was ligated by homologous recombination with linearized plasmid pACYC-fnp to obtain plasmid pACYC-fapnp.

[0097] Plasmids pCOLA-zgxp, pACYC-fapnp, and pCDF-tbytp were electrotransformed into the competent cells of recombinant strain VT0004 to obtain a new recombinant strain VT0008.

[0098] The primer sequences used are as follows: zwf-F: 5’-GTTTAACTTTAATAAGGAGATATACC ATGGCGGTAACGCAAACAGC -3’; SEQ IDNO.47.

[0099] zwf-R: 5’-TGGACATGTATATCCTTCTCCTT TTACTCAAACTCATTCCAGGAACGACCAT -3’; SEQID NO.48.

[0100] gnd-F: 5’-GAGTAAAAGGAGAAGGATATAC ATGTCCAAGCAACAGATCGGCGTAG -3’; SEQ IDNO.49.

[0101] gnd-R: 5’-TCGAATTCGGATCCTGGCT TTAATCCAGCCATTCGGTATGGAACAC -3’; SEQ IDNO.50.

[0102] apfdh-F: 5’-CAAATCACTCGAACAACCTGAATAAAAGGAGAAGGATATAC ATGGCCAAGATTGTGTGTGTTCTGTAT -3'; SEQ ID NO.51.

[0103] apfdh-R: 5'- TGCCGGAACTGCTGCTTTAAAAC -3'; SEQ ID NO.52.

[0104] cola-zg-F: 5'-AGCCAGGATCCGAATTCGAGC-3'; SEQ ID NO.53.

[0105] cola-zg-R: 5'-GGTATATCTCCTTATTAAAGTTAAACAAAATTATTTCTACAGGGGAAT-3'; SEQ ID NO.54.

[0106] op-apf-F: 5'-TTAAAGCAGCAGTTCCGGCATGCAGGTCGACAAGCTTGCG-3'; SEQ ID NO.55.

[0107] op-apf-R: 5'-TTATTCAGGTTGTTCGAGTGATTTGATGTAGTCATAAATC-3'; SEQ ID NO.56.

[0108] Flask fermentation of recombinant strains VT0007 and VT0008: The flask fermentation system and process are the same as above.

[0109] Fermentation results: The yield of 1,3-butanediol in VT0007 was 12.32 g / L, and the conversion rate was 0.423 g / g; the yield of 1,3-butanediol in VT0008 was 12.60 g / L, and the conversion rate was 0.433 g / g.

[0110] 3.2 Construction of overexpression plasmid and strain for enhancing cofactor ATP Using the genome of Escherichia coli K-12 as a template, the polyphosphate kinase (ppk) gene ppk (as shown in SEQ ID NO.57) was amplified by PCR using primers ppk-F / R to obtain the ppk gene fragment.

[0111] Using plasmid pACYC-fapnp as a template, amplification was carried out using primers over-ppk-F / R to obtain the linearized plasmid pACYC-fapnp.

[0112] The PCR amplification system and amplification program are the same as above.

[0113] The ppk gene fragment was ligated to the linearized plasmid pACYC-fapnp by homologous recombination to obtain plasmid pACYC-fpapnp.

[0114] The plasmids pCOLA-zgxp, pACYC-fpapnp, and pCDF-tbytp were electrotransformed into the competent cells of the recombinant strain VT0004 to obtain a new recombinant strain VT0009.

[0115] The primer sequences used are as follows: ppk-F: 5'-AACTTTAATAAGGAGATATA ATGGGTCAGGAAAAGCTATACATCGAAAAAG -3'; SEQ ID NO.58.

[0116] ppk-R: 5'-CGCAAGCTTGTCGACCTGCA TTATTCAGGTTGTTCGAGTGATTTGATGTA -3'; SEQ ID NO.59.

[0117] over-ppk-F: 5'-TGCAGGTCGACAAGCTTGCG-3'; SEQ ID NO.60.

[0118] over-ppk-R: 5'-CCCATTATATCTCCTTATTAAAGTTTTATTTCTTCTGTCCATAAGCTCTGGTGGC-3'; SEQ ID NO.61.

[0119] Flask fermentation of the recombinant strain VT0009: The flask fermentation system and process are the same as above.

[0120] Fermentation result: The yield of 1,3-butanediol in VT0009 was 12.75 g / L, and the conversion rate was 0.438 g / g.

[0121] 4 Relief of metabolic feedback inhibition nodes 4.1 Construction of plasmids and strains for knocking out pdhR to relieve feedback inhibition at the acetyl-CoA node Using the genome of Escherichia coli K-12 as a template, the upstream 500 bp (as shown in SEQ ID NO.63) of the pyruvate dehydrogenase complex repressor gene pdhR (as shown in SEQ ID NO.62) was amplified by PCR using the primers do-pdhR-F1 / R1 to obtain the do-pdhR-1 gene fragment.

[0122] Using the genome of Escherichia coli K-12 as a template, the 500 bp downstream of the pyruvate dehydrogenase complex repressor gene pdhR (as shown in SEQ ID NO.64) was amplified by PCR using primers do-pdhR-F2 / R2 to obtain the do-pdhR-2 gene fragment.

[0123] Using the do-pdhR-1 gene fragment and the do-pdhR-2 gene fragment as templates, PCR amplification was carried out using primers do-pdhR-F1 / R2 to obtain the pdhR homologous arm do-pdhR gene fragment (as shown in SEQ ID NO.65).

[0124] Using plasmid pECgRNA as a template, amplification was carried out using primers gRNA-pdhR-F / gRNA-R to obtain the DNA fragment gRNA-phdR (SEQ ID NO.66).

[0125] The primer sequences used are as follows: do-pdhR-F1: 5’- ATGCGTGTGTAAGTTTGCAATTCCGT -3’; SEQ ID NO.67.

[0126] do-pdhR-R1: 5’-AATTTTTACCAGAAAAATCA GAGTTCCTGTCTTAAGCCACTTGCC -3’; SEQ IDNO.68.

[0127] do-pdhR-F2: 5’-TTAAGACAGGAACTC TGATTTTTCTGGTAAAAATTATCCAGAAGATGTTGTAAA TCAAG -3’; SEQ ID NO.69.

[0128] do-pdhR-R2: 5’- AAGACTGGAAGGACGCCATATGG -3’; SEQ ID NO.70.

[0129] gRNA-pdhR-F: 5’- GGACTAGTTCAGATTGCCGTCACCGAAGGTTTTAGAGCTAGAAATAGCAAGTT -3’; SEQ ID NO.71.

[0130] gRNA-R: The same as SEQ ID NO.13.

[0131] The DNA fragment gRNA-phdR and plasmid pECgRNA were digested with restriction endonucleases speI-HF and Xhol respectively.

[0132] Restriction digestion system: 40 µL of DNA fragment gRNA-phdR / plasmid pECgRNA, 5 µL of rCutsmart buffer, 1 µL of speI-HF, 1 µL of Xhol, 3 µL of ddH2O.

[0133] Restriction digestion procedure: 15 min at 37 °C.

[0134] The DNA fragment gRNA-phdR recovered after restriction digestion was ligated with the plasmid pECgRNA recovered after restriction digestion using T4 DNA ligase to obtain the plasmid gRNA-pdhR.

[0135] Ligation system: 1 µL of T4 DNA Ligase, 1 µL, 2 µL of the DNA fragment gRNA-phdR recovered after restriction digestion, 1 µL of the plasmid pECgRNA recovered after restriction digestion, 5 µL of ddH2O.

[0136] Ligation procedure: 3 h at 22 °C.

[0137] The plasmid gRNA-pdhR, plasmid pEcCas9, and do-pdhR gene fragment were electrotransformed into the competent cells of the recombinant strain VT0004 to obtain the recombinant strain VT0010 with the pdhR gene knocked out by CRISPR-Cas9.

[0138] The competent cells of the recombinant strain VT0010 were prepared, and the plasmids pCOLA-zgxp, pACYC-fpapnp, and pCDF-tbytp were electrotransformed into the competent cells of the recombinant strain VT10 to obtain a new recombinant strain VT0011.

[0139] Flask fermentation of the recombinant strain VT0011: The flask fermentation system and process were the same as above.

[0140] Fermentation result: The yield of 1,3-butanediol in VT0011 was 13.31 g / L, and the conversion rate was 0.458 g / g.

[0141] Shunt optimization of the 5-carbon metabolic flux 5.1 Knockout of the pfkB gene by CRISPR-Cas9 Using the genome of Escherichia coli K-12 as a template, the upstream 500 bp (as shown in SEQ ID NO.73) of the gene pfkB (encoding ATP-dependent 6-phosphofructokinase isozyme 2, as shown in SEQ ID NO.72) was amplified by PCR using the primers do-pfkB-F1 / R1 to obtain the do-pfkB-1 gene fragment.

[0142] Using the genome of Escherichia coli K-12 as a template, the downstream 500 bp of the gene pfkB of ATP-dependent 6-phosphofructokinase isozyme 2 (as shown in SEQ ID NO.74) was amplified by PCR using primers do-pfkB-F2 / R2 to obtain the do-pfkB-2 gene fragment.

[0143] Using the do-pfkB-1 gene fragment and the do-pfkB-2 gene fragment as templates, PCR amplification was carried out using primers do-pfkB-F1 / R2 to obtain the pfkB homologous arm do-pfkB gene fragment (as shown in SEQ ID NO.75).

[0144] Using the plasmid pECgRNA as a template, amplification was carried out using primers gRNA-pfkB-F / gRNA-R to obtain the DNA fragment gRNA-pfkB (SEQ ID NO.76).

[0145] The primer sequences used are as follows: do-pfkB-F1: 5’- ACCAGGTCATGGTGGTGTCAGC -3’; SEQ ID NO.77.

[0146] do-pfkB-R1: 5’- CATTTCCTCCTATAGGCTGATTTCAGTCTGG -3’; SEQ ID NO.78.

[0147] do-pfkB-F2: 5’-CTGAAATCAGCCTATAGGAGGAAATG CAAAAACATTCCCCCAGCATTGGG -3’; SEQ ID NO.79.

[0148] do-pfkB-R2: 5’- ACATGATGTCTCTCCCATGTTGTCTGC -3’; SEQ ID NO.80.

[0149] gRNA-pfkB-F: 5’- GGACTAGTCACGTACATGTGGAAGCAAGGTTTTAGAGCTAGAAATAGCAAGTT -3’; SEQ ID NO.81.

[0150] gRNA-R: same as SEQ ID NO.13.

[0151] The DNA fragment gRNA-pfkB and the plasmid pECgRNA were digested with restriction endonucleases speI-HF and Xhol respectively.

[0152] The digestion system and procedure are the same as above.

[0153] The DNA fragment gRNA-pfkB recovered by enzymatic digestion was ligated with the plasmid pECgRNA recovered by enzymatic digestion using T4 ligase to obtain the plasmid gRNA-pfkB.

[0154] The ligation system and procedure were the same as above.

[0155] The plasmid gRNA-pfkB, plasmid pECCas9, and do-pfkB gene fragment were electrotransformed into the competent cells of the recombinant strain VT0010 to obtain the recombinant strain VT0012 with the pfkB gene knocked out by CRISPR-Cas9.

[0156] The competent cells of the recombinant strain VT0012 were prepared, and the plasmids pCOLA-zgxp, pACYC-fpapnp, and pCDF-tbytp were electrotransformed into the competent cells of the recombinant strain VT0012 to obtain a new recombinant strain VT0013.

[0157] Flask fermentation of the recombinant strain VT0013: The flask fermentation system and process were the same as above.

[0158] Fermentation result: The yield of 1,3-butanediol was 13.68 g / L, and the conversion rate was 0.470 g / g.

[0159] 5.2 CRISPR-Cas9 knockout of the gapA gene Using the genome of Escherichia coli K-12 as a template, the upstream 500 bp (as shown in SEQ ID NO.83) of the glyceraldehyde-3-phosphate dehydrogenase A (gapA) gene (as shown in SEQ ID NO.82) was amplified by PCR using the primers do-gapA-F1 / R1 to obtain the do-gapA-1 gene fragment.

[0160] Using the genome of Escherichia coli K-12 as a template, the downstream 500 bp (as shown in SEQ ID NO.84) of the glyceraldehyde-3-phosphate dehydrogenase A (gapA) gene was amplified by PCR using the primers do-gapA-F2 / R2 to obtain the do-gapA-2 gene fragment.

[0161] The downstream 500 bp fragment do-gapA-2 of the glyceraldehyde-3-phosphate dehydrogenase A gene gapA derived from Escherichia coli K-12:

[0162] Using the do-gapA-1 gene fragment and the do-gapA-2 gene fragment as templates, PCR amplification was carried out using the primers do-gapA-F1 / R2 to obtain the gapA homologous arm do-gapA gene fragment (as shown in SEQ ID NO.85).

[0163] Using the plasmid pECgRNA as a template, amplification was carried out using the primers gRNA-gapA-F1 / gRNA-R to obtain the DNA fragment gRNA-gapA (SEQ ID NO.86).

[0164] The primer sequences used are as follows: do-gapA-F1: 5'- CAGCGGGGCATCGCAGATCAAAC -3'; SEQ ID NO.87.

[0165] do-gapA-R1: 5'-TCACAGTGTCATCTCAAC ATATTCCACCAGCTATTTGTTAGTGAATAAAAGGT TG -3'; SEQ ID NO.88.

[0166] do-gapA-F2: 5'-GGTGGAATAT GTTGAGATGACACTGTGATCTAAAAAGAGCG -3'; SEQ IDNO.89.

[0167] do-gapA-R2: 5'- CGCTAACAGCGTAAAGTCGTGCG -3'; SEQ ID NO.90.

[0168] gRNA-gapA-F: 5'-GGACTAGTTCTCACAAAGACTGGCGCGGGTTTTAGAGCTAGAAATAGCAAGTT-3'; SEQ ID NO.91.

[0169] gRNA-R: same as SEQ ID NO.13.

[0170] The DNA fragment gRNA-gapA and the plasmid pECgRNA were digested with the restriction endonucleases speI-HF and Xhol respectively.

[0171] The digestion system and procedure were the same as above.

[0172] The DNA fragment gRNA-gapA recovered by digestion and the plasmid pECgRNA recovered by digestion were ligated with T4 to obtain the plasmid gRNA-gapA.

[0173] The ligation system and procedure were the same as above.

[0174] The plasmid gRNA-gapA, plasmid pECCas9, and do-gapA gene fragment were electrotransformed into the competent cells of the recombinant strain VT0012 to obtain the recombinant strain VT0014 with the gapA gene knocked out by CRISPR-Cas9.

[0175] The competent cells of the recombinant strain VT0014 were prepared, and the plasmids pCOLA-zgxp, pACYC-fpapnp, and pCDF-tbytp were electrotransformed into the competent cells of the recombinant strain VT0014 to obtain a new recombinant strain VT0015.

[0176] Flask fermentation of the recombinant strain VT0015: The flask fermentation system and process were the same as above.

[0177] Fermentation results: The yield of 1,3-butanediol was 14.17 g / L, and the conversion rate was 0.487 g / g.

[0178] 6 Continuous fed-batch scale-up experiment in a 5 L fermenter Fermentation process in a 6 L fermenter: The fermentation tank scale-up system was used for scale-up culture in a 5 L bioreactor. It was prepared through two-stage seed amplification: The primary seed was a single colony activation solution cultured in LB liquid medium at 37°C for 12 h, and the secondary seed was transferred to fresh LB liquid medium at an inoculation amount of 2.5% and cultured overnight. The secondary seed was inoculated into TB medium at an inoculation amount of 5%, and this was recorded as 0 h. When cultured at 37°C to the middle and late logarithmic phase (OD600≈1.5), 0.05 mM IPTG was added for induction, and at the same time, the constant temperature fermentation was maintained at 30°C through the temperature control system. At this time, feeding started (the feed used 800 g / L glucose monohydrate) to control the sugar concentration at 10 - 20 g / L, and the total fermentation time was controlled within 100 h.

[0179] TB medium: 20 g / L glucose monohydrate, 24 g / L yeast extract, 12 g / L peptone, 4 mL glycerol, 2.31 g / L KH2PO4, 12.54 g / L K2HPO4.

[0180] The fermentation results of the recombinant strain VT0015 in the fermenter are shown in Table 1.

[0181] Table 1

[0182] At 57 h of fermentation, the conversion rate of 1,3-butanediol was 0.462 g / g; at 68 h of fermentation, the conversion rate of 1,3-butanediol was 0.450 g / g.

[0183] 7 Directed evolution and orthogonal assembly of the 1,3-butanediol synthesis module 7.1 Obtaining the butyraldehyde dehydrogenase mutant Bld by directed evolutionD113N Using the codon-optimized butyraldehyde dehydrogenase mutant gene bld synthesized by BGI from Clostridium saccharoperbutylacetonicum N1-4(HMT)) D113N / L273T (as shown in SEQ ID NO.92, hereinafter referred to as bld**) as a template, PCR amplification was carried out using primers bld**-F / R to obtain the bld** gene fragment.

[0184] Using plasmid pCDF-tbytp as a template, amplification was carried out using primers cdf-bld**-F / R to obtain the linearized plasmid pCDF-tbytp.

[0185] The bld** gene fragment was ligated to the linearized plasmid pCDF-tbytp by homologous recombination to obtain plasmid pCDF-tb**ytp.

[0186] Plasmids pCOLA-zgxp, pACYC-fpapnp, and pCDF-tb**ytp were electrotransformed into the competent cells of recombinant strain VT0014 to obtain a new recombinant strain VT0016.

[0187] The homologous recombination system and procedure are shown in the Beijing TransGen Biotech Basic Edition Homologous Recombination Seamless Cloning Kit.

[0188] The primer sequences used are as follows: bld**-F: 5’-ATGATTAAAGATACCCTGGTTAGCATCACG-3’; SEQ ID NO.93.

[0189] bld**-R: 5’-TTTAACCAGCCAGTACGCAGC-3’; SEQ ID NO.94.

[0190] cdf-bld**-F: 5’-GCGTACTGGCTGGTTAAAAGGAGATATACCATGAACAACTTTAATCT-3’; SEQID NO.95.

[0191] cdf-bld**-R: 5’-CTAACCAGGGTATCTTTAATCATGTATATCCTTCTCCTTAAAGTTAAACAAAATTATTTCTAG-3’; SEQ ID NO.96.

[0192] Shake flask fermentation of recombinant strain VT0016: The shake flask fermentation system and process are the same as above.

[0193] Fermentation result: The yield of 1,3-butanediol was 14.94 g / L, and the conversion rate was 0.515 g / g.

[0194] 7.2 Orthogonal assembly of acetyl-CoA acetyltransferase mutant PhaA F219Y and acetoacetyl-CoA reductase mutant PhaB Q47L Using the codon-optimized acetyl-CoA acetyltransferase mutant gene phaA F219Y from Cupriavidus necator ATCC 17699 synthesized by BGI (hereinafter referred to as phaA* as shown in SEQ ID NO.97) as a template, PCR amplification was carried out using primers 219-F / R to obtain the phaA* gene fragment.

[0195] Using the codon-optimized acetoacetyl-CoA reductase mutant gene phaB Q47L from Cupriavidus necator ATCC 17699 synthesized by BGI (hereinafter referred to as phaB* as shown in SEQ ID NO.98) as a template, PCR amplification was carried out using primers 47-F / R to obtain the phaB* gene fragment.

[0196] Using plasmid pCDF-tb**ytp as a template, amplification was carried out using primers p**-F / R to obtain the linearized plasmid pCDF-tb**ytp.

[0197] The phaA* gene fragment, phaB* gene fragment and the linearized plasmid pCDF-tb**ytp were ligated by homologous recombination to obtain plasmid pCDF-tb**ytp**.

[0198] Plasmids pCOLA-zgxp, pACYC-fpapnp, and pCDF-tb**ytp** were electrotransformed into the competent cells of recombinant strain VT0014 to obtain a new recombinant strain VT0016.

[0199] The homologous recombination system and procedure can be found in the Beijing TransGen Biotech Basic Edition Homologous Recombination Seamless Cloning Kit.

[0200] The primer sequences used are as follows: 219-F: 5’-CGGCTTACATATGGGCTAAAGGAGATATACC ATGACTGACGTTGTTATTGTTTCCG-3'; SEQ ID NO. 99.

[0201] 219 - R: 5'- TTATTTACGCTCTACGGCCAGTGC -3'; SEQ ID NO. 100.

[0202] 47 - F: 5'-AGAAATAATTTTGTTTAACTTTAAGGAGAAGGATATAC ATGACCCAGCGCATTGCGT -3'; SEQ ID NO. 101.

[0203] 47 - R: 5'- TTAGCCCATATGTAAGCCGCC -3'; SEQ ID NO. 102.

[0204] p** - F: 5'-CTGGCCGTAGAGCGTAAATAACGAATTCGAGCTCCGTCGAC - 3'; SEQ ID NO. 103.

[0205] p** - R: 5'-GTATATCCTTCTCCTTAAAGTTAAACAAAATTATTTCT - 3'; SEQ ID NO. 104.

[0206] Flask fermentation of recombinant strain VT0017: The flask fermentation system and process are the same as above.

[0207] Fermentation result: The yield of 1,3 - butanediol is 15.29 g / L, and the conversion rate is 0.527 g / g. It reaches 105% of the theoretical conversion rate.

[0208] In strains VT001 - VT004, the reaction formula for the maximum conversion rate of glucose to 1,3 - butanediol: 1 Glucose + 3 NADPH → 1 1,3 - BDO + 4 NADH + 2 ATP + 2 CO2 Therefore, the theoretical conversion rate = (1 mol 1,3 - BDO * M1) / (1 mol Glucose * M2) = 0.5 g / g.

[0209] In strains VT004 - VT017, the reaction formula for the maximum conversion rate of glucose to 1,3 - butanediol: Glu + ATP → 1.09 1,3 - BDO + 1.64 CO2 Therefore, the new theoretical conversion rate = (1.09 mol 1,3 - BDO * M1) / (1 mol Glucose * M2) = 0.545 g / g.

[0210] Among them, M1 is the molar mass of 1,3-BDO, which is 90 g / mol; M2 is the molar mass of glucose, which is 180 g / mol.

[0211] 8 Continuous feeding scale-up experiment in a 5 L fermenter The fermentation results of the recombinant strain VT0017 in the fermenter are shown in Table 2.

[0212] Table 2

[0213] At 57 h of fermentation, the conversion rate of 1,3-butanediol is 0.470 g / g; at 67 h of fermentation, the conversion rate of 1,3-butanediol is 0.465 g / g.

[0214] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be obvious to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to these embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A genetically engineered bacterium for producing 1,3-butanediol, characterized in that using JM109(DE3) as the starting strain, weakening the citrate synthase gene gltA; knocking out the D-lactate dehydrogenase gene ldhA and the pyruvate dehydrogenase-ubiquinone gene poxB; overexpressing the phosphoketolase gene xfp, the phosphotransacetylase gene pta, PhaA, PhaB, Bld*, yqhd, fdh1, nadk, pntA, pntB genes; The weakening of the citrate synthase gene gltA is to replace the upstream UTR sequence of the citrate synthase gene gltA with the UTR-1 sequence; the UTR sequence is as shown in SEQ ID NO.4; the UTR-1 sequence is as shown in SEQ ID NO.1; The nucleotide sequence of the phosphoketolase gene xfp is as shown in SEQ ID NO.34; The nucleotide sequence of the phosphotransacetylase gene pta is as shown in SEQ ID NO.

39.

2. The genetically engineered bacterium for producing 1,3-butanediol according to claim 1, wherein It also includes overexpressing the glucose-6-phosphate dehydrogenase gene zwf and the 6-phosphogluconate dehydrogenase gene gnd; The nucleotide sequence of the glucose-6-phosphate dehydrogenase gene zwf is as shown in SEQ ID NO.44; The nucleotide sequence of the 6-phosphogluconate dehydrogenase gene gnd is as shown in SEQ ID NO.

45.

3. The genetically engineered bacterium for producing 1,3-butanediol according to claim 2, characterized in that, It also includes overexpressing the gene apfdh* of the formate dehydrogenase mutant; The nucleotide sequence of the gene apfdh* of the formate dehydrogenase mutant is as shown in SEQ ID NO.

46.

4. The genetically engineered bacterium for producing 1,3-butanediol according to claim 3, characterized in that, It also includes overexpressing the polyphosphate kinase gene ppk; The nucleotide sequence of the polyphosphate kinase gene ppk is as shown in SEQ ID NO.

57.

5. The genetically engineered bacterium for producing 1,3-butanediol according to claim 4, characterized in that, It also includes knocking out the pyruvate dehydrogenase complex inhibitor gene pdhR.

6. The genetically engineered bacterium for producing 1,3-butanediol according to claim 5, characterized in that, It also includes knocking out the ATP-dependent 6-phosphofructokinase isoenzyme 2 gene pfkB.

7. The genetically engineered bacterium for producing 1,3-butanediol according to claim 6, characterized in that, It also includes knocking out the glyceraldehyde-3-phosphate dehydrogenase A gene gapA.

8. A genetically engineered bacterium for producing 1,3-butanediol according to claim 7, characterized in that, Replacing the Bld* gene with the Bld** gene; The nucleotide sequence of the Bld** gene is as shown in SEQ ID NO.

92.

9. The genetically engineered bacterium for producing 1,3-butanediol according to claim 8, characterized in that, Replacing the PhaA gene with the PhaA* gene and replacing the PhaB gene with the PhaB* gene; The nucleotide sequence of the PhaA* gene is as shown in SEQ ID NO.97; The nucleotide sequence of the PhaB* gene is as shown in SEQ ID NO.

98.

10. Use of the genetically engineered bacterium according to any one of claims 1-9 in high-yield production of 1,3-butanediol.

Images