Clostridium tyrobutyricum for producing butyl butyrate by jointly utilizing glucose and xylose as well as construction method and application of clostridium tyrobutyricum

Abstract

The invention belongs to the field of gene engineering, and discloses clostridium tyrobutyricum for producing butyl butyrate by jointly utilizing glucose and xylose as well as a construction method and application of the clostridium tyrobutyricum. The strain has the following characteristics: a restriction enzyme rease gene is knocked out, a lactic dehydrogenase ldh2 gene, a lactic dehydrogenase ldh3 gene and a lactic dehydrogenase ldh1 gene are knocked out, an HPr kinase / phosphorylase hprK gene is knocked out, an aldol dehydrogenase adhE2 gene is knocked in at the site, a xylose transcription inhibition factor xylR gene is knocked out, and an aldol dehydrogenase adhE2 gene is knocked in at the site; a butyryl-CoA / acetic acid CoA transferase cat1 gene is knocked out, an aldehyde alcohol dehydrogenase adhE2 gene is knocked into the site, and alcohol acyltransferase VAAT and heat shock protease GroESL are overexpressed. The strain is obtained by a gene editing method, and can utilize glucose and xylose in lignocellulose hydrolysate to produce butyl butyrate at high yield.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, and specifically relates to a Clostridium butyricum strain that co-produces butyl butyrate using glucose and xylose, its construction method, and its application. Background Technology

[0002] Butyl butyrate is a short-chain fatty acid ester widely used in food, pharmaceuticals, cosmetics, chemicals, and biofuels. Currently, its industrial production mainly relies on chemical synthesis methods, with typical processes including: 1) catalytic condensation of butyric acid and butanol using concentrated sulfuric acid as a catalyst at 200-250℃; 2) disproportionation of n-butyraldehyde to butyric acid and butanol under Cu / ZnO / Al2O3 catalysis (255℃, 0.7MPa) with the participation of water, followed by esterification to butyl butyrate; and 3) using composite catalysts (such as dicp-2 / dicp-SC) to catalyze the formation of various esters from n-butyraldehyde under specific reaction conditions, from which butyl butyrate is then separated and purified. These processes generally suffer from drawbacks such as high pollution, high energy consumption, and reliance on petrochemical products. Under the triple pressures of the energy crisis, climate change, and environmental pollution, green and sustainable microbial fermentation methods are increasingly favored.

[0003] In microbial fermentation, the microorganisms that synthesize butyl butyrate naturally are *Clostridium sp. strain BOH3* and *C. acetobutylicum* NJ4. They catalyze the synthesis of butyl butyrate from the precursors butyrate and butanol under the action of endogenous lipases, but the yield is low. For non-natural butyl butyrate-synthesizing microorganisms, early methods involved the exogenous addition of another precursor, butyrate, and / or butanol, along with esterases, to achieve butyl butyrate synthesis. However, the production process involving the exogenous addition of enzymes or chemical precursors is complex and costly, severely limiting its potential for large-scale application. In recent years, the development of metabolic engineering and synthetic biology has provided new ideas for the de novo synthesis of butyl butyrate. For example, in *E. coli*, modular engineering has been used to simultaneously introduce butyryl-CoA, butanol, and butyl butyrate modules, enabling the de novo synthesis of butyl butyrate from glucose. However, metabolic modification is complex, and the yield and selectivity of butyl butyrate are low. In solvent-producing Clostridium beyere and Clostridium acetone-butanol, butyryl-CoA and butanol synthesis modules are inherently present. By introducing the key enzyme for butyl butyrate synthesis, namely alcohol acyltransferase, butyryl-CoA and butanol are condensed into butyl butyrate. However, the presence of acetone as a byproduct increases the difficulty of separating butyl butyrate.

[0004] Clostridium tyrobutyricum is a potential chassis cell for butyl butyrate synthesis due to its inherently high butyryl-CoA flux, simple culture conditions, and low byproduct production. Early methods involved directly adding butanol and lipase to the Clostridium tyrobutyricum fermentation broth, achieving a butyl butyrate yield of 34.7 g / L in 50 g / L glucose fermentation after process optimization. In recent years, researchers have utilized the CRISPR-Cas system and an iterative editing system based on upp / 5-fluorouracil reverse screening to achieve efficient de novo synthesis using glucose, mannitol, and other substrates. Based on metabolic engineering strategies, the precursor butanol pathway was enhanced, and the metabolic flux of the byproduct butyrate was blocked, thus constructing the enhanced engineered strain MV12 (Δupp,Δrease::Pctthl-adhE2,Δldh1::Pctthl-ctfAB,Δldh2::Pctthl-adhE2,Δcat1,Pfla-vaat). Under two-stage temperature control (37℃→25℃), the yield of butyl butyrate using mannitol as a substrate exceeded 142.6 g / L, setting a new record for the highest yield of butyl butyrate synthesized by microorganisms. However, mannitol itself is a high-value industrial raw material, which undoubtedly increases production costs and weakens the economic competitiveness of this process.

[0005] Lignocellulose hydrolysate (mainly containing glucose and xylose) is an ideal substrate to replace mannitol due to its wide availability, low price, and renewability. However, current research on the efficient synthesis of butyl butyrate from lignocellulose hydrolysate remains relatively scarce. Existing studies have attempted to overcome the limitations of single-strain synthesis by integrating the metabolic advantages of multiple strains through co-culture strategies, but the yield of butyl butyrate is generally low. Summary of the Invention

[0006] The primary objective of this invention is to overcome the shortcomings and deficiencies of the prior art and to provide a Clostridium butyricum strain that utilizes both glucose and xylose to produce butyl butyrate.

[0007] Another object of the present invention is to provide a method for constructing Clostridium butyricum that co-utilizes glucose and xylose to produce butyl butyrate.

[0008] Another object of the present invention is to provide the application of Clostridium butyricum, which co-utilizes glucose and xylose to produce butyl butyrate.

[0009] The objective of this invention is achieved through the following technical solution: a Clostridium butyricum strain that co-utilizes glucose and xylose to produce butyl butyrate, characterized by the following features:

[0010] (1) Knock out the restriction endonuclease rease gene;

[0011] (2) Knock out three lactate dehydrogenase genes, namely ldh2 (locus CTK_C11900), ldh3 (locus CTK_C14210) and ldh1 (locus CTK_C07420), to block the lactate pathway.

[0012] (3) Knock out the HPr kinase / phosphorylase hprK gene (locus CTK_C17290) and knock in the aldol dehydrogenase adhE2 gene at the same site.

[0013] (4) Knock out the xylR gene (locus CTK_C21030), and simultaneously knock in the aldol dehydrogenase adhE2 gene at the same site to relieve xylose utilization repression.

[0014] (5) Knock out the butyryl-CoA / acetic acid CoA transferase cat1 gene (locus CTK_C06520) and knock in the aldol dehydrogenase adhE2 gene at the same site to block the butyrate synthesis pathway and enhance butanol synthesis capacity.

[0015] (6) Overexpression of acyltransferase VAAT and overexpression of heat shock protease GroESL.

[0016] The aldol dehydrogenase adhE2 mentioned above is derived from Clostridium acetobutylicum.

[0017] The aldol dehydrogenase adhE2 gene is preferably expressed by the promoter Pctthl of the Clostridium butyricum endogenous thiolytic enzyme gene.

[0018] The nucleotide sequence of the promoter Pctthl is shown in SEQ ID NO.1.

[0019] The nucleotide sequence of the gene encoding the aldol dehydrogenase is shown in SEQ ID NO.2.

[0020] The gene for the acyltransferase VAAT is preferably driven by the promoter Pfla of the Clostridium acetone-butanol flavin protein gene.

[0021] The nucleotide sequence of the promoter Pfla is shown in SEQ ID NO.3.

[0022] The nucleotide sequence of the gene encoding the acyltransferase vaat is shown in SEQ ID NO.4.

[0023] The heat shock protease GroESL is derived from *Deinococcus wulumuqiensis* DSM 28115.

[0024] The heat shock protease GroESL gene is preferably expressed by the promoter Pcat1 of the Clostridium butyryl-CoA / acetic acid-CoA transferase gene.

[0025] The nucleotide sequence of the promoter Pcat1 is shown in SEQ ID NO.5.

[0026] The nucleotide sequence of the gene encoding the heat shock protease is shown in SEQ ID NO.6.

[0027] The above-mentioned method for constructing Clostridium butyricum, which utilizes both glucose and xylose to produce butyl butyrate, employs a multi-round continuous gene editing system based on the Clostridium butyricum endogenous type I-B CRISPR-Cas system. The specific steps are as follows:

[0028] S0: An editing plasmid targeting the restriction endonuclease rease gene was introduced into the Clostridium butyricum chassis strain to obtain Clostridium butyricum WTΔRMI;

[0029] S1: The editing plasmid that targets and knocks out ldh2 is introduced into Clostridium butyricum WTΔRMI; positive colonies are plated on RCM selective medium containing inducer and cultured to screen for positive clones with plasmid elimination and successful ldh2 gene knockout, namely WTΔRMIΔldh2 strain.

[0030] S2: The editing plasmid that targets and knocks out ldh3 is introduced into the WTΔRMIΔldh2 strain obtained in step S1, and the induction and screening process is repeated to obtain the WTΔRMIΔldh2Δldh3 strain.

[0031] S3: Iterative editing to build GB3: Repeat the iterative editing process of step S2, as follows:

[0032] The third round: Based on the WTΔRMIΔldh2Δldh3 strain, an editing plasmid that targets and knocks out ldh1 was introduced to knock out ldh1, resulting in the WTΔRMIΔldh2Δldh3Δldh1 strain, which was named engineered strain GB.

[0033] Fourth round: Based on the engineered strain GB, an editing plasmid that targets and knocks out hprK and inserts adhE2 was introduced. The first adhE2 expression cassette was introduced while knocking out hprK to obtain engineered strain GB1.

[0034] Fifth round: Based on the strains from the fourth round, an editing plasmid that targets and knocks out xylR and inserts adhE2 was introduced. At the same time as knocking out xylR, a second adhE2 expression cassette was introduced to obtain the engineered strain GB2.

[0035] Sixth round: Based on the strains from the fifth round, an editing plasmid that targets and knocks out cat1 and inserts adhE2 was introduced. At the same time as knocking out cat1, a third adhE2 expression cassette was introduced to obtain engineered strain GB3.

[0036] S4: The plasmid containing the Pfla-vaat and Pcat1-groESL expression cassettes was introduced into the engineered strain GB3 to obtain the target engineered strain GVB3NG, which is Clostridium butyricum that co-produces butyl butyrate using glucose and xylose.

[0037] The preferred method of introduction is conjugative introduction, which involves co-culturing Escherichia coli containing the editing plasmid and Clostridium butyricum, and transferring the editing plasmid from Escherichia coli to Clostridium butyricum.

[0038] The editing plasmid targeting the restriction endonuclease rease gene described in step S0 is p83151-ΔRMI.

[0039] The p83151-ΔRMI plasmid is obtained by inserting a gRNA expression cassette containing a repair homologous arm and a gene that targets and knocks out the restriction endonuclease rease gene into the multiple cloning site of the pMTL83151 plasmid backbone, thus obtaining the plasmid p83151-ΔRMI.

[0040] The target site for the sgRNA design targeting the knockout of the restriction endonuclease rease gene is:

[0041] rease: 5'-AGAAGATATGGATGATGCGGTTGAACCAAGTTTC-3'.

[0042] The preferred Clostridium tyrobutyricum chassis strain is Clostridium tyrobutyricum ATCC 25755.

[0043] The edit plasmid for targeted knockout of ldh2 mentioned in step S1 is p83-ermBΔcatPΔldh2.

[0044] The p83-ermBΔcatPΔldh2 is obtained through the following steps: the chloramphenicol resistance gene is removed from the pMTL83151 plasmid backbone to obtain the vector pMTL83151-C, and then the erythromycin resistance gene is cloned into it to obtain the vector pMTL83151-ermB. Next, a gRNA expression cassette driven by promoter Pcat1 to target and knock out the chloramphenicol resistance gene catP is inserted into the multiple cloning site of the vector pMTL83151-ermB to obtain the CRISPR-P vector pMTL83151-ermB-Pcat1-ΔcatP. Finally, a gRNA expression cassette that can be driven by lactose-inducible promoter to target and knock out genomic ldh2 and contains repair homologous arms is inserted upstream of the promoter Pcat1 of the CRISPR-P vector to obtain the plasmid p83-ermBΔcatPΔldh2.

[0045] The target site for the sgRNA design targeting the knockout of the chloramphenicol resistance gene catP is:

[0046] catP:5'-TATATCCCCAATTCACCATCTTGATTGATTGCCGTCCT-3'.

[0047] The target of the sgRNA designed to knock out ldh2 in the genome is:

[0048] ldh2:5'-CAGCTATATAATAGGAGAACATGGAGATTCTGAA-3'.

[0049] The inducer mentioned in step S1 is preferably lactose; more preferably 40 mM lactose.

[0050] The editing plasmid for targeted knockout of ldh3 mentioned in step S2 is p82-KARΔermBΔldh3.

[0051] The p82-KARΔermBΔldh3 was obtained through the following steps: An ampicillin-kanamycin tandem resistance gene was cloned into the vector pMTL83151-C to obtain the vector pMTL83151-KAR. Then, a gRNA expression cassette driven by promoter Pcat1 to target and knock out the erythromycin resistance gene ermB was inserted into the multiple cloning site of this vector to obtain the CRISPR-S vector pMTL83151-KAR-Pcat1-ΔermB. Finally, a gRNA expression cassette containing a repair homologous arm that can be driven by a lactose-inducible promoter to target and knock out genomic ldh3 was inserted upstream of the promoter Pcat1 of the CRISPR-S vector to obtain the plasmid p82-KARΔermBΔldh3.

[0052] The target site for the sgRNA designed to knock out the erythromycin resistance gene ermB is:

[0053] ermB:5'-ACTTCTGCCATTAAAAATAATGCCAATGAGCGTTTTGT-3'.

[0054] The target of the sgRNA design for knocking out ldh3 in the genome is:

[0055] ldh3:5'-AATCCACTTAAAATGCTTTATTACAGTTTTTCCAATTCT-3'.

[0056] The edit plasmid for targeted knockout of ldh1 mentioned in step S3 is p83-catPΔKanRΔldh1.

[0057] The p83-catPΔKanRΔldh1 is obtained through the following steps: a gRNA expression cassette driven by Pcat1 to target and knock out the kanamycin resistance gene KanR is inserted into the multiple cloning site of the pMTL83151 plasmid to obtain the CRISPR-R vector pMTL83151-catP-Pcat1-ΔKanR. Then, a gRNA expression cassette containing a repair homologous arm that can be driven by a lactose-inducible promoter to target and knock out ldh1 in the genome is inserted upstream of the promoter Pcat1 of the CRISPR-R vector to obtain the plasmid p83-catPΔKanRΔldh1.

[0058] The target of the sgRNA design for knocking out the kanamycin resistance gene KanR is:

[0059] 5'-GGCTCTTCACTCCATCGACATATCGGATTGTCCTAT-3'.

[0060] The target of the sgRNA design for knocking out ldh1 in the genome is:

[0061] ldh1:5'-TAGCAAATAGATACAATCTTGACCCTAAGGATGT-3'.

[0062] The edit plasmid for targeting and knocking out hprK and inserting adhE2 in step S3 is pMTL83151-ermBΔcatPΔhprK::adhE2.

[0063] The pMTL83151-ermBΔcatPΔhprK::adhE2 is obtained through the following steps: a gRNA expression cassette containing a repair homologous arm and the Pctthl-adhE2 to be knocked into is inserted into the CRISPR-P vector pMTL83151-ermB-Pcat1-ΔcatP. This cassette is capable of targeted knockout of the genomic hprK by a lactose-inducible promoter.

[0064] The target of the sgRNA design for targeted knockout of genomic hprK is:

[0065] hprK:5'-TGGAGTATTGGTAGACGTATATGGTGTTGGGATG-3'.

[0066] The edit plasmid for targeting and knocking out xylR and inserting adhE2 in step S3 is pMTL83151-KARΔermBΔxylR::adhE2.

[0067] The pMTL83151-KARΔermBΔxylR::adhE2 is obtained through the following steps: a gRNA expression cassette containing a repair homologous arm and the Pctthl-adhE2 to be knocked into is inserted into the CRISPR-S vector pMTL83151-KAR-Pcat1-ΔermB. This cassette is capable of targeted knockout of the genomic xylR driven by a lactose-inducible promoter.

[0068] The target of the design for targeted knockout of xylR in the genome is:

[0069] xylR:5'-GCTTATGCAGAAGCTTTTCTTAATTTCAATGATA-3'.

[0070] The edit plasmid that targets and knocks out cat1 and inserts adhE2 in step S3 is pMTL83151-catPΔKanRΔcat1::adhE2.

[0071] The pMTL83151-catPΔKanRΔcat1::adhE2 is obtained through the following steps: a gRNA expression cassette containing a repair homologous arm and the Pctthl-adhE2 to be knocked into the CRISPR-R vector pMTL83151-catP-Pcat1-ΔKanR is inserted into the vector. This gRNA expression cassette is capable of targeted knockout of the genomic cat1 by a lactose-inducible promoter.

[0072] The target of the design for the targeted knockout of the genomic cat1 is:

[0073] cat1:5'-CTTGTAGAAGATGGATCAACCCTACAACTTGGTA-3'.

[0074] The overexpression plasmid mentioned in step S3 is preferably pMTL82151-ermB-Pfla-vaat-Pcat1-groESL12.

[0075] The pMTL82151-ermB-Pfla-vaat-Pcat1-groESL12 is obtained through the following steps: the chloramphenicol resistance gene is removed from the backbone of the pMTL82151-Pfla-VAAT plasmid and the erythromycin resistance gene is cloned to obtain the plasmid pMTL82151-ermB-Pfla-vaat. Then, the Pcat1-groESL expression cassette is inserted downstream of the vaat gene in this vector.

[0076] The above-mentioned Clostridium butyricum, which utilizes glucose and xylose to produce butyl butyrate, is used in the production of butyl butyrate.

[0077] A method for producing butyl butyrate by fermentation using lignocellulose hydrolysate as a carbon source includes the following steps:

[0078] 1) The Clostridium butyricum strain that co-utilizes glucose and xylose to produce butyl butyrate was inoculated into a fermentation medium containing lignocellulose hydrolysate for anaerobic fermentation, and the pH of the fermentation broth was maintained at 5.8-6.2.

[0079] 2) Regularly sample and monitor residual sugar. When the residual sugar concentration is below 15 g / L, add lignocellulose hydrolysate equivalent to 1 / 2 to 1 volume of the fermentation broth described in step 1).

[0080] 3) During fermentation for 12-24 hours, add hexadecane equivalent to 1 / 3 to 2 / 3 of the volume of the fermentation broth described in step 1) as the extractant for the ester extraction;

[0081] 4) After fermentation, an organic phase containing butyl butyrate is obtained.

[0082] The amount of inoculation described in step 1) is preferably 5% by volume.

[0083] The lignocellulose hydrolysate mentioned in step 1) is preferably at least one of corn cob hydrolysate, sugarcane bagasse hydrolysate, soybean hull hydrolysate, and soybean straw hydrolysate; more preferably, it is corn cob hydrolysate.

[0084] The preferred lignocellulose hydrolysate is a lignocellulose hydrolysate with a total sugar concentration of 65-70 g / L; it is preferably prepared by the following steps: first, treat the lignocellulose powder with an acid solution, then adjust the pH of the treatment system to a pH suitable for cellulase hydrolysis, add cellulase for enzymatic hydrolysis; after enzymatic hydrolysis, separate the solid and liquid, further concentrate, and then separate the solid and liquid again, and the resulting supernatant is the lignocellulose hydrolysate.

[0085] The acid solution is preferably an H2SO4 solution; more preferably an H2SO4 solution with a concentration of 0.02M.

[0086] The preferred treatment conditions are 121°C for 20–40 min; more preferably, 121°C for 30 min.

[0087] The pH-adjusting reagent is preferably a NaOH solution; more preferably a 0.02M NaOH solution.

[0088] The cellulase is preferably a cellulase. CTec2.

[0089] The preferred conditions for enzymatic hydrolysis are 45–55°C and 120–180 rpm for 60–80 h; more preferably, 50°C and 150 rpm for 72 h.

[0090] The preferred method for solid-liquid separation is centrifugation.

[0091] The centrifugation conditions are preferably 5000-6000 rpm for 5-15 min; more preferably 5000 rpm for 10 min.

[0092] The preferred degree of concentration is to concentrate to a total sugar concentration of 65-70 g / L.

[0093] The fermentation medium described in step 1) is a nitrogen-containing CGM medium, and its preferred composition, except for the lignocellulose hydrolysate, is as follows: 2 g / L yeast extract, 1 g / L K2HPO4·3H2O, 0.5 g / L KH2PO4, 2 g / L (NH4)2SO4, 1 mL / L trace element A and 1 mL / L trace element B; wherein:

[0094] The composition of trace element A is as follows: 20 g / L CoCl2·6H2O, 15 g / L CaCl2·2H2O;

[0095] The composition of trace element B is as follows: 15 g / L FeSO4·7H2O, 15 g / L ZnSO4·7H2O, 10 g / L MnSO4·H2O, 100 g / L MgSO4·7H2O.

[0096] The anaerobic fermentation conditions described in step 1) are preferably a temperature of 36-38°C and a rotation speed of 120-180 rpm; more preferably a temperature of 37°C and a rotation speed of 150 rpm.

[0097] The pH value mentioned in step 1) is preferably 6.0.

[0098] The amount of hexadecane added in step 3) is preferably equivalent to 1 / 2 volume of the fermentation broth in step 1).

[0099] The fermentation time in step 4) is preferably 120-144 hours; more preferably 132 hours.

[0100] The present invention has the following advantages and effects compared with the prior art:

[0101] The engineered strain GVB3NG constructed in this invention achieves high-efficiency utilization of glucose and xylose in lignocellulose hydrolysate and high production of butyl butyrate through a comprehensive strategy of blocking the lactic acid pathway, relieving the carbon metabolism inhibition of xylose by glucose, enhancing the butanol synthesis pathway, blocking the byproduct butyrate synthesis pathway, and improving the fermentation performance of the strain in lignocellulose hydrolysate.

[0102] In a 5L fermenter, fed-batch fermentation was carried out using corn cob hydrolysate as the carbon source. The GVB3NG strain consumed a total of 109.00 g of glucose and 61.39 g of xylose, achieving a yield, efficiency, and selectivity of butyl butyrate of 26.62 g / L, 0.09 mol / mol, and 95.86%, respectively. This yield represents the highest reported level of de novo butyl butyrate synthesis from lignocellulose hydrolysate by microorganisms to date, significantly reducing production costs and demonstrating enormous potential for industrial application. Attached Figure Description

[0103] Figure 1 This is a design strategy diagram for constructing GB3 through multiple rounds of gene editing in this invention; where AD are schematic diagrams of strategies for knocking out rease, ldh2, ldh3 and ldh1 gene sites, respectively; EG are schematic diagrams of strategies for integrating adhE2 expression cassettes at hprK site, xylR site and cat1 site, respectively.

[0104] Figure 2 This is a flowchart illustrating the process of obtaining GVB3NG through multiple rounds of gene editing in this invention. A shows a schematic diagram of obtaining GB3 using the RPS iterative editing strategy; B shows the molecular verification results of the engineered GB3 genotype; C shows the changes in metabolic flux after the introduction of alcohol and ester synthesis pathways in Clostridium butyricum; D shows the GB3 conjugating plasmid pMTL82151-ermB-Pfla-vaat-Pcat1-groESL12; and E shows the molecular verification results.

[0105] Figure 3 This is a graph showing the comparison of butyl butyrate yields of GVB3 and GVB3NG in different lignocellulose hydrolysates in this invention; where CCH represents corn cob hydrolysate, SCB represents bagasse hydrolysate, SBH represents soybean hull hydrolysate, and SBS represents soybean straw hydrolysate.

[0106] Figure 4 This is a diagram showing the results of batch-fed fermentation of the genetically engineered bacteria GVB3NG in a 5L fermenter using corn cob hydrolysate as the carbon source. In this diagram, A is the aqueous phase product of the engineered bacteria GVB3NG using corn cob hydrolysate as the carbon source; and B is the organic phase product of the engineered bacteria GVB3NG using corn cob hydrolysate as the carbon source. Detailed Implementation

[0107] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the materials, reagents, instruments and methods used in the following embodiments are all conventional materials, reagents, instruments and methods in the art, and can be obtained through commercial channels; the experimental methods described are all conventional methods unless otherwise specified.

[0108] This embodiment uses a genome iterative editing system to construct genetically engineered bacteria, which involves the following screening resistance plates:

[0109] Cloning host and donor bacteria E. coli CA434: LB medium containing chloramphenicol at a final concentration of 25 μg / mL is abbreviated as LBC medium, LB medium containing erythromycin at a final concentration of 500 μg / mL is abbreviated as LBE medium, and LB medium containing ampicillin at a final concentration of 100 μg / mL is abbreviated as LBA medium.

[0110] Clostridium butyricum transformants were selected using: RTD medium (RCM enhanced with 25 μg / mL thiamphenicol and 250 μg / mL D-cyclic serine, used to screen for Clostridium butyricum transformants containing chloramphenicol resistance tag plasmids), RED medium (RCM enhanced with 40 μg / mL erythromycin and 250 μg / mL D-cyclic serine, used to screen for Clostridium butyricum transformants containing erythromycin resistance tag plasmids), and RKD medium (RCM enhanced with 50 μg / mL kanamycin and 250 μg / mL D-cyclic serine, used to screen for Clostridium butyricum transformants containing working plasmids with kanamycin and ampicillin tandem resistance tags). YRTD, YRED, and YRKD media were prepared by adding 40 mM of α-lactose monohydrate to RTD, RED, and RKD media, respectively, to induce the expression of the lactose-inducible promoter PbgaL, thereby driving gRNA transcription for genome editing.

[0111] The RPS iterative genome editing system used in this embodiment involves the following genome editing operations: Δrease, Δldh2, Δldh3, Δldh1, ΔhprK::adhE2, ΔxylR::adhE2, and Δcat1::adhE2. A cloning host constructed using E. coli CA434 as the working plasmid and a conjugation transfer donor bacterium were used to perform the above gene editing operations.

[0112] The target design involved in the genetically engineered bacteria is as follows:

[0113] rease:5'-AGAAGATATGGATGATGCGGTTGAACCAAGTTTC-3';

[0114] ldh2:5'-CAGCTATATAATAGGAGAACATGGAGATTCTGAA-3';

[0115] catP:5'-TATATCCCCAATTCACCATCTTGATTGATTGCCGTCCT-3';

[0116] ldh3:5'-AATCCACTTAAATGCTTTATTACAGTTTTTCCAATTCT-3';

[0117] ermB:5'-ACTTCTGCCATTAAAAATAATGCCAATGAGCGTTTTGT-3';

[0118] ldh1:5'-TAGCAAATAGATACAATCTTGACCCTAAGGATGT-3';

[0119] KanR:5'-GGCTCTTCACTCCATCGACATATCGGATTGTCCTAT-3';

[0120] hprK:5'-TGGAGTATTGGTAGACGTATATGGTGTTGGGATG-3';

[0121] xylR:5'-GCTTATGCAGAAGCTTTTCTTAATTTCAATGATA-3';

[0122] cat1:5'-CTTGTAGAAGATGGATCAACCCTACAACTTGGTA-3'.

[0123] The primers used in this invention are as follows:

[0124] p83-Pbgal-F:5’-AGGAAACAGCTATGACCGCGGTTATATACTTGGTTTATTTACTTGATTATT-3’;

[0125] spacer-rease-R:5’-GGTTCAACCGCATCATCCATATCTTCTATTTAAATACATCTCATGTTAAGGTT-3’;

[0126] rease-Ter-F:5’-GATGCGGTTGAACCAAGTTTCGTTGAACCTTAACATGAGATGTATTTAAATATAAAAAAATTGTAGATA AATTTTATAAAATAG-3’;

[0127] rease-Ter-R:5’-CTACCAAATCATCTGTTAAATCTGGAGCTCATAAAAAAATTGTAGATAAAACTATTTTATAAAATTTATCT-3’;RMI-H1-F:5’-GAGCTCCAGATTTAACAGATGATTTGGTAGGT-3’;

[0128] RMI-H1-R:5’-ATTATGTGGGTACCAATTGCTCTTCATTCATTTCTCACTTG-3’;

[0129] RMI-H2-F:5’-GAGCAATTGGTACCCACATAATGAAGAGATACAATCTTTG-3’;

[0130] RMI-H2-R:5’-TCTCCATGGACGCGTGACGTCTACAGCTAATAGTCGAACAACTGGC-3’;

[0131] p83-F:5’-AGGAAACAGCTATGACCGCGG-3’

[0132] p83-R:5’-GACGTCACGCGTCCATGGAGAT-3’

[0133] erm-scar-F:5’-CTTGAATTTGAGAGGGAACTTAGATGAACGAGAAAAATATAAAACACAGTC-3’;

[0134] erm-scar-R:5’-AGTTACAGACAAACCTGAAGTTACTTATTAAATAATTTATAGCTATTGAAAAGAG-3’;

[0135] chuCatp-F:5’-CTTCAGGTTTGTCTGTAACT-3’;

[0136] chuCatp-R:5’-CTAAGTTCCCTCTCAAATTCAAG-3’;

[0137] Pcat1-F:5’-AGAGCCCAAATCTTTGAAAATAATG-3’;

[0138] Pcat1-spacer(catP)-R:5’-CGGCAATCAATCAAGATGGTGAATTGGGGATATAATTTAAATACATCTCATGTTAAGGTTCAACAAA AACCACCCTTTCATAAATT-3’;

[0139] TCapfdx-spacer(catP)-F:5’-ACCATCTTGATTGATTGCCGTCCTGTTGAACCTTAACATGAGATGTATTTAAATATAAAAATAAG AAGCCTGCATTTGCAGGCTTCT-3’;

[0140] TCapfdx-R:5’-GCTTATATCCTTCGAGCTCATAAAAATAAGAAGCCTGCAAATGCAGGC3-’;

[0141] p83-backbone-F:5’-TGAGCTCGAAGGATATAAGCATCTCGAGGCCTGCAGACATG-3’;

[0142] p83-backbone-R:5’-ATTTTCAAAGATTTGGGCTCTCCGCGGTCATAGCTGTTTCCT-3’;

[0143] Pbgal-ldh2-R:5’-TCCATGTTCTCCTATTATATAGCTGATTTAAATACATCTCATGTTAAGGTTC-3’;

[0144] ldh2-Ter-F:5'-ATATAATAGGAGAACATGGAGATTCTGAAGTTGAACCTTAACATGAGATG-3';

[0145] Ter-H1-ldh2-R:5'-AGCTTACTTAGGTGGAGCTCATAAAAAAATTGTAGATAAAAC-3';

[0146] ldh2-H1-F:5'-TGAGCTCCACCTAAGTAAGCTGCAACTC-3':

[0147] ldh2-H1-R:5'-AGGAAGGTACCAAAGTAATTACCTCCATTATAAATTTCAG-3';

[0148] ldh2-H2-F:5'-AATTACTTTGGTACCTTCCTGCAGTAATAGGATCTG-3':

[0149] ldh2-p83-R2:5'-AAGATTTGGGCTCTCTCGAGAACATTCAATGAAAGGTGGTTTG-3':

[0150] p83-RPS-F:5'-CTCGAGAGAGCCCAAATCTTTGAAAATA-3':

[0151] p83-RPS-R:5'-CCGCGGTCATAGCTGTTTCCT-3';

[0152] can-P8-F:5'-GAATTTGAGAGGGAACTTAGATGGCTAAAATGAGAATATCAC-3';

[0153] KanR-5unRBSUTR-R:5'-TCCGCTCACAATTCCACGTCGACTACCGCGGATTCTAGACTAAAACAATTCATCCAGTA-3';Amp-5unRBSUTR-F:5'-GACGTGGAATTGTGAGCGGATAACAATTTCAGGAGGGCTGAATGAATCAATTCAGTATCAGTA-3';

[0154] Amp-R:5'-AGTTACAGACAAACCTGAAGTTACCAATGCTTAATCAGTG-3';

[0155] Pcat1-spacer(erm)-R:5'-GCTCATTGGCATTATTTTTAATGGCAGAAGTATTTAAATACATCTCATGTTAAGGTTCAACAAAAACCACCCTTTCATAAATTATA-3';

[0156] TCapfdx-spacer(ermB)-F: 5'-TAAAAATAATGCCAATGAGCGTTTTGTGTTGAACCTTAACATGAGATGTATTTAAATAAAAAATAAGAAGCCTGCATTTGCAGGCT-3';

[0157] Pbgal-ldh3-R:5'-TGGAAAAACTGTAATAAAGCATTTAAGTGGATTATTTAAATACATCTCATGTTAAGGTTC-3';ldh3-Ter-F:5'-TGCTTTATTACAGTTTTTCCAATTCTGTTGAACCTTAACATGAGATGTATTT-3';

[0158] ldh3-Ter-R:5'-TCCTCGTTCAACTAGAGCTCATAAAAAAAATTGTAGATAAAACTATTT-3';

[0159] ldh3-H1-F:5'-ATGAGCTCTAGTTGAACGAGGAAATCATGAAG-3';

[0160] ldh3-H1-R:5'-CTTTAATGGTACCTGTTAATAAACTCCCCCTTATGTTTTC-3';

[0161] ldh3-H2-F:5'-TATTAACAGGTACCATTAAAGTATTTATCGATAAAAGGAT-3';

[0162] ldh3-p83-R2:5'-AAGATTTGGGCTCTCTCGAGCCTGAAGATGCAGCTATTCTTC-3'

[0163] Pcat1-spacer(KanR)-R:5'-ACAATCCGATATGTCGATGGAGTGAAAGAGCCATTTAAATACATCTCATGTTAAGGTTCAACAAAAACCACCCTTTCATAAATTATA-3'

[0164] TCapfdx-spacer(KanR)-F:5’-CCATCGACATATCGGATTGTCCCTATGTTGAACCTTAACATGAGATGTATTTAAATATAAAAATAAGAAGCCTGCATTTGCAGGCT-3’;

[0165] Pbgal-ldh1-R:5’-CTTAGGGTCAAGATTGTATCTATTTGCTAATTTAAATACATCTCATGTTAAGGT-3’;

[0166] ldh1-Ter-F:5’-AGATACAATCTTGACCCTAAGGATGTGTTGAACCTTAACATGAGATGTAT-3’;

[0167] ldh1-Ter-R:5’-TTTTGGCTGGAGCTCATAAAAAAATTGTAGATAAAACTATTTTAT-3’;

[0168] ldh1-H1-F:5’-TTTATGAGCTCCAGCCAAAAGAAGTATTGACTACA-3’;

[0169] ldh1-H1-R:5’-ATTGTAGCCGGTACCAGTACCTACATTTCCCACTCCAACT-3’;

[0170] ldh1-H2-F:5’-GGTACTGGTACCGGCTACAATGAAAGCTGCAGGAT-3’;

[0171] ldh1-p83-R2:5’-AAGATTTGGGCTCTCTCGAGTTATTAAGTATCTTCTTTATATCGC-3’;

[0172] spacer-hprK-R:5’-CCAACACCATATACGTCTACCAATACTCCAATTTAAATACATCTCATGTTAAGGT-3’;

[0173] hprK-Ter-F:5’-GTAGACGTATATGGTGTTGGGATGGTTGAACCTTAACATGAGATGT-3’;

[0174] hprK-Ter-R:5'-TTGCAAGACGTCATAAAAAAATTGTAGATAAAACTATTTTA-3':

[0175] hprK-H1-F:5'-TTTTTTATGACGTCTTGCAATGAGGAAATTATGTAAATAATG-3';

[0176] hprK-H1-R:5'-TATTCATCATTTTTTCGCCCCCTAGTCCAAAG-3':

[0177] hprK-H2-F:5'-GGGCGAAAAAATGATGAATAAGAAAGATTAGAAAAG-3';

[0178] hprk-H2-R:5'-AAGATTTGGGCTCTCTCGAGGCAGGCTTATCTTTTAAAACATAAC-3';

[0179] Pctthl-F:5'-GGTACCATATTCAGCGAAAATAGTATATTATAAT-3';

[0180] adhE2-R:5'-ACCATTGAGTCCATATAATCGCG-3';

[0181] hprk-fankuo-F:5'-GATTATATGGACTCAATGGTATGATGAATAAGAAAGATTAGAAAAG-3';

[0182] hprk-fankuo-R:5'-TTTTCGCTGAATATGGTACCTTTCGCCCCCTAGTCCAAAGCTG-3':

[0183] spacer-xylR-R:5'-GAAATTAAGAAAAGCTTCTGCATAAGCATTTAAATACATCTCATGTTAAGGTTC-3';

[0184] xylR-Ter-F:5'-CAGAAGCTTTTCTTAATTTCAATGATAGTTGAACCTTAACATGAGATGTAT-3':

[0185] xylR-Ter-R:5'-CTTCCCAAGAATCGCGAATAAAAAAAATTGTAGATAAAACTATTTTAT-3';

[0186] xylR-H1-F:5'-TATTCGCGATTCTTGGGAAGTATTATATTACCAG-3';

[0187] xylR-H1-R:5'-ATCTCTACTTATTTAGTATCACCATCTATCCATTTCAG-3';

[0188] xylR-H2-F:5'-TGATACTAAATAAGTAGAGATATTTATGTCTTAAAG-3';

[0189] xylR-H2-R:5'-AAAGATTTGGGCTCTCTCGAGCATCATATAAAAAATTTAATATTCAATT-3';

[0190] xylR-fankuo-F:5'-GATTATATGGACTCAATGGTTAAGTAGAGATATTTTATGTCTTAAAGG-3';

[0191] xylR-fankuo-R:5'-TTTTCGCTGAATATGGTACCTTTAGTATCACCATCTATCCATTTCAG-3';

[0192] cat1-H1-R:5'-GAAAGGGTGGTTTTTGGTACCATATTCAGCGAAAAT-3';

[0193] cat1-H2-F:5'-GATTATATGGACTCAATGGTTGGTATTGCACAACTTAGAGGT-3';

[0194] cat1-H2-R:5'-CAAAGATTTGGGCTCTCTCGAGCCTATACTTCTATGATAGGTTTCAGGAAA-3';

[0195] Pcat1-groESL12-F:5'-CTCTTTAGCTCCTTGGAGCTCGTAGACTTTAAGGATGGAACCTTTGA-3';

[0196] Pcat1-groESL12-R:5'-GTCACCAAGTGGTTTCAGCATAAACCACCCTTTCATAAATTATATAAA-3';

[0197] groESL12-F:5'-ATGCTGAAACCACTTGGTGACC-3';

[0198] groL-R:5'-CGCGTGACGTCGACTTAGAAGTCCATGCCGCCCATG-3';

[0199] VAATgujia-groL-F:5'-ACTTCTAAGTCGACGTCACGCGTCCATG-3';

[0200] VAAT-larger-R:5'-TGCGCCAGGAGAGTTGTTGATTTAATATCTACTAATTAAAGTTTTAGGAGAT-3';

[0201] RMI-F:5'-AGTTAATTTTAGAAAGGCACAATATTTTAT-3'

[0202] RMI-R:5'-TTTTCGGAAAATAAATCTTATACTTCG-3'

[0203] ldh2-H2-1000F:5'-TGCTTGGAGTTTTAATTATTAATA-3';

[0204] ldh2-H1-1000R:5'-TCAATATTATCCCATGGATTAGG-3';

[0205] YQ-ldh3-F:5'-TAGCACACAGACTATCTACTA-3';

[0206] YQ-ldh3-R:5'-TGCGTTGTAATTTGAAGTTC-3';

[0207] YQ-ldh1-F:5'-TATGCCTCTCTATAGAAGCT-3';

[0208] YQ-ldh1-R:5'-ACAGCTGTCTTATTGAGACC-3';

[0209] Test-hprk-1000F:5'-TCTATCTTGTCTGCACTGGC-3';

[0210] Test-hprk-1000R:5'-AGTTATAGGAAGAAATTATAAGCAGTG-3';

[0211] Test-xylR-1000F:5'-TTCTGCATATTATTTTCCACCT-3';

[0212] Test-xylR-1000R:5'-AGCGTGGATCTATGTCTAGT-3';

[0213] Test-qiaoCAT1-F:5'-GGATCATTTATATTCCTTGGACCTAC-3';

[0214] Test-qiaoCAT1-R:5'-CTAAAAGTAGCCGGTCTTAAAGAAG-3'.

[0215] The following materials used in this invention have been disclosed in the literature:

[0216] The plasmids pCloneEZ-Plac-repeat, pCloneEZ-repeat-terminator, pMTL82151, and pMTL83153-Δrease::Pctthl-adhE2 have been disclosed in the literature “Guo XL, et al. De novo biosynthesis of butyl butyrate in engineered Clostridium tyrobutyricum. Metab. Eng. 2023: 77:64-75.”

[0217] The plasmid pYL001-adhE2 has been published in the literature “Bao T et al. Engineering Clostridium cellulovorans for highly selective n-butanol production from cellulose inconsolidated bioprocessing. Biotechnol Bioeng. 2021, 118: 2703-2718.”

[0218] The plasmids pMTL83153Δcat1 and pMTL82151-Pfla-VAAT have been disclosed in the literature "Guo XL, et al. Efficient production of butyl butyrate from mannitol by engineered Clostridium tyrobutyricum. Chem. Eng. J. 2024, 487: 150577."

[0219] The plasmids pMTL-Em and pMTL83151 have been published in the literature “Fu HX, et al. Elimination of carbon catabolite repression in Clostridium tyrobutyricum for enhanced butyric acid production from lignocellulosic hydrolysates, Bioresour. Technol. 2022, 357:127320.”

[0220] Example 1: Construction of plasmid p83151-ΔRMI involved in the initial strain WTΔRMI

[0221] First, using pCloneEZ-Plac-repeat and pCloneEZ-repeat-terminator as templates, the fragments PbgaL-repeat(rease) and (rease)repeat-terminator were amplified, respectively. The 3' end of PbgaL-repeat(rease) and the 5' end of (rease)repeat-terminator contain spacer-type primers targeting the rease gene. The upstream and downstream primers for amplifying PbgaL-repeat(rease) were p83-Pbgal-F and spacer-rease-R, respectively; the upstream and downstream primers for amplifying (rease)repeat-terminator were rease-Ter-F and rease-Ter-R, respectively. These fragments were then fused using overlap PCR to obtain the PbgaL-ΔRMI fragment. Using the C. tyrobutyricum ATCC 25755 genome as a template, the upstream homologous arm H1 and downstream homologous arm H2 of the rease were amplified. H1 and H2 were fused using overlap PCR to obtain the H1H2 (rease) fragment. The primers used for amplifying the upstream homologous arm H1 were RMI-H1-F and RMI-H1-R, respectively; the primers used for amplifying the downstream homologous arm H2 were RMI-H2-F and RMI-H2-R, respectively. Using the Gibson method, the PbgaL-ΔRMI and H1H2 (rease) fragments were ligated into the linearized pMTL83151 plasmid. The ligation product was then transformed into E. coli CA434, and after screening, the plasmid was extracted to obtain the editing plasmid p83151-ΔRMI. The primers used for linearizing the pMTL83151 plasmid were p83-F and p83-R.

[0222] Example 2: Construction of CRISPR-P parent plasmid and ldh2 gene knockout plasmid

[0223] (1) Replacement of resistance genes

[0224] First, using plasmid pMTL-Em as a template, the erythromycin resistance gene fragment ermB was amplified by PCR using primers erm-scar-F and erm-scar-R. Second, using plasmid pMTL83151 as a template, the linearized vector fragment pMTL83151-C, which had the catP resistance gene removed, was amplified by reverse PCR using primers chuCatp-F and chuCatp-R. Finally, the amplified ermB gene fragment was ligated to the linearized vector pMTL83151-C using the Gibson assembly method. The ligation product was then transformed into E. coli CA434, and after screening, the plasmid was extracted to obtain plasmid pMTL83151-ermB. All E. coli CA434 cells containing the erythromycin resistance plasmid were screened using LBE medium.

[0225] (2) Construction of CRISPR-P parent plasmid

[0226] Using genomic DNA from *C. tyrobutyricum* ATCC 25755 as a template, the promoter *Pcat1*, with a repeat-spacer(catP) sequence fused to its 3' end, was obtained by PCR amplification using primers *Pcat1-F* and *Pcat1-spacer(catP)*-R. Using plasmid *pYL001-adhE2* as a template, the terminator *TCapfdx*, with a spacer(catP)-repeat sequence fused to its 5' end, was obtained by PCR amplification using primers *TCapfdx-spacer(catP)*-F and *TCapfdx*-R. The promoter Pcat1 (containing repeat-spacer(catP)) and terminator TCapfdx (containing spacer(catP)-repeat) fragments obtained from the above amplification were ligated using the overlap PCR method to obtain the complete catP resistance gene plasmid gRNA expression cassette Pcat1-repeat-spacer(catP)-repeat-TCapfdx (abbreviated as Pcat1-ΔcatP). The obtained Pcat1-ΔcatP fragment was ligated to linearized pMTL83151-ermB using the Gibson assembly method. Finally, the ligation product was transformed into E. coli CA434, and after screening, the plasmid was extracted to obtain the CRISPR-P parent plasmid pMTL83151-ermB-Pcat1-ΔcatP. The upstream and downstream primers for linearized pMTL83151-ermB were p83-backbone-F and p83-backbone-R, respectively.

[0227] (3) Construction of ldh2 knockout plasmid

[0228] First, the PbgaL-repeat and repeat-terminator fragments were amplified using pCloneEZ-Plac-repeat and pCloneEZ-repeat-terminator plasmids, respectively. The 3' end of PbgaL-repeat and the 5' end of repeat-terminator contain spacer sequences targeting ldh2 knockout. The upstream and downstream primers for amplifying PbgaL-repeat were p83-Pbgal-F and Pbgal-ldh2-R, respectively; the upstream and downstream primers for amplifying repeat-terminator were ldh2-Ter-F and Ter-H1-ldh2-R, respectively. Subsequently, these fragments were ligated into a single fragment using overlap PCR to obtain the PbgaL-Δldh2 fragment. Using the C. tyrobutyricum ATCC 25755 genome as a template, the upstream homologous arm H1 and downstream homologous arm H2 of ldh2 were amplified. H1 and H2 were ligated into a single fragment using overlap PCR to obtain the H1H2(ldh2) fragment. The primers used for amplifying the upstream homologous arm H1 were ldh2-H1-F and ldh2-H1-R, respectively; the primers used for amplifying the downstream homologous arm H2 were ldh2-H2-F and ldh2-p83-R2, respectively. Using the Gibson method, the PbgaL-Δldh2 and H1H2(ldh2) fragments were ligated into the linearized vector pMTL83151-ermB-Pcat1-ΔcatP. Finally, the ligation product was transformed into E. coli CA434, and after screening, the plasmid was extracted to obtain the p83-ermBΔcatPΔldh2 plasmid. The upstream and downstream primers for linearizing pMTL83151-ermB-Pcat1-ΔcatP are p83-RPS-F and p83-RPS-R, respectively.

[0229] Example 3: Construction of CRISPR-S parent plasmid and ldh3 gene knockout plasmid

[0230] (1) Replacement of resistance genes

[0231] First, using plasmid pET-28a as a template, the kanamycin resistance gene KanR was amplified by PCR using primers kan-P8-F and KanR-5unRBSUTR-R, with a portion of the S5'UTR sequence fused to its 3' end. Next, using plasmid pCloneEZ-Plac-repeat as a template, the ampicillin resistance gene AmpR was amplified by PCR using primers Amp-5unRBSUTR-F and Amp-R, with a portion of the S5'UTR sequence also fused to its 5' end. Subsequently, the two fragments were fused using overlap PCR to obtain the KanR-S5'UTR-AmpR fragment. The KanR-S5'UTR-AmpR fragment was ligated to the linearized vector pMTL83151-C obtained in Example 2 using the Gibson assembly method. Finally, the ligation product was transformed into E. coli CA434, and after screening, the plasmid was extracted to obtain the pMTL83151-KAR plasmid. All E. coli CA434 containing the KAR plasmid were screened using LBA culture medium.

[0232] (2) Construction of CRISPR-S parent plasmid

[0233] Using genomic DNA from *C. tyrobutyricum* ATCC 25755 as a template, the promoter Pcat1 was obtained by PCR amplification using primers Pcat1-F and Pcat1-spacer(erm)-R, with the repeat-spacer(ermB) sequence fused to its 3' end. Using plasmid pYL001-adhE2 as a template, the terminator TCapfdx was obtained by PCR amplification using primers TCapfdx-spacer(ermB)-F and TCapfdx-R, with the spacer(ermB)-repeat sequence fused to its 5' end. The Pcat1 and TCapfdx fragments obtained by the above amplification were fused using overlap PCR to obtain the Pcat1-repeat-spacer(ermB)-repeat-TCapfdx fragment. The Pcat1-repeat-spacer(ermB)-repeat-TCapfdx fragment was ligated into the linearized pMTL83151-KAR vector using the Gibson assembly method. The ligation product was then transformed into E. coli CA434, and after screening, the plasmid was extracted to obtain the CRISPR-S parent plasmid pMTL83151-KAR-Pcat1-ΔermB. The upstream and downstream primers for the linearized pMTL83151-KAR were p83-backbone-F and p83-backbone-R, respectively.

[0234] (3) Construction of ldh3 knockout plasmid

[0235] First, using pCloneEZ-Plac-repeat and pCloneEZ-repeat-terminator as templates, the fragments PbgaL-repeat(ldh3) and repeat(ldh3)-terminator were amplified, respectively. The 3' end of PbgaL-repeat(ldh3) and the 5' end of (ldh3)repeat-terminator contain the ldh3 spacer series. The upstream and downstream primers for amplifying PbgaL-repeat(ldh3) were p83-Pbgal-F and Pbgal-ldh3-R, respectively; the upstream and downstream primers for amplifying (ldh3)repeat-terminator were ldh3-Ter-F and ldh3-Ter-R, respectively. These fragments were then ligated into a single fragment using overlap PCR to obtain the PbgaL-Δldh3 fragment. Using the C. tyrobutyricum ATCC 25755 genome as a template, the upstream homologous arm H1 and downstream homologous arm H2 of ldh3 were amplified. H1 and H2 were fused using overlap PCR to obtain the H1H2(ldh3) fragment. The primers used for amplifying the upstream homologous arm H1 were ldh3-H1-F and ldh3-H1-R; the primers used for amplifying the downstream homologous arm H2 were ldh3-H2-F and ldh3-p83-R2, respectively. Using the Gibson method, the PbgaL-Δldh3 and H1H2(ldh3) fragments were ligated into the linearized pMTL83151-KAR-Pcat1-ΔermB vector. Finally, the ligation product was transformed into E. coli CA434, and after screening, the plasmid was extracted to obtain the ldh3 knockout plasmid p83-KARΔermBΔldh3. The upstream and downstream primers for linearizing pMTL83151-KAR-Pcat1-ΔermB are p83-RPS-F and p83-RPS-R, respectively.

[0236] Example 4: Construction of CRISPR-R parent plasmid and ldh1 gene knockout plasmid

[0237] (1) Construction of CRISPR-R parent plasmid

[0238] Using genomic DNA from *C. tyrobutyricum* ATCC 25755 as a template, the promoter Pcat1 was obtained by PCR amplification using primers Pcat1-F and Pcat1-spacer(KanR)-R, with a repeat-spacer(KanR) sequence fused to its 3' end. Using plasmid pYL001-adhE2 as a template, the terminator TCapfdx was obtained by PCR amplification using primers TCapfdx-spacer(KanR)-F and TCapfdx-R, with a spacer(KanR)-repeat sequence fused to its 5' end. The Pcat1 and TCapfdx fragments obtained by the above amplifications were fused using overlap PCR to obtain the Pcat1-repeat-spacer(KanR)-repeat-TCapfdx fragment. The Pcat1-repeat-spacer(KanR)-repeat-TCapfdx fragment was ligated to the linearized pMTL83151 vector using the Gibson assembly method. The ligation product was then transformed into E. coli CA434, and after screening, the plasmid was extracted to obtain the CRISPR-S parent plasmid pMTL83151-catP-Pcat1-ΔKanR. The primers for the linearized pMTL83151 vector were p83-backbone-F and p83-backbone-R. All E. coli CA434 cells containing chloramphenicol resistance plasmids were screened using LBC medium.

[0239] (2) Construction of ldh1 gene knockout plasmid

[0240] First, using pCloneEZ-Plac-repeat and pCloneEZ-repeat-terminator as templates, the fragments PbgaL-repeat(ldh1) and (ldh1)repeat-terminator were amplified, respectively. The 3' end of PbgaL-repeat(ldh1) and the 5' end of (ldh1)repeat-terminator contain the ldh1 spacer sequence. The upstream and downstream primers for amplifying PbgaL-repeat(ldh1) were p83-Pbgal-F and Pbgal-ldh1-R, respectively; the upstream and downstream primers for amplifying (ldh1)repeat-terminator were ldh1-Ter-F and ldh1-Ter-R, respectively. These fragments were then fused using overlap PCR to obtain the PbgaL-Δldh1 fragment. Using the C. tyrobutyricum ATCC 25755 genome as a template, the upstream homologous arm H1 and downstream homologous arm H2 of ldh1 were amplified. H1 and H2 were ligated into a single fragment using overlap PCR to obtain the H1H2(ldh1) fragment. The primers used for amplifying the upstream homologous arm H1 were ldh1-H1-F and ldh1-H1-R, respectively; the primers used for amplifying the downstream homologous arm H2 were ldh1-H2-F and ldh1-p83-R2, respectively. Using the Gibson method, the PbgaL-Δldh1 and H1H2(ldh1) fragments were ligated into the linearized pMTL83151-catP-Pcat1-ΔKanR vector. The ligation product was then transformed into E. coli CA434, and after screening, the plasmid was extracted to obtain the ldh1 gene knockout plasmid p83-catPΔKanRΔldh1. The upstream and downstream primers for linearizing pMTL83151-catP-Pcat1-ΔKanR are p83-RPS-F and p83-RPS-R, respectively.

[0241] Example 5: Construction of hprK gene knockout and adhE2 gene knock-in plasmid

[0242] First, using pCloneEZ-Plac-repeat and pCloneEZ-repeat-terminator as templates, the fragments PbgaL-repeat(hprK) and (hprK)repeat-terminator were amplified, respectively. The 3' end of PbgaL-repeat(hprK) and the 5' end of (hprK)repeat-terminator contain the hprK spacer series. The upstream and downstream primers for amplifying PbgaL-repeat(hprK) were p83-Pbgal-F and spacer-hprK-R, respectively; the upstream and downstream primers for amplifying (hprK)repeat-terminator were hprK-Ter-F and hprK-Ter-R, respectively. These fragments were then fused using overlap PCR to obtain the PbgaL-ΔhprK fragment. Using the C. tyrobutyricum ATCC 25755 genome as a template, the upstream homologous arm H1 and downstream homologous arm H2 of hprK were amplified. H1 and H2 were then fused using overlap PCR to obtain the H1H2 (hprK) fragment. The primers used for amplifying the upstream homologous arm H1 were hprK-H1-F and hprK-H1-R, respectively; the primers used for amplifying the downstream homologous arm H2 were hprK-H2-F and hprK-H2-R, respectively. Using the Gibson method, the PbgaL-ΔhprK and H1H2(hprK) fragments were ligated to the linearized CRISPR-P parent plasmid pMTL83151-ermB-Pcat1-ΔcatP in step (3) of Example 2. Finally, the ligation product was transformed into E. coli CA434, and after screening, the plasmid was extracted to obtain the editing plasmid pMTL83151-ermBΔcatPΔhprK.

[0243] Primers Pctthl-F and adhE2-R were designed using plasmid pMTL83153-Δrease::Pctthl-adhE2 as a template. The Pctthl-adhE2 fragment was obtained by PCR amplification. The Pctthl-adhE2 fragment was ligated into the linearized pMTL83151-ermBΔcatPΔhprK vector (with reverse PCR amplification primers hprk-fankuo-F and hprk-fankuo-R) using the Gibson method. Finally, the ligation product was transformed into E. coli CA434. After screening, the plasmid was extracted, thus obtaining the hprK gene knockout and adhE2 gene knock-in plasmid pMTL83151-ermBΔcatPΔhprK::adhE2.

[0244] Example 6: Construction of xylR gene knockout and adhE2 gene knock-in plasmid

[0245] First, using pCloneEZ-Plac-repeat and pCloneEZ-repeat-terminator as templates, the fragments PbgaL-repeat(xylR) and (xylR)repeat-terminator were amplified, respectively. The 3' end of PbgaL-repeat(xylR) and the 5' end of (xylR)repeat-terminator contain xylR spacer sequences. The upstream and downstream primers for amplifying PbgaL-repeat(xylR) were p83-Pbgal-F and spacer-xylR-R, respectively; the upstream and downstream primers for amplifying (xylR)repeat-terminator were xylR-Ter-F and xylR-Ter-R, respectively. These fragments were then fused using overlap PCR to obtain the PbgaL-ΔxylR fragment. Using the C. tyrobutyricum ATCC 25755 genome as a template, the upstream homologous arm H1 and downstream homologous arm H2 of xylR were amplified. H1 and H2 were then fused using overlap PCR to obtain the H1H2(xylR) fragment. The primers used for amplifying the upstream homologous arm H1 were xylR-H1-F and xylR-H1-R, respectively; the primers used for amplifying the downstream homologous arm H2 were xylR-H2-F and xylR-H2-R, respectively. Using the Gibson method, the PbgaL-ΔxylR and H1H2(xylR) fragments were ligated to the linearized CRISPR-S parent plasmid pMTL83151-KAR-Pcat1-ΔermB in step (3) of Example 3. Finally, the ligation product was transformed into E. coli CA434, and after screening, the plasmid was extracted to obtain the second-round editing plasmid pMTL83151-KARΔermBΔxylR.

[0246] Primers xylR-fankuo-F and xylR-fankuo-R were designed using plasmid pMTL83151-KARΔermBΔxylR as a template for reverse PCR amplification to achieve linearization. The fragment Pctthl-adhE2 from Example 5 was ligated into the linearized vector pMTL83151-KARΔermBΔxylR using the Gibson method. Finally, the ligation product was transformed into E. coli CA434, and after screening, the plasmid was extracted to obtain the xylR gene knockout and adhE2 gene knock-in plasmid pMTL83151-KARΔermBΔxylR::adhE2.

[0247] Example 7: Construction of cat1 gene knockout and adhE2 gene knock-in plasmid

[0248] First, three fragments were obtained by PCR amplification: a lactose-induced expression system-driven gRNA expression cassette targeting cat1 and the upstream homologous arm of the cat1 gene (referred to as PbgaL-Δcat1-H1) fragment amplified by primers p83-Pbgal-F and cat1-H1-R designed with pMTL83153Δcat1 as a template; a Pctthl-adhE2 fragment obtained in Example 5; and a downstream homologous arm fragment of cat1 obtained by primers cat1-H2-F and cat1-H2-R designed with the C. tyrobutyricum ATCC 25755 genome as a template. The three fragments were ligated by overlap PCR and then assembled by Gibson. The fusion product was then ligated to the linearized CRISPR-R parent plasmid pMTL83151-catP-Pcat1-ΔKanR in step (2) of Example 4 to obtain the cat1 gene knockout and adhE2 gene knock-in plasmid pMTL83151-catPΔKanRΔcat1::adhE2.

[0249] Example 8: Construction of the genetically engineered bacterium GVB3 involving the plasmid pMTL82151-ermB-Pfla-vaat

[0250] Using plasmid pMTL82151-Pfla-VAAT as a template, a linearized vector fragment p82-Pfla-VAAT-C, stripped of the catP resistance gene, was obtained by reverse PCR amplification using primers chuCatp-F and chuCatp-R. This vector was then ligated to the ermB gene fragment from Example 2 using the Gibson assembly method. The ligation product was transformed into E. coli CA434, and after screening, the plasmid was extracted to obtain plasmid pMTL82151-ermB-Pfla-vaat.

[0251] Example 9: Genetically engineered bacteria GVB3NG involving the overexpression plasmid pMTL82151-ermB-Pfla-vaat-Pcat1-groESL12

[0252] Using C. tyrobutyricum ATCC 25755 genomic DNA as a template, the promoter Pcat1 was obtained by PCR amplification using primers Pcat1-groESL12-F and Pcat1-groESL12-R. Using Deinococcus wulumuqiensis DSM 28115 genomic DNA as a template, the heat shock protein gene groESL was obtained by PCR amplification using primers groESL12-F and groL-R. The terminator TslpA (nucleotide sequence shown in SEQ ID NO.7) was synthesized by the company. The promoter Pcat1, the groESL gene, and the terminator TslpA obtained above were fused into a single fragment Pcat1-groESL12 using overlap PCR. Using the plasmid pMTL82151-ermB-Pfla-vaat from Example 8 as a template, the linearized vector fragment p82-ermB-Pfla-VAAT-C was obtained by reverse PCR amplification using primers VAATgujia-groL-F and VAAT-groter-R. This vector was then ligated to the Pcat1-groESL12 fragment using the Gibson assembly method. The ligation product was transformed into E. coli CA434, and after screening, the plasmid was extracted to obtain the plasmid pMTL82151-ermB-Pfla-vaat-Pcat1-groESL12 (e.g., ...). Figure 2 (As shown).

[0253] Example 10

[0254] After obtaining the editing plasmid, the subsequent embodiments of this invention follow a cyclical operation pattern of "CRISPR-P series → CRISPR-R series → CRISPR-S series," achieving continuous editing by alternating the use of selection and induction media with corresponding resistance markers. First, the restriction endonuclease gene of *C. tyrobutyricum* ATCC 25755 was knocked out using the plasmid from Example 1, obtaining the engineered bacterium WT / ΔRMI with high transformation efficiency. Using WT / ΔRMI as the initial bacterium, six consecutive rounds of iterative genome editing were carried out using the editing plasmids from Examples 2-7, with the editing sequence as follows: Figure 2 As shown, they are Δldh2, Δldh3, Δldh1, ΔhprK::adhE2, ΔxylR::adhE2, and Δcat1::adhE2, respectively. Their specific descriptions are as follows:

[0255] (1) Construction of the initial WT / ΔRMI engineered bacteria

[0256] E. coli CA434 carrying the edited plasmid p83151-ΔRMI was conjugated with wild-type C. tyrobutyricum ATCC25755 for transformation (conjugation method see the literature "Yukai Suo et al. Butyric acid production from lignocellulosic biomass hydrolysates by engineered Clostridium tyrobutyricum overexpressing Class I heat shock protein GroESL. Bioresour. Technol. 2018; 250:691-698"), and transformants were screened on RTD conjugation selection plates. Subsequently, the successfully conjugated strains were cultured on YRTD inducible solid plates to induce rease gene knockout. PCR verification of single colonies was performed using genome-specific primers RMI-F and RMI-R to screen for the initial engineered strain WT / ΔRMI with the rease gene knocked out.

[0257] (2) Construction of WT / ΔRMIΔldh2 engineered bacteria

[0258] E. coli CA434 carrying the second-round editing plasmid p83-ermBΔcatPΔldh2 was conjugated with the engineered strain WT / ΔRMI for transformation, and transformants were screened on a RED conjugation selection plate. Subsequently, the successfully conjugated strains were cultured on YRED inducible solid plates to induce ldh2 gene knockout. Single colonies were validated by PCR using genome-specific primers ldh2-H2-1000F and ldh2-H1-1000R to screen for the engineered strain WT / ΔRMIΔldh2 with the ldh2 gene knocked out.

[0259] (3) Construction of WT / ΔRMIΔldh2Δldh3 engineered bacteria

[0260] E. coli CA434 carrying the third-round editing plasmid p83-KARΔermBΔldh3 was conjugated with the second-round edited recipient strain WT / ΔRMIΔldh2 for transformation, and transformants were screened on an RKD conjugation selection plate. Subsequently, the successfully conjugated strains were cultured on YRKD inducible solid plates to induce ldh3 gene knockout. Single colonies were validated by PCR using genome-specific primers YQ-ldh3-F and YQ-ldh3-R, and the engineered strain WT / ΔRMIΔldh2Δldh3 with the ldh3 gene knocked out was screened.

[0261] (4) Construction of WT / ΔRMIΔldh2Δldh3Δldh1 (GB) engineered bacteria

[0262] E. coli CA434 carrying the fourth-round editing plasmid p83-catPΔKanRΔldh1 was conjugated with the third-round edited recipient strain WT / ΔRMIΔldh2Δldh3 for transformation, and transformants were screened on an RTD conjugation selection plate. Subsequently, the successfully conjugated strains were cultured on YRTD inducible solid plates to induce ldh1 gene knockout. Single colonies were validated by PCR using genome-specific primers YQ-ldh1-F and YQ-ldh1-R, and the engineered strain WT / ΔRMIΔldh2Δldh3Δldh1 (named GB) with the ldh1 gene knocked out was obtained.

[0263] (5) Using the plasmid pMTL83151-ermBΔcatPΔhprK::adhE2 described in Example 5, the hprK gene was knocked out in engineered strain GB according to step (2) of Example 10, and the first adhE2 gene copy was integrated to obtain engineered strain GB1. Subsequently, based on strain GB1, using the plasmid pMTL83151-KARΔermBΔxylR::adhE2 described in Example 6, the xylR gene was knocked out and the second adhE2 copy was integrated according to step (3) of Example 10 to obtain engineered strain GB2. Finally, for strain GB2, using the plasmid pMTL83151-catPΔKanRΔcat1::adhE2 described in Example 7, the cat1 gene was knocked out and the third adhE2 copy was integrated according to step (4) of Example 10 to obtain engineered strain GB3. The overall process of this multi-round iterative editing and the genotype verification results at each stage are attached. Figure 2 As shown. The primers used to verify the hprK, xylR, and cat1 genotypes were Test-hprk-1000F, Test-hprk-1000R, Test-xylR-1000F, Test-xylR-1000R, Test-qiaoCAT1-F, and Test-qiaoCAT1-R, respectively.

[0264] Example 11: Using GB3 as the starting strain described in Example 10, the co-expression plasmid pMTL82151-ermB-Pfla-vaat described in Example 8 was combined with this strain to obtain engineered strain GVB3.

[0265] Using GB3 as described in Example 10 as the starting strain, the co-expression plasmid pMTL82151-ermB-Pfla-vaat-Pcat1-groESL12 described in Example 9 was conjugated into this strain to obtain the engineered strain GVB3NG.

[0266] Example 12: The preparation and shake-flask fermentation conditions of lignocellulose hydrolysate (corn cob hydrolysate, sugarcane bagasse hydrolysate, soybean hull hydrolysate, soybean straw hydrolysate) are as follows:

[0267] CGM medium formula (1L): 4g peptone, 2g yeast extract, 1g K2HPO4·3H2O, 0.5g KH2PO4, 2g (NH4)2SO4, 1mL trace element A solution, 1mL trace element B solution, solvent is deionized water; wherein:

[0268] Trace element A (1L): 20g CoCl2·6H2O, 15g CaCl2·2H2O;

[0269] Trace element B (1L): 15g FeSO4·7H2O, 15g ZnSO4·7H2O, 10g MnSO4·H2O, 100g MgSO4·7H2O.

[0270] (2) Preparation of hydrolysate: The biomass was dried at 55℃ for 48h and ground into powder (particle size ~280μm); 120g of powder was weighed, 0.02M H2SO4 was added, and the mixture was treated at 121℃ for 30min; after cooling to room temperature, the pH was adjusted to 5.0 with 0.02M NaOH; cellulase was added at 1.8% (v / v). After CTec2 (Novozymes, Copenhagen, Denmark), the mixture was enzymatically hydrolyzed at 50℃ and 150 rpm for 72 h. After hydrolysis, the mixture was centrifuged at 5000 rpm for 10 min, and the supernatant was collected. The supernatant was concentrated to a total sugar concentration (glucose + xylose) of 65-70 g / L. After concentration, the supernatant was centrifuged again and stored at 4℃ for later use.

[0271] (3) Shake-flask fermentation: After adjusting the pH of the concentrated hydrolysate to 6.8, 42.5 mL of the hydrolysate was transferred to a 125 mL serum bottle containing 40 g / L CaCO3 and autoclaved. A 10-fold concentrated CGM medium was prepared and autoclaved (115℃ for 20 min). Before inoculation, 5 mL of the autoclaved 10×CGM concentrate was mixed into 42.5 mL of the hydrolysate, and the seed culture was 2.5 mL, resulting in a final fermentation volume of 50 mL. Fermentation was carried out at 150 rpm and 37℃. During fermentation, 25 mL of hexadecane was added to the serum bottle every 24 hours as an extraction solvent. Samples were collected every 12 or 24 hours for analysis during fermentation. The shake-flask fermentation time was 120 hours.

[0272] (4) Sample determination: Residual sugars and metabolites (butanol, butyric acid, ethanol, acetic acid) were analyzed in the aqueous phase samples, and ester products (butyl butyrate, ethyl butyrate, butyl acetate) were analyzed in the organic phase samples. The concentrations of glucose, xylose, butyric acid, butanol, acetic acid, and ethanol in the aqueous phase of the fermentation broth were analyzed using a Waters Corporation high-performance liquid chromatograph (HPLC-RID) equipped with an Aminex 87H column (HPX-87H, Bio-Rad, Hercules, CA) and a refractive index detector (Waters 2414). The detection conditions were: column oven temperature 60℃, mobile phase 2.5 mM H₂SO₄ solution, flow rate 0.6 mL / min, and detector temperature 40℃.

[0273] The concentrations of butyl butyrate, butyl acetate, and ethyl butyrate in the organic phase of the fermentation broth were analyzed using a gas chromatograph (Agilent 7890A, Agilent Technologies, California, USA) equipped with a flame ionization detector (GC-FID) and a DB-FFAP capillary column (30 m × 0.25 mm × 0.5 μm, Agilent Technologies). N2 was used as the carrier gas at a flow rate of 3 mL / min. The GC column oven program was as follows: initial temperature of 40 °C for 1 min, then increased to 70 °C at a rate of 5 °C / min, followed by an increase to 220 °C at a rate of 30 °C / min and held for 5 min. An internal standard of 1 g / L amyl acetate was added to the hexadecane organic phase sample at a 1:1 (v / v) ratio.

[0274] Example 13: A method for producing butyl butyrate by batch fed fermentation using lignocellulose hydrolysate (such as corn cob hydrolysate) as a carbon source, specifically carried out in a 5L fermenter:

[0275] Culture medium: Measure 900 mL of corn cob hydrolysate treated according to step (2) of Example 12 (adjust pH to 6.0) as carbon source, and add an additional 20-fold concentrated modified CGM culture medium (organic nitrogen source is only 2 g / L yeast powder, and the other components remain unchanged).

[0276] Fermentation conditions: Inoculate with 50 mL of GVB3NG seed culture (final initial fermentation volume 1 L). Fermentation temperature 37℃, stirring speed 150 rpm. The pH of the fermentation broth was automatically maintained at 6.0 using 30% (v / v) ammonia throughout the process. Nitrogen gas was purged into the fermenter for more than 30 minutes before inoculation to ensure an anaerobic environment.

[0277] Product extraction: 24 hours after inoculation, 0.5 L of hexadecane was added to the fermenter as an extractant.

[0278] Feeding strategy: Regularly sample and monitor residual sugars (glucose, xylose) and biomass (OD). 600 And its main metabolites (butanol, butyric acid, ethanol, acetic acid). When the residual sugar concentration is below 15 g / L, add 500 mL to 1000 mL of sterilized concentrated corn cob hydrolysate adjusted to pH 6.0.

[0279] (5) Product analysis was performed according to step (4) of Example 12.

[0280] Example 14: To compare the fermentation advantages of engineered bacteria overexpressing groESL in lignocellulose hydrolysates, shake-flask fermentation of GVB3 and GVB3NG described in Example 11 in different lignocellulose hydrolysates (corn cob hydrolysate, sugarcane bagasse hydrolysate, soybean hull hydrolysate, and soybean straw hydrolysate) was evaluated. The results are as follows: Figure 3 As shown, GVB3NG outperformed GVB3 in butyl butyrate production in all four tested hydrolysates (increasing by 16.3%-19.1%), with the highest butyl butyrate production (4.42 g / L) achieved in corn cob hydrolysate as the carbon source.

[0281] Example 15: Using GVB3NG as the fermentation engineered strain described in Example 11, GVB3NG was subjected to fed-batch fermentation for 132 hours according to the method of Example 13. The final results showed that GVB3NG consumed 109g of glucose and 61.39g of xylose, with a butyl butyrate yield of 26.62g / L. The yield and selectivity were 0.09mol / mol and 95.86%, respectively. Figure 4 (As shown).

[0282] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A Clostridium butyricum strain that co-produces butyl butyrate using glucose and xylose, characterized in that: The Clostridium butyricum strain that utilizes both glucose and xylose to produce butyl butyrate has the following characteristics: (1) Knock out the restriction endonuclease rease gene; (2) Knock out lactate dehydrogenase ldh2, lactate dehydrogenase ldh3 and lactate dehydrogenase ldh1 genes; (3) Knock out the HPr kinase / phosphorylase hprK gene and simultaneously knock in the aldol dehydrogenase adhE2 gene at the same site. (4) Knock out the xylR gene, a xylose transcription repressor, and simultaneously knock in the aldosterone dehydrogenase adhE2 gene at the same site. (5) Knock out the butyryl-CoA / acetic acid CoA transferase cat1 gene and simultaneously knock in the aldol dehydrogenase adhE2 gene at the same site. (6) Overexpression of acyltransferase VAAT and overexpression of heat shock protease GroESL.

2. The Clostridium butyricum strain according to claim 1, which co-utilizes glucose and xylose to produce butyl butyrate, is characterized in that: The aldol dehydrogenase mentioned is derived from Clostridium acetobutylicum; The heat shock protease described is derived from *Deinococcus wulumuqiensis* DSM 28115, a radiation-resistant bacterium.

3. The Clostridium butyricum strain according to claim 1, which co-utilizes glucose and xylose to produce butyl butyrate, is characterized in that: The aldol dehydrogenase adhE2 gene is expressed by the promoter Pctthl of the Clostridium butyricum endogenous thiolytic enzyme gene. The nucleotide sequence of the promoter Pctthl is shown in SEQ ID NO.1; The nucleotide sequence of the gene encoding the aldol dehydrogenase is shown in SEQ ID NO.2; The gene for the acyltransferase vaat is expressed by the promoter Pfla of the Clostridium acetone-butanol flavin protein gene. The nucleotide sequence of the promoter Pfla is shown in SEQ ID NO.3; The nucleotide sequence of the gene encoding the acyltransferase vaat is shown in SEQ ID NO.4; The heat shock protease groESL gene is expressed by the promoter Pcat1 of the Clostridium butyryl-CoA / acetic acid-CoA transferase gene. The nucleotide sequence of the promoter Pcat1 is shown in SEQ ID NO.5; The nucleotide sequence of the gene encoding the heat shock protease is shown in SEQ ID NO.

6.

4. The method for constructing Clostridium butyricum, which co-utilizes glucose and xylose to produce butyl butyrate, as described in any one of claims 1 to 3, is characterized in that... Includes the following steps: S0: An editing plasmid targeting the restriction endonuclease rease gene was introduced into the Clostridium butyricum chassis strain to obtain Clostridium butyricum WTΔRMI; S1: The editing plasmid that targets and knocks out ldh2 is introduced into Clostridium butyricum WTΔRMI; positive colonies are plated on RCM selective medium containing inducer and cultured to screen for positive clones with plasmid elimination and successful ldh2 gene knockout, namely WTΔRMIΔldh2 strain. S2: The editing plasmid that targets and knocks out ldh3 is introduced into the WTΔRMIΔldh2 strain obtained in step S1, and the induction and screening process is repeated to obtain the WTΔRMIΔldh2Δldh3 strain. S3: Iterative editing to build GB3: Repeat the iterative editing process of step S2, as follows: The third round: Based on the WTΔRMIΔldh2Δldh3 strain, an editing plasmid that targets and knocks out ldh1 was introduced to knock out ldh1, resulting in the WTΔRMIΔldh2Δldh3Δldh1 strain, which was named engineered strain GB. Fourth round: Based on the engineered strain GB, an editing plasmid that targets and knocks out hprK and inserts adhE2 was introduced. The first adhE2 expression cassette was introduced while knocking out hprK to obtain engineered strain GB1. Fifth round: Based on the strains from the fourth round, an editing plasmid that targets and knocks out xylR and inserts adhE2 was introduced. At the same time as knocking out xylR, a second adhE2 expression cassette was introduced to obtain the engineered strain GB2. Sixth round: Based on the strains from the fifth round, an editing plasmid that targets and knocks out cat1 and inserts adhE2 was introduced. At the same time as knocking out cat1, a third adhE2 expression cassette was introduced to obtain engineered strain GB3. S4: The plasmid containing the Pfla-vaat and Pcat1-groESL expression cassettes was introduced into the engineered strain GB3 to obtain the target engineered strain GVB3NG, which is Clostridium butyricum that co-produces butyl butyrate using glucose and xylose.

5. The method for constructing Clostridium butyricum using glucose and xylose to produce butyl butyrate according to claim 4, characterized in that: The editing plasmid targeting the restriction endonuclease rease gene described in step S0 is p83151-ΔRMI; The p83151-ΔRMI plasmid is obtained by the following steps: inserting a gRNA expression cassette containing a repair homologous arm and a gene that targets and knocks out the restriction endonuclease rease gene into the multiple cloning site of the pMTL83151 plasmid backbone, thus obtaining the plasmid p83151-ΔRMI. The editing plasmid for targeted knockout of ldh2 mentioned in step S1 is p83-ermBΔcatPΔldh2; The p83-ermBΔcatPΔldh2 is obtained through the following steps: the chloramphenicol resistance gene is removed from the pMTL83151 plasmid backbone to obtain the vector pMTL83151-C, and then the erythromycin resistance gene is cloned into it to obtain the vector pMTL83151-ermB. Next, a gRNA expression cassette driven by promoter Pcat1 to target and knock out the chloramphenicol resistance gene catP is inserted into the multiple cloning site of the vector pMTL83151-ermB to obtain the CRISPR-P vector pMTL83151-ermB-Pcat1-ΔcatP. Finally, a gRNA expression cassette that can be driven by lactose-induced promoter to target and knock out the genomic ldh2 and contains repair homologous arms is inserted upstream of the promoter Pcat1 of the CRISPR-P vector to obtain the plasmid p83-ermBΔcatPΔldh2. The editing plasmid for targeted knockout of ldh3 mentioned in step S2 is p82-KARΔermBΔldh3; The p82-KARΔermBΔldh3 was obtained through the following steps: the ampicillin-kanamycin tandem resistance gene was cloned into the vector pMTL83151-C to obtain the vector pMTL83151-KAR. Then, a gRNA expression cassette that targets and knocks out the erythromycin resistance gene ermB driven by the promoter Pcat1 was inserted into the multiple cloning site of the vector to obtain the CRISPR-S vector pMTL83151-KAR-Pcat1-ΔermB. Finally, a gRNA expression cassette that can target and knock out the genomic ldh3 driven by the lactose-inducible promoter and contains a repair homologous arm was inserted upstream of the promoter Pcat1 of the CRISPR-S vector to obtain the plasmid p82-KARΔermBΔldh3. The editing plasmid for targeted knockout of ldh1 mentioned in step S3 is p83-catPΔKanRΔldh1; The p83-catPΔKanRΔldh1 was obtained through the following steps: a gRNA expression cassette driven by Pcat1 to target and knock out the kanamycin resistance gene KanR was inserted into the multiple cloning site of the pMTL83151 plasmid to obtain the CRISPR-R vector pMTL83151-catP-Pcat1-ΔKanR; then, a gRNA expression cassette that can be driven by a lactose-inducible promoter to target and knock out ldh1 in the genome and contains a repair homologous arm was inserted upstream of the promoter Pcat1 of the CRISPR-R vector to obtain the plasmid p83-catPΔKanRΔldh1. The editing plasmid for targeting and knocking out hprK and inserting adhE2 in step S3 is pMTL83151-ermBΔcatPΔhprK::adhE2; The pMTL83151-ermBΔcatPΔhprK::adhE2 is obtained through the following steps: inserting a gRNA expression cassette that can be driven by a lactose-inducible promoter to target and knock out the genomic hprK and contains a repair homologous arm and the Pctthl-adhE2 to be knocked in into the CRISPR-P vector pMTL83151-ermB-Pcat1-ΔcatP; The editing plasmid for targeting and knocking out xylR and inserting adhE2 in step S3 is pMTL83151-KARΔermBΔxylR::adhE2; The pMTL83151-KARΔermBΔxylR::adhE2 is obtained through the following steps: inserting a gRNA expression cassette containing a repair homologous arm and the Pctthl-adhE2 to be knocked into the CRISPR-S vector pMTL83151-KAR-Pcat1-ΔermB; this cassette is capable of targeted knockout of the genome xylR driven by a lactose-inducible promoter. The edit plasmid that targets and knocks out cat1 and inserts adhE2 in step S3 is pMTL83151-catPΔKanRΔcat1::adhE2; The pMTL83151-catPΔKanRΔcat1::adhE2 is obtained through the following steps: inserting a gRNA expression cassette that can be driven by a lactose-inducible promoter to target and knock out the genomic cat1 and contains a repair homologous arm and the Pctthl-adhE2 to be knocked in into the CRISPR-R vector pMTL83151-catP-Pcat1-ΔKanR; The overexpression plasmid mentioned in step S3 is plasmid pMTL82151-ermB-Pfla-vaat-Pcat1-groESL12; The pMTL82151-ermB-Pfla-vaat-Pcat1-groESL12 is obtained through the following steps: the chloramphenicol resistance gene is removed from the backbone of the pMTL82151-Pfla-VAAT plasmid and the erythromycin resistance gene is cloned to obtain the plasmid pMTL82151-ermB-Pfla-vaat. Then, the Pcat1-groESL expression cassette is inserted downstream of the vaat gene in this vector.

6. The method for constructing Clostridium butyricum using glucose and xylose to produce butyl butyrate according to claim 5, characterized in that: The target site for the sgRNA design targeting the knockout of the restriction endonuclease rease gene is: rease: 5'-AGAAGATATGGATGATGCGGTTGAACCAAGTTTC-3'; The target site designed to eliminate the sgRNA of CRISPR-R series plasmids by knocking out the chloramphenicol resistance gene catP is as follows: catP:5'-TATATCCCCAATTCACCATCTTGATTGATTGCCGTCCT-3'; The target of the sgRNA designed to knock out ldh2 in the genome is: ldh2:5'-CAGCTATATAATAGGAGAACATGGAGATTCTGAA-3'; The target site designed to eliminate the erythromycin resistance gene ermB in CRISPR-P series plasmids by knocking out the sgRNA is: ermB:5'-ACTTCTGCCATTAAAAATAATGCCAATGAGCGTTTTGT-3'; The target of the sgRNA design for knocking out ldh3 in the genome is: ldh3:5'-AATCCACTTAAATGCTTTATTACAGTTTTTCCAATTCT-3'; The target site for the design of the targeted knockout of the kanamycin resistance gene KanR to eliminate the sgRNA in CRISPR-S series plasmids is as follows: 5'-GGCTCTTCACTCCATCGACATATCGGATTGTCCTAT-3'; The target of the sgRNA design for knocking out ldh1 in the genome is: ldh1:5'-TAGCAAATAGATACAATCTTGACCCTAAGGATGT-3'; The target of the sgRNA design for targeted knockout of genomic hprK is: hprK:5'-TGGAGTATTGGTAGACGTATATGGTGTTGGGATG-3'; The target of the design for targeted knockout of xylR in the genome is: xylR:5'-GCTTATGCAGAAGCTTTTCTTAATTTCAATGATA-3'; The target of the design for the targeted knockout of the genomic cat1 is: cat1:5'-CTTGTAGAAGATGGATCAACCCTACAACTTGGTA-3'.

7. The use of Clostridium butyricum, as described in any one of claims 1 to 3, in the production of butyl butyrate by co-utilizing glucose and xylose.

8. A method for producing butyl butyrate by fermentation using lignocellulose hydrolysate as a carbon source, characterized in that... Includes the following steps: 1) The Clostridium butyricum strain according to any one of claims 1 to 3, which co-utilizes glucose and xylose to produce butyl butyrate, is inoculated into a fermentation medium containing lignocellulose hydrolysate for anaerobic fermentation, and the pH of the fermentation broth is maintained at 5.8 to 6.

2. 2) Regularly sample and monitor residual sugar. When the residual sugar concentration is below 15 g / L, add lignocellulose hydrolysate equivalent to 1 / 2 to 1 volume of the fermentation broth described in step 1). 3) During fermentation for 12-24 hours, add hexadecane equivalent to 1 / 3 to 2 / 3 of the volume of the fermentation broth described in step 1) as the extractant for the ester extraction; 4) After fermentation, an organic phase containing butyl butyrate is obtained.

9. The method for producing butyl butyrate by fermentation using lignocellulose hydrolysate as a carbon source according to claim 8, characterized in that: The lignocellulose hydrolysate mentioned in step 1) is at least one of corn cob hydrolysate, sugarcane bagasse hydrolysate, soybean hull hydrolysate, and soybean straw hydrolysate. The fermentation medium mentioned in step 1) is a nitrogen-containing CGM medium with the following composition: 2 g / L yeast extract, 1 g / L K2HPO4·3H2O, 0.5 g / L KH2PO4, 2 g / L (NH4)2SO4, 1 mL / L trace element A and 1 mL / L trace element B; wherein: The composition of trace element A is as follows: 20 g / L CoCl2·6H2O, 15 g / L CaCl2·2H2O; The composition of trace element B is as follows: 15 g / L FeSO4·7H2O, 15 g / L ZnSO4·7H2O, 10 g / L MnSO4·H2O, 100 g / L MgSO4·7H2O.

10. The method for producing butyl butyrate by fermentation using lignocellulose hydrolysate as a carbon source according to claim 8, characterized in that: The anaerobic fermentation conditions described in step 1) are a temperature of 36–38°C and a rotation speed of 120–180 rpm; The fermentation time described in step 4) is 120–144 hours.

Images