Application of miR-151-5p as a target in the preparation of products regulating follicle development

By regulating follicle development through the miR-151-5p target, the lack of granulosa cell proliferation and steroid hormone secretion during follicle development is resolved, effective regulation of follicle number and cell cycle is achieved, and the efficiency of ovarian development is improved.

CN120249286BActive Publication Date: 2025-09-26SOUTH CHINA AGRICULTURAL UNIVERSITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510748339.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-06
Publication Date
2025-09-26
Estimated Expiration
2045-06-06

AI Technical Summary

Technical Problem

There is no relevant research on the relationship between miR-151-5p and follicular development in the existing technology, resulting in a lack of effective means to regulate granulosa cell proliferation, cell cycle and steroid hormone secretion during follicular development.

Method used

Using miR-151-5p as a target, by regulating the proliferation, cell cycle and steroid hormone secretion of ovarian granulosa cells, miR-151-5p agonists or inhibitors were used to regulate the follicle development process, screened out the target gene PGAM1 and inhibited its expression by degrading mRNA.

Benefits of technology

miR-151-5p significantly regulates the follicular development process, inhibits or promotes the proliferation of ovarian granulosa cells, regulates the number of follicles and cell cycle, promotes the secretion of steroid hormones, and improves the efficiency of ovarian development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249286B_ABST
    Figure CN120249286B_ABST
Patent Text Reader

Abstract

The present invention provides the application of miR-151-5p as a target in the preparation of products for regulating follicular development, which belongs to the field of molecular biotechnology. The present invention provides the application of miR-151-5p in the preparation of reagents for regulating the process of follicular development. The miR-151-5p can inhibit cell proliferation, block the cell cycle, and inhibit the expression of genes related to the proliferation of goat ovarian granulosa cells, but can promote the secretion of steroid hormones in goat ovarian granulosa cells, promote the expression of genes related to steroid hormone secretion, and promote the expression of key proteins for the secretion of steroid hormones in ovarian granulosa cells. The present invention also screened the target gene of the miR-151-5p. PGAM1 The miR-151-5p inhibits the target gene by degrading mRNA PGAM1 Therefore, by regulating the miR-151-5p and / or PGAM1 Regulate to control the development of follicles.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of molecular biotechnology, and specifically relates to the application of miR-151-5p as a target in the preparation of products for regulating follicle development. Background Art

[0002] The ovary is a crucial organ for female reproductive capacity, with one of its primary functions being follicle development and ovulation. The follicle is the basic structural and functional unit of the ovary, primarily responsible for ovulation and hormone secretion. During follicular development, granulosa cells transform from a flat to a cubic shape and subsequently differentiate. This series of changes plays a crucial role in the growth and development of the oocyte, the initiation of primordial follicle growth, the regulation of follicular development during the growing phase, and follicular atresia. Furthermore, granulosa cell apoptosis is a key mechanism in initiating follicular atresia. Excessive apoptosis of granulosa cells within the follicle can induce follicular atresia, reduce estrus frequency, and thus affect female productivity.

[0003] Granulosa cells, as an essential component of the ovarian follicle, are the primary site of estrogen synthesis. During follicular development, they gradually proliferate from a single, flat layer to a multi-layered, columnar structure. They produce follicular development-related cytokines, growth factors, and estrogen, promoting follicular maturation. It is currently believed that the recruitment, selection, and ovulation of follicles are essentially the proliferation and differentiation of granulosa cells, while granulosa cell apoptosis represents the atresia and degeneration of the follicle.

[0004] miR-151-5p is a microRNA whose expression varies across different tumors. Its expression is often upregulated in tumors such as pituitary adenomas, acute myeloid leukemia, endometrial cancer, lung cancer, Barrett's esophagus, colorectal cancer, myelodysplastic syndrome, hepatocellular carcinoma, and breast cancer, acting as an oncogene. It also exhibits a tumor suppressor role in malignant pleural mesothelioma, central nervous system lymphoma, chronic myeloid leukemia, and acute lymphoblastic leukemia. Furthermore, miR-151-5p has diagnostic and prognostic value. In head and neck squamous cell carcinoma, miR-151-5p expression levels are significantly correlated with tumor metastasis and prognosis, making it a potential marker for determining metastasis and assessing prognosis. Studies have also linked miR-151-5p to memory formation and endothelial cell function, but no studies have yet investigated its relationship with follicular development. Summary of the Invention

[0005] The present invention provides the use of miR-151-5p as a target in the preparation of a product for regulating follicular development. The miR-151-5p can play a role in the process of follicular development.

[0006] The present invention provides the use of miR-151-5p in preparing a reagent for regulating the process of follicle development.

[0007] In a preferred embodiment of the present invention, the regulation includes regulating at least one of the following: (1) regulating the proliferation of ovarian granulosa cells;

[0008] (2) Regulate the number of follicles;

[0009] (3) Regulate the cell cycle of ovarian granulosa cells;

[0010] (4) Regulate the secretion of steroid hormones in ovarian granulosa cells.

[0011] In a preferred embodiment of the present invention, regulating the cell cycle of ovarian granulosa cells includes regulating the progression of ovarian granulosa cells from G1 phase to S phase.

[0012] In a preferred embodiment of the present invention, the regulation of ovarian granulosa cell steroid hormone secretion includes: regulating the secretion of estrogen and / or progesterone, regulating the expression of steroid hormone secretion-related genes, and regulating the secretion of steroid hormone secretion-related proteins.

[0013] In a preferred embodiment of the present invention, the target genes of miR-151-5p include PGAM1 .

[0014] The present invention also provides the use of a reagent that promotes miR-151-5p expression in the preparation of any of the following products: a product that inhibits ovarian granulosa cell proliferation, a product that reduces the number of follicles, a product that blocks the ovarian granulosa cell cycle, and a product that promotes steroid hormone secretion in ovarian granulosa cells.

[0015] In a preferred embodiment of the present invention, the reagent for promoting the expression of miR-151-5p includes at least one of the following: an agonist of the miR-151-5p, a mimic of the miR-151-5p, an overexpression vector containing the base sequence of the miR-151-5p, an overexpression vector containing the base sequence of the miR-151-5p mimic, a composition containing the miR-151-5p, a composition containing an agonist of the miR-151-5p, and a composition containing a miR-151-5p mimic.

[0016] The present invention also provides the use of a reagent for inhibiting miR-151-5p expression in the preparation of any of the following products: a product for promoting ovarian granulosa cell proliferation, a product for increasing the number of follicles, and a product for inhibiting steroid hormone secretion of ovarian granulosa cells.

[0017] In a preferred embodiment of the present invention, the reagent for inhibiting the expression of miR-151-5p comprises at least one of the following: the inhibitor of miR-151-5p and the antagonist of miR-151-5p.

[0018] The present invention also provides a reagent for promoting follicle development, including a reagent for inhibiting miR-151-5p expression and / or promoting PGAM1 Expression reagents.

[0019] Beneficial Effects: The present invention provides the use of miR-151-5p in the preparation of a reagent for regulating follicular development. The miR-151-5p is differentially expressed in large and small follicles and is significantly upregulated in large follicles, indicating that miR-151-5p may play a role in follicular development. In one embodiment of the present invention, goat ovarian granulosa cells were used as hosts, and by transfecting miR-151-5p mimics and inhibitors, it was found that the difference in cell proliferation activity was significantly reduced after overexpression of miR-151-5p, and the difference in cell proliferation activity was significantly reduced after interference with miR-151-5p, indicating that miR-151-5p can inhibit cell proliferation, and specifically, miR-151-5p can prevent cells from progressing from the G1 phase to the S phase.

[0020] The miR-151-5p described in the present invention can also inhibit the expression of genes related to the proliferation of goat ovarian granulosa cells, and at the same time inhibit the expression of key proteins in the proliferation process of ovarian granulosa cells, but miR-151-5p can promote the secretion of steroid hormones in goat ovarian granulosa cells, promote the expression of genes related to steroid hormone secretion, and promote the expression of key proteins for steroid hormone secretion in ovarian granulosa cells.

[0021] The present invention also screened the target gene of miR-151-5p PGAM1 , PGAM1 There is a binding site between the 3' UTR region of the target gene and the miR-151-5p, and the miR-151-5p inhibits the target gene by degrading mRNA. PGAM1 The target gene of the present invention PGAM1 It can promote the proliferation of goat ovarian granulosa cells and interfere with PGAM1 It can inhibit the cell cycle progression from G1 phase to S phase of ovarian granulosa cells, inhibit the expression of key cell proliferation genes, and promote the secretion of steroid hormones in goat ovarian granulosa cells. At the same time, the present invention also found that miR-151-5p regulates the function of granulosa cells by regulating the phosphorylation state of AKT. PGAM1 The function of ovarian granulosa cells is regulated by the PI3K / AKT signaling pathway. Therefore, the miR-151-5p and / or PGAM1Regulate to control the development of follicles. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Figure 1 shows the relative expression of miR-151-5p in large and small follicles and the verification result of miR-151-5p transfection efficiency in goat ovarian granulosa cells. Figure A: relative expression of miR-151-5p in large and small follicles; B: relative expression of miR-151-5p in goat ovarian granulosa cells after transfection with miR-151-5p mimics; C: relative expression of miR-151-5p in goat ovarian granulosa cells after transfection with miR-151-5 inhibitor.

[0023] Figure 2 Figure 1 shows the effect of miR-151-5p on the viability of goat ovary granulosa cells. Figure A: CCK-8 assay to detect the effect of overexpression of miR-151-5p on cell proliferation. Figure B: CCK-8 assay to detect the effect of interference with miR-151-5p on cell proliferation.

[0024] Figure 3 This is the result of EdU detection of the effect of miR-151-5p on the proliferation of goat ovary granulosa cells;

[0025] Figure 4 Figure 1 shows the results of miR-151-5p inhibiting the cell cycle progression of goat ovarian granulosa cells. Figure A: Flow cytometry analysis of the effect of miR-151-5p mimics on the cell cycle progression of goat ovarian granulosa cells. Figure B: Flow cytometry analysis of the effect of miR-151-5p inhibitor on the cell cycle progression of goat ovarian granulosa cells.

[0026] Figure 5 Figure 1 shows the effect of miR-151-5p on proliferation-related genes in ovarian granulosa cells. Figure A shows the quantitative results of proliferation-related marker genes after overexpression of miR-151-5p; Figure B shows the quantitative results of proliferation-related marker genes after interference with miR-151-5p.

[0027] Figure 6 Figure 1 shows the effect of miR-151-5p on the expression of proteins related to ovarian granulosa cell proliferation. Figure A: Western blot results of proteins related to cell proliferation after overexpression of miR-151-5p; B: Visual analysis of Western blot results of proteins related to cell proliferation after overexpression of miR-151-5p; C: Western blot results of proteins related to cell proliferation after interference with miR-151-5p; D: Visual analysis of Western blot results of proteins related to cell proliferation after interference with miR-151-5p.

[0028] Figure 7 Figure 1 shows the effect of miR-151-5p on steroid hormone secretion in ovarian granulosa cells. Figure A shows the effect of miR-151-5p on estrogen secretion in ovarian granulosa cells. Figure B shows the effect of miR-151-5p on progesterone secretion in ovarian granulosa cells.

[0029] Figure 8 This figure shows the effect of miR-151-5p on the expression of genes related to steroid hormone secretion in ovarian granulosa cells;

[0030] Figure 9 Figure 1 shows the effect of miR-151-5p on the expression of proteins related to steroid hormone secretion in ovarian granulosa cells. Figure A: Western blotting results of proteins related to steroid hormone secretion in cells after overexpression of miR-151-5p; B: Visual analysis of Western blotting results of proteins related to steroid hormone secretion in cells after overexpression of miR-151-5p; C: Western blotting results of proteins related to steroid hormone secretion in cells after interference with miR-151-5p; D: Visual analysis of Western blotting results of proteins related to steroid hormone secretion in cells after interference with miR-151-5p.

[0031] Figure 10 Figure 1 is the result of differential gene analysis of miR-151-5p transcriptome, A: Volcano plot of differentially expressed genes; B: Heat map of cluster analysis of differentially expressed genes;

[0032] Figure 11 Figure 1 is a circle diagram of differential gene enrichment analysis, A: GO enrichment analysis circle diagram; B: KEGG enrichment analysis circle diagram;

[0033] Figure 12 Figure 2 is the RT-qPCR validation result of differentially expressed genes;

[0034] Figure 13 Dual luciferase analysis of miR-151-5p and PGAM1 Targeting relationship diagram;

[0035] Figure 14 To interfere with miR-151-5p PGAM1 Expression impact result diagram;

[0036] Figure 15 Under the action of siRNA PGAM1 mRNA expression level changes;

[0037] Figure 16 This is the result of CCK-8 detection of the effect of interfering with PGAM1 on cell proliferation activity;

[0038] Figure 17 For EdU detection PGAM1 Effects on the proliferation of goat ovarian granulosa cells;

[0039] Figure 18 for PGAM1 Results of promoting cell cycle progression of goat ovarian granulosa cells;

[0040] Figure 19 for PGAM1 The results of the effect on genes related to ovarian granulosa cell proliferation;

[0041] Figure 20 for PGAM1 Effects on the expression of ovarian granulosa cell proliferation-related proteins and interference effect verification results, Figure A: Interference PGAM1 Western blotting results of proteins related to cell proliferation; B: interference PGAM1 Then the results of immunoblotting of proteins related to cell proliferation were visualized and analyzed;

[0042] Figure 21 For interference PGAM1 Effects on steroid hormone secretion in ovarian granulosa cells, Figure A: Interference PGAM1 Effect on estrogen secretion of ovarian granulosa cells; B: interference PGAM1 Effects on progesterone secretion in ovarian granulosa cells;

[0043] Figure 22 for PGAM1 Effects on the expression of genes related to steroid hormone secretion in ovarian granulosa cells;

[0044] Figure 23 for PGAM1 Effects on the expression of proteins related to steroid hormone secretion in ovarian granulosa cells, A: Interference PGAM1 Western blot results of proteins related to cellular steroid hormone secretion; B: interference PGAM1 Then the results of western blot analysis of proteins related to cellular steroid hormone secretion were visualized;

[0045] Figure 24 Figure 1 shows the effect of miR-151-5p on the expression of proteins in the PI3K / AKT signaling pathway in goat ovarian granulosa cells. Figure A: Immunoblotting results of proteins related to the PI3K / AKT signaling pathway after overexpression of miR-151-5p; B: Visual analysis of immunoblotting results of proteins related to the PI3K / AKT signaling pathway after overexpression of miR-151-5p; C: Immunoblotting results of proteins related to the PI3K / AKT signaling pathway after interference with miR-151-5p; D: Visual analysis of immunoblotting results of proteins related to the PI3K / AKT signaling pathway after interference with miR-151-5p.

[0046] Figure 25 for PGAM1 Effects on protein expression of PI3K / AKT signaling pathway in goat ovarian granulosa cells. PGAM1 Western blot results of proteins related to the PI3K / AKT signaling pathway; B: interference PGAM1 Afterwards, the results of immunoblotting of proteins related to the PI3K / AKT signaling pathway were visualized and analyzed;

[0047] Figure 26 These are the results of the effect of miR-151-5p on mouse ovarian development. Figure A: HE staining section of mouse ovaries after ovarian injection of miR-151-5p antagonist; B: follicle counts at all levels in mouse ovaries after injection of miR-151-5p antagonist; C: HE staining section of mouse ovaries after ovarian injection of miR-151-5p agonist; D: follicle counts at all levels in mouse ovaries after injection of miR-151-5p agonist. DETAILED DESCRIPTION

[0048] The present invention provides the use of miR-151-5p in preparing a reagent for regulating the process of follicle development.

[0049] The base sequence of miR-151-5p of the present invention is shown in SEQ ID No. 1: 5'-UCGAGGAGCUCACAGUCUAGU-3'.

[0050] The present invention confirms that the miR-151-5p can regulate the follicle development process, specifically including any of the following: (1) regulating the proliferation of ovarian granulosa cells;

[0051] (2) Regulate the number of follicles;

[0052] (3) Regulate the cell cycle of ovarian granulosa cells;

[0053] (4) Regulate the secretion of steroid hormones in ovarian granulosa cells.

[0054] In one embodiment of the present invention, goat ovarian granulosa cells are used as an example to illustrate that overexpression of the miR-151-5p can inhibit the proliferation of ovarian granulosa cells, and inhibiting the expression of the miR-151-5p can promote the proliferation of ovarian granulosa cells.

[0055] In one embodiment of the present invention, goat ovarian granulosa cells are used as an example to illustrate that inhibiting the expression of miR-151-5p can increase the number of follicles, and overexpressing miR-151-5p can reduce the number of follicles and cause ovarian development abnormalities.

[0056] In one embodiment of the present invention, the effect of miR-151-5p on the cell cycle of goat ovarian granulosa cells was verified by flow cytometry. The results showed that after overexpression of miR-151-5p, the proportion of G1 phase cells increased significantly, the proportion of S phase cells decreased significantly, and the proportion of G2 phase cells did not change significantly. After inhibition of miR-151-5p, the proportion of G1 phase cells decreased significantly, the proportion of S phase cells increased significantly, and the proportion of G2 phase cells did not change significantly, demonstrating that miR-151-5p can regulate the cell cycle of ovarian granulosa cells.

[0057] In one embodiment of the present invention, a comparative experiment of overexpression and interference of miR-151-5p expression was conducted to verify the effect of miR-151-5p on genes related to proliferation of goat ovarian granulosa cells. The results showed that after overexpression of miR-151-5p, PCNA 、 CDK4 and CCND1 The mRNA expression level of P53 The mRNA expression level of miR-151-5p was significantly increased; after inhibiting the miR-151-5p, PCNA 、 CDK6 and CCND1 The mRNA expression level of P53 The expression level of miR-151-5p was significantly reduced, indicating that miR-151-5p can inhibit cell proliferation. At the same time, Western Blot detection found that miR-151-5p can inhibit the expression of key proteins in the proliferation process of ovarian granulosa cells.

[0058] In one embodiment of the present invention, ELISA experiments confirmed that miR-151-5p can promote the secretion of steroid hormones in goat ovarian granulosa cells, wherein the steroid hormones include estrogen and / or progesterone, while promoting the expression of genes related to steroid hormone secretion in ovarian granulosa cells and promoting the expression of key proteins for steroid hormone secretion in ovarian granulosa cells.

[0059] In one embodiment of the present invention, the target gene of miR-151-5p was also screened. PGAM1 , the binding site is located at the PGAM1 The 3'UTR region of the miR-151-5p is inhibited by degrading mRNA. PGAM1 Perform its function.

[0060] The present invention also provides the use of a reagent that promotes miR-151-5p expression in the preparation of any of the following products: a product that inhibits ovarian granulosa cell proliferation, a product that reduces the number of follicles, a product that blocks the ovarian granulosa cell cycle, and a product that promotes steroid hormone secretion in ovarian granulosa cells.

[0061] In a preferred embodiment of the present invention, the reagent for promoting miR-151-5p expression comprises at least one of the following: an agonist of miR-151-5p, a mimic of miR-151-5p, an overexpression vector containing the base sequence of miR-151-5p, an overexpression vector containing the base sequence of miR-151-5p mimic, a composition containing miR-151-5p, a composition containing an agonist of miR-151-5p, and a composition containing a mimic of miR-151-5p. In one embodiment of the present invention, the base sequence of the miR-151-5p mimic has a nucleotide sequence of the forward chain as shown in SEQ ID No. 2: 5'-UCGAGGAGCUCACAGUCUAGU-3', and a nucleotide sequence of the reverse chain as shown in SEQ ID No. 3: 5'-UAGACUGUGAGCUCCUCGAUU-3'.

[0062] The present invention also provides the use of a reagent for inhibiting miR-151-5p expression in the preparation of any of the following products: a product for promoting ovarian granulosa cell proliferation, a product for increasing the number of follicles, and a product for inhibiting steroid hormone secretion of ovarian granulosa cells.

[0063] In a preferred embodiment of the present invention, the reagent for inhibiting miR-151-5p expression comprises at least one of the following: a miR-151-5p inhibitor and a miR-151-5p antagonist. In one embodiment, the inhibitor of the present invention is designed to have a nucleotide sequence as shown in SEQ ID No. 4: 5'-ACUAGACUGUGAGCUCCUCGA-3'.

[0064] The present invention also provides a reagent for promoting follicle development, including a reagent for inhibiting miR-151-5p expression and / or promoting PGAM1 Expression reagents.

[0065] The present invention PGAM1 It can promote cell proliferation and regulate the cell cycle of ovarian granulosa cells, such as interfering with PGAM1 The proportion of cells in the late G1 phase increased significantly, the proportion of cells in the S phase decreased significantly, and the proportion of cells in the G2 phase did not change significantly.

[0066] In one embodiment of the present invention, three si-PGAM1 interferences are designed. PGAM1expression, wherein the nucleotide sequence of the forward chain of si-PGAM1-1 is shown in SEQ ID No.5: 5'-CCUACAAGCUGGUGCUGAUTT-3', and the nucleotide sequence of the reverse chain is shown in SEQ ID No.6: 5'-AUCAGCACCAGCUUGUAGGTT-3'; the nucleotide sequence of the forward chain of si-PGAM1-2 is shown in SEQ ID No.7: 5'-GCUUCACCUCAGUGCAGAATT-3', and the nucleotide sequence of the reverse chain is shown in SEQ ID No.8: 5'-UUCUGCACUGAGGUGAAGCTT-3'; the nucleotide sequence of the forward chain of si-PGAM1-3 is shown in SEQ ID No.9: 5'-GGUACGCAGACCUCACUGATT-3', and the nucleotide sequence of the reverse chain is shown in SEQ ID No.10: 5'-UCAGUGAGGUCUGCGUACCTT-3'.

[0067] To further illustrate the present invention, the application of miR-151-5p provided by the present invention as a target in the preparation of products for regulating follicular development is described in detail below in conjunction with the examples, but they should not be understood as limiting the scope of protection of the present invention.

[0068] The room temperature referred to in the present invention refers to 25°C.

[0069] In the present invention, unless otherwise specified, the materials and methods used can be conventionally obtained from the art:

[0070] 1. Isolation and Culture of Goat Ovarian Granulosa Cells

[0071] Fifteen female goats of similar weight, good health, and parity of two or more were selected from Leizhou goats. All Leizhou goats were estrus synchronized. Ovarian tissue was quickly isolated after slaughter and then soaked in 75% alcohol for 10 seconds, followed by another 10 seconds in saline containing 2% double-antibody solution. After soaking, the ovarian tissue was stored in saline containing 2% double-antibody solution at 37°C and transported to the laboratory as soon as possible for ovarian granulosa cell isolation.

[0072] After returning to the laboratory, the ovaries were first disinfected with 75% alcohol. Goat ovaries were then placed in DMEM / F12 medium supplemented with 2% double-antibody. The follicles were punctured using a 1 mL sterile syringe, and 0.5 mL of culture medium was pipetted into the follicular antrum to release the ovarian granulosa cells into the cell culture medium. Larger tissue fragments were filtered through a 70 μm cell sieve. After filtration, the cell culture medium was transferred to a 15 mL centrifuge tube and centrifuged at 1000 rpm for 10 minutes. The goat ovary granulosa cells were then resuspended in 10 mL of complete culture medium (90% DMEM / F12 + 10% FBS + 2% double-antibody) and cultured in a 10 cm dish in a 37°C, 5% CO2 incubator for 24 hours. After 24 hours, unattached cells were discarded and replaced with fresh complete culture medium. The cell culture medium was then changed every 48 hours. Cells were passaged and cryopreserved when the cells reached approximately 80% confluence.

[0073] 2. Cell transfection

[0074] When the cell density reached 50%-60%, transfection was performed using the Invitrogen™ Lipofectamine 3000 transfection kit.

[0075] 3. Cell viability and proliferation assay

[0076] Cell viability was assessed using CCK-8. The assay steps were as follows: Well-grown goat ovary granulosa cells were seeded into a 96-well plate, and 100 μL of cell suspension was added to each well. The validation test was repeated three times. PBS was placed around the well containing the cell suspension to prevent evaporation of the solution in the wells to be tested. The cells were then incubated in a 37°C, 5% CO2 incubator for 2–4 hours. Subsequent treatments were performed after the cells attached to the plate. Cell proliferation activity was assessed using CCK-8 reagent. 10 μL of CCK-8 reagent was added to each well and the cells were incubated in the incubator for an additional 2 hours. At various time points (24, 48, and 72 hours), absorbance at 450 nm was measured using a microplate reader to assess cell viability.

[0077] Cell proliferation was detected using the EdU reagent, using the RiboBio Cell-Light EdU Apollo 567 In Vitro Kit. After adding 100 μL of 50 μM EdU to each well, the cells were incubated in an incubator for 2 h. The cells were then washed twice with PBS and fixed with 4% paraformaldehyde for 30 min. Remaining aldehyde groups were neutralized with 50 μL of 2 mg / mL glycine, followed by permeabilization of the cell membrane with 100 μL of 0.5% Triton X-100 in PBS. 100 μL of Apollo solution was then added, and the cells were incubated at room temperature in the dark for 30 min. The cells were then washed with PBS and stained with Hoechst 33342 for 30 min at room temperature in the dark. After incubation, fluorescence was observed using a fluorescence microscope, and the number of nuclei and EdU-stained cells was analyzed using ImageJ software. Calculation formula: cell proliferation rate (%) = number of EdU-stained cells / Hoechst33342×100%.

[0078] 4. Flow cytometry

[0079] Goat ovarian granulosa cells were seeded in 6-well plates and approximately 5×10 cells were collected 48 h after transfection by trypsin digestion. 5 Wash the cells with PBS. Resuspend the cells in 0.3 mL of PBS, then add 1.2 mL of -20°C anhydrous ethanol and place in a -20°C freezer to fix overnight. Wash the cells with PBS and let them rest at room temperature for 15 minutes. Add 100 μL of RNase A Reagent and incubate in a 37°C water bath for 30 minutes. Add 400 mL of PI Reagent (50 μL / mL) and incubate at 2-8°C in the dark for 30 minutes. Red fluorescence at an excitation wavelength of 488 nm was then recorded by flow cytometry.

[0080] 5. Enzyme-linked immunosorbent assay (ELISA)

[0081] Goat ovarian granulosa cells were seeded in 6-well plates. Cell supernatants were collected 48 hours after transfection and assayed for estradiol (E2) and progesterone (P4) secretion levels using ELISA kits. The absorbance of 50 μL of cell supernatant at 450 nm was measured using a microplate reader according to the kit instructions. Linear regression analysis was performed on the standard curve, and the corresponding sample concentrations were calculated. The average coefficient of variation between batches was less than 15%, and the kit sensitivity was 1 pmol / mL.

[0082] 6. Total RNA extraction, reverse transcription and fluorescence quantitative PCR

[0083] Total RNA was extracted and purified according to the instructions of Invitrogen Trizol reagent. The concentration and purity of the extracted RNA were detected using an ultra-micro spectrophotometer. The ratio of 260 nm to 280 nm for all samples was greater than 1.8 and less than 2.0. The miRNA was reverse transcribed using the miRNA cDNA first-strand synthesis premix (stem-loop method) from Aikerui, and the reverse transcription primers were designed using miRNA Desigen V1.10 software. The reverse transcription of mRNA was performed using PrimeScript from Takara. TM RT reagent Kit. Fluorescence quantitative PCR was performed using the reverse transcription product (cDNA) as a template. The relative expression level of the gene was determined by 2 -ΔΔCt Methods: U6 was used as an internal reference for miRNA quantification, and GAPDH was used as an internal reference for mRNA quantification. P values ​​were calculated using a t-test; P < 0.05 and P < 0.01 indicated significant differences. Primers were designed using NCBI and synthesized by Sangon Biotech Co., Ltd.

[0084] 20 μL reaction system: 2×ChamQ SYBR qPCR Master Mix 10 μL, upstream primer F (10 μM) 0.4 μL, downstream primer R (10 μM) 0.4 μL, cDNA 1 μL, ddH2O 8.2 μL.

[0085] The reaction program was as follows: initial denaturation at 95°C for 30 s; cycling reaction at 95°C for 10 s, 60°C for 30 s, for 40 cycles; and melting curve analysis at 95°C for 15 s, 60°C for 60 s, and 95°C for 15 s.

[0086] The primer sequences are as follows:

[0087] PCNA-F (SEQ ID No. 11):GAACCTCACCAGCATGTCCA;

[0088] PCNA-R (SEQ ID No. 12): TGCCAAGGTGTCCGCATTAT;

[0089] CCND1-F (SEQ ID No. 13): CACCTGTATGTTCGTGGCCT;

[0090] CCND1-R (SEQ ID No. 14):TGAACTTCACGTCTGTGGCA;

[0091] CDK4-F(SEQ ID No.15):GAGCATCCCAATGTTGTCAGG;

[0092] CDK4-R(SEQ ID No.16):ACTGGCGCATCAGATCCTTT;

[0093] CDK6-F(SEQ ID No.17):GACCAGCAGTATGAGTGCGT;

[0094] CDK6-R(SEQ ID No.18):CACGTCAAACAACCTGACCAC;

[0095] P53-F(SEQ ID No.19):GGTCTCCGGGGTCATCTAGC;

[0096] P53-R(SEQ ID No.20):GGAGAGCTCGGAGGACAGAAG;

[0097] STAR-F(SEQ ID No.21):CATTGACCTCAAGGGATGGCT;

[0098] STAR-R(SEQ ID No.22):CAACACCTGGCTTCAAGAGC;

[0099] CYP11A1-F(SEQ ID No.23):GCTGCGGAAGGAGGTTCTGAATG;

[0100] CYP11A1-R(SEQ ID No.24):GCACCAGTGTCTTGGCAGGAATC;

[0101] 3β-HSD-F(SEQ ID No.25):TCTGCCTGTTGGTGGAGGAGAAG;

[0102] 3β-HSD-R(SEQ ID No.26):GATGACAGAAGCGGTGTGGATGAC;

[0103] GAPDH-F(SEQ ID No.27):GTTTGTGATGGGCGTGAACC;

[0104] GAPDH-R(SEQ ID No.28):GCGTGGACAGTGGTCATAAGT;

[0105] U6-F(SEQ ID No.29):GTGCTCGCTTCGGCAGCACAT;

[0106] U6-R(SEQ ID No.30):ATCCAGTGCAGGGTCCGAGG;

[0107] miR-151-5p-F(SEQ ID No.31):CGCGTCGAGGAGCTCACAG;

[0108] miR-151-5p-R(SEQ ID No.32):AGTGCAGGGTCCGAGGTATT;

[0109] PLAC8-F(SEQ ID No.33):ACCTCAAAACTCCAACTGGCA;

[0110] PLAC8-R(SEQ ID No.34):AAATGTGCCGCAGAGACAGAC;

[0111] SERPINH1-F(SEQ ID No.35):CATGTTCTTCAAGCCGCACTG;

[0112] SERPINH1-R(SEQ ID No.36):CATGGTGACACCCACGGTAT;

[0113] LAP3-F(SEQ ID No.37):CAGACGTCTTCATCAGACCCA;

[0114] LAP3-R(SEQ ID No.38):TCCCAACAAACACCAACGGA;

[0115] PPIB-F(SEQ ID No.39):GATGGCACTGGAGGTAAGAGC;

[0116] PPIB-R(SEQ ID No.40):ATGAAGAACTGGGAGCCGTT;

[0117] IQGAP1-F(SEQ ID No.41):AACAGAGTCCCGAGCATAGC;

[0118] IQGAP1-R(SEQ ID No.42):TGCTCAGCTGTTTCCACACT;

[0119] LMNB1-F (SEQ ID No. 43):GAATCCGAGGCCAGCAGTAG;

[0120] LMNB1-R (SEQ ID No. 44):TCCCATTGGTTGGTCCTGTTC;

[0121] SULF1-F (SEQ ID No. 45): ACCTGCAGCTGATGGAACTC;

[0122] SULF1-R (SEQ ID No. 46):TCCCATAACTGTCCTCTGTGC;

[0123] ASPM-F (SEQ ID No. 47):AAATCGAAGCTCGGGCGGTTA;

[0124] ASPM-R (SEQ ID No. 48):TTCTGCCGTTCTCCCACATC.

[0125] 7. Western blot

[0126] Protein extraction and denaturation: After washing with PBS, the cell samples were added with 200 μL of RIPA protein lysis buffer, mixed thoroughly, and lysed on ice for 10 min. The lysates were collected and centrifuged at 13,000 rpm for 15 min at 4°C. The supernatant was collected and added with 4× protein loading buffer. The samples were then denatured in a metal bath at 100°C for 10 min. The denatured protein samples were stored in a -80°C refrigerator for later use.

[0127] Electrophoresis: Assemble the electrophoresis rack, add electrophoresis solution, add 5-10 μL of protein sample and Maker to each well for electrophoresis. The electrophoresis conditions are 120 V, 45 min, and stop electrophoresis when bromophenol blue reaches 0.5 cm from the bottom of the gel.

[0128] Transfer and blocking: Pre-soak the transfer cassette in transfer buffer. Place the transfer cassette in the following order: positive electrode, cellulose pad, filter paper, PVDF membrane, gel, filter paper, cellulose pad, and negative electrode. The PVDF membrane requires ethanol activation. Transfer conditions are 0.4 A for 70 minutes. After transfer, remove the PVDF membrane and place it in 5% skim milk powder or 5% BSA solution. Decolorize and block on a shaker at room temperature for 60 minutes.

[0129] Antibody incubation: Discard the blocking solution and wash the membrane three times with TBST (5 min each). Then, add the diluted primary antibody and incubate overnight at 4°C. The next day, remove the primary antibody and wash the membrane five times with TBST (5 min each). Then, add the diluted secondary antibody and incubate at room temperature for 60 min. Wash the membrane five times with TBST (5 min each).

[0130] Chemiluminescence detection and gel image analysis: Use ELC luminescent solution for treatment, then place the PVDF membrane into a luminescence colorimeter for chemical exposure and imaging, and finally use ImageJ software to analyze the grayscale value of the protein bands.

[0131] 8. Plasmid construction and miRNA and siRNA design and synthesis

[0132] Primers were designed based on the CDS region of the goat PGAM1 gene provided by NCBI. Homologous arms and restriction sites were added upstream and downstream, respectively. Reverse transcribed cDNA was used as a template for PCR amplification. The product was recovered by gel recovery and homologous recombination was performed with the linearized lentiviral vector (pCDH) by homologous recombination. The ligation product was transformed with DH5α and then spread on LB plates containing Amp. The next day, a single clone was picked and expanded, and the culture solution was PCR-treated and sent to Sangon Biotechnology Co., Ltd. for sequencing. After sequencing was confirmed, the culture was expanded and shaken to extract the plasmid. About 200 bp before and after the PGAM1 3'UTR sequence (wild-type and mutant fragments) were cloned into the pmirGLO-Report vector by homologous recombination to construct the pmirGLO-PGAM1-WT and pmirGLO-PGAM1-MUT vectors siRNA-PGAM1, miR-151-5p mimics, inhibitors, agomir-miR-151-5p, antagomir-miR-151-5p and their corresponding negative controls were designed and synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd.

[0133] 9. Dual luciferase assay

[0134] HEK293T cells were cultured in DMEM and 10% FBS for the validation of miRNA targets. The cells were seeded in 24-well plates and co-transfected with 200 ng of pmirGLO- PGAM1 -WT and pmirGLO- PGAM1 -MUT and 100 μM miR-151-5p mimics or mimics NC were transfected. 48 hours after transfection, cells were harvested and dual-luciferase fluorescence activity was measured using the Novozymes DualLuciferase Reporter Assay Kit. Binding sites were predicted using RNAhybrid online software.

[0135] 10. Transcriptome Sequencing and Analysis

[0136] Goat ovarian granulosa cells were transfected with miR-151-5p mimics and mimics NC, respectively. After 48 hours, cells were harvested and RNA was extracted. The total amount and integrity of RNA were determined using an Agilent 2100 Bioanalyzer. Samples that met sequencing requirements were sent to Paisono Bio for paired-end sequencing using an Illumina sequencing platform. Samples were sequenced on the Illumina platform to generate image files and FASTQ raw data. Reads with an average quality score below Q20 were removed, and the filtered reads were aligned to the goat reference genome (Genome: Capra_hircus.ARS1.dna.toplevel.fa) using HISAT2 software. Transcript expression levels were calculated for each sample, and mRNA was normalized to FPKM. Differential expression analysis of genes was performed using Deseq2, with screening criteria of expression fold difference (|log2FoldChange|) > 1 and a significant P-value < 0.05. Gene ontology enrichment analysis was performed using top GO, and significantly enriched GO terms were analyzed using the hypergeometric distribution method (the standard for significant enrichment was P < 0.05). KEGG pathway enrichment analysis was performed using Cluster Profiler software (the standard for significant enrichment was P < 0.05). Based on the results of GO and KEGG enrichment analysis and their biological significance, target genes were selected for subsequent research.

[0137] mimics NC forward strand (SEQ ID No. 49): 5′-UUGUACUACACAAAAGUACUG-3′;

[0138] mimics NC reverse strand (SEQ ID No. 50): 5'-GUACUUUUGUGUAGUACAAUU-3'.

[0139] 11. Animal Testing

[0140] Six 7-week-old SPF-grade C57BL / 6J mice weighing 22±2 g were selected and randomly divided into four groups after one week of adaptive feeding. After the mice were anesthetized with avertin, the skin and muscles of the back were cut open, and the ovaries were carefully pulled out. Under a microscope, intra-ovarian injections were performed. The negative control was injected into the left ovary, and agomir-miR-151-5p (sequences same as SEQ ID No. 2 and SEQ ID No. 3) or antagomir-miR-151-5p (sequences same as SEQ ID No. 4) was injected into the right ovary. 2 μL agomir-miR-151-5p or antagomir-miR-151-5p was injected into each ovary at a concentration of 80×10 -12 M (160 pmol). After injection, mice in each treatment group were housed individually. On the ninth day after injection, the ovaries of the mice were collected under a sterile environment and fixed in 4% paraformaldehyde. The ovaries were then sent to Wuhan Sewell Biotechnology Co., Ltd. for HE staining.

[0141] 12. Statistical analysis

[0142] GraphPad Prism 8.0.2 was used to analyze data. Student's t-test was used for comparisons between two groups, and one-way analysis of variance (ANOVA) was used for comparisons between multiple groups. All data are presented as mean ± standard deviation (mean ± SD). P < 0.05 (*) and P < 0.01 (**) were considered statistically significant, while P > 0.05 (ns) was not considered statistically significant.

[0143] Example 1 Verification of miR-151-5p expression, overexpression, and interference efficiency in goat follicles

[0144] Transcriptome sequencing data showed that miR-151-5p was differentially expressed in large and small follicles, and RT-qPCR was used to verify the relative expression of miR-151-5p in large and small follicles. Figure 1 As shown, miR-151-5p was significantly upregulated in large follicles (P < 0.01) ( Figure 1 (A in the middle), which is consistent with the sequencing results, indicating that it may play a role in follicular development. After miR-151-5p was transfected into granulosa cells, the relative expression of miR-151-5p was detected. The results showed that compared with the mimicNC transfection group, the expression of miR-151-5p in the mimics transfection group was significantly upregulated (P < 0.01) ( Figure 1Middle B), compared with the inhibitor NC transfection group, the miR-151-5p expression level in the miR-151-5p mimics transfection group was significantly downregulated (P<0.01) ( Figure 1 (C) This indicates that both miR-151-5p mimics and miR-151-5p inhibitor achieved the expected effects and are suitable for subsequent experiments.

[0145] Example 2 Effect of miR-151-5p on the proliferation of goat ovarian granulosa cells

[0146] 2.1 Effect of miR-151-5p on the proliferation activity of goat ovarian granulosa cells detected by CCK-8

[0147] The miR-151-5p mimics and inhibitors were transfected into goat ovarian granulosa cells, and CCK-8 assay was performed at 24 h, 48 h, and 72 h after transfection. Figure 2 As shown in Figure 3, there was no significant difference in cell proliferation activity between the miR-151-5p overexpression group and the control group at 24 h (P>0.05), but the difference in cell proliferation activity between the miR-151-5p overexpression group and the control group was significantly reduced at 48 h and 72 h (P<0.01). Figure 2 Middle A), there was no significant difference in cell proliferation activity between the miR-151-5p interference group and the control group at 24 h (P>0.05), but the difference in cell proliferation activity between the miR-151-5p interference group and the control group was significantly reduced at 48 h and 72 h (P<0.01) ( Figure 2 Middle B). The results indicate that miR-151-5p can inhibit cell proliferation.

[0148] 2.2 EdU detection of the effect of miR-151-5p on the proliferation activity of goat ovarian granulosa cells

[0149] Goat ovarian granulosa cells were transfected with miR-151-5p mimics and inhibitors, and the cell proliferation rate was calculated 48 hours after transfection. Figure 3 As shown in the results, compared with the mimics NC group, the cell proliferation ratio in the miR-151-5p mimics group was significantly decreased (P < 0.01). Compared with the inhibitor NC group, the cell proliferation ratio in the miR-151-5p inhibitor group was significantly increased (P < 0.01), which was consistent with the CCK-8 results, indicating that miR-151-5p can inhibit cell proliferation.

[0150] Example 3 Effect of miR-151-5p on the cell cycle of goat ovarian granulosa cells

[0151] After transfection of miR-151-5p mimics and inhibitor into goat ovarian granulosa cells, cells were harvested 48 hours later and analyzed by flow cytometry. Figure 4 As shown in Figure 3, overexpression of miR-151-5p significantly increased the proportion of cells in the G1 phase (P < 0.01), significantly decreased the proportion of cells in the S phase (P < 0.01), and showed no significant change in the proportion of cells in the G2 phase (P > 0.05). Figure 4 Middle A), after inhibition of miR-151-5p, the proportion of cells in the G1 phase was significantly decreased (P < 0.01), the proportion of cells in the S phase was significantly increased (P < 0.01), and the proportion of cells in the G2 phase did not change significantly (P > 0.05) ( Figure 4 Middle B) The results indicate that miR-151-5p prevents cells from progressing from G1 phase to S phase.

[0152] Example 4 Effect of miR-151-5p on genes related to proliferation of goat ovarian granulosa cells

[0153] RT-qPCR detection showed that after transfection of miR-151-5p mimics in goat ovarian granulosa cells, the mimics group had a significantly higher expression of miR-151-5p than the group transfected with mimics NC. PCNA 、 CDK4 and CCND1 The mRNA expression level of P53 The mRNA expression level of CDK6 The difference was not significant (P>0.05) ( Figure 5 Middle A).

[0154] After transfection of miR-151-5p inhibitor in goat ovarian granulosa cells, the inhibitor group showed a significantly higher expression of miR-151-5p than the inhibitor NC group. PCNA 、 CDK6 and CCND1 The mRNA expression level of P53 The expression level of CDK4 There was no significant difference (P>0.05) ( Figure 5 Middle B), indicating that miR-151-5p can inhibit cell proliferation.

[0155] Western Blot analysis showed that the levels of cell proliferation-related proteins changed after transfection of miR-151-5p mimics and inhibitor in goat ovarian granulosa cells. Figure 6As shown, compared with the mimics NC transfection group, the expression levels of CCND1, CDK6, RB and p-RB proteins related to proliferation and cell cycle in the miR-151-5p mimics group were significantly decreased (P < 0.01), while the expression level of PCNA protein was not significantly different (P > 0.05) ( Figure 6 Compared with the inhibitorNC transfection group, the expression levels of PCNA and RB proteins related to cell proliferation genes in the miR-151-5p mimics transfection group were significantly increased (P < 0.05), while the expression levels of p-RB and CCND1 proteins were not significantly different (P > 0.05). Figure 6 CD), indicating that miR-151-5p can inhibit the expression of key proteins in the proliferation of ovarian granulosa cells.

[0156] Example 5 Effect of miRNA-151-5p on steroid hormone secretion in goat ovarian granulosa cells

[0157] The results of ELISA detection of goat ovarian granulosa cells transfected with miR-151-5p mimics and inhibitors are as follows Figure 7 As shown in the results, overexpression of miR-151-5p significantly increased the secretion levels of estrogen (E2) and progesterone (P4) (P < 0.01), while interference with miR-151-5p significantly decreased the secretion levels of E2 and P4 (P < 0.05), indicating that miR-151-5p can promote the secretion of steroid hormones in goat ovarian granulosa cells.

[0158] RT-qPCR detection showed that after transfection of miR-151-5p mimics in goat ovarian granulosa cells, the mimics group was significantly associated with steroid hormone secretion compared with the mimics NC group. STAR 、 CYP11A1 and HSD3B1 The gene expression levels were significantly increased (P<0.01) ( Figure 8 Middle A), after interference with miR-151-5p STAR 、 CYP11A1 and HSD3B1 (P<0.05)The gene expression level was significantly decreased( Figure 8 Middle B). This indicates that miR-151-5p can promote the secretion of steroid hormones in goat ovarian granulosa cells.

[0159] Western Blot analysis showed that the expression of CYP11A1 and CYP19A1, key proteins related to steroid hormone secretion, increased significantly in the mimics group compared with the mimics NC group (P < 0.05). Figure 9 Compared with the inhibitor NC group, the expression of CYP11A1 protein in the inhibitor group was significantly downregulated (P<0.05) ( Figure 9 These results indicate that miR-151-5p can promote the expression of key proteins in steroid hormone secretion in ovarian granulosa cells.

[0160] Example 6 Transcriptome sequencing analysis of the regulatory effect of miR-151-5p on gene expression in goat ovarian granulosa cells

[0161] 6.1 Quality Testing of RNA-Seq Sequencing Data

[0162] Goat ovarian granulosa cells were transfected with miR-151-5p and mimics NC. RNA was collected 48 hours later for transcriptome sequencing. Before further analysis, eight independent cDNA libraries were constructed from RNA from goat ovarian granulosa cells in the miR-151-5p overexpression group (mimics) and the control group (NC). The sequencing data are summarized in Table 1. A total of 410,409,100 raw sequence reads were generated from the eight sequencing libraries, of which 404,023,542 high-quality reads passed quality control and were available for subsequent analysis. Base calls exceeding 99.9% for each sample accounted for 96.16–96.71% of the total. High-quality reads were aligned to the reference genome with an alignment rate exceeding 98.56%. 3.92–4.61% of high-quality reads aligned to multiple positions, and 95.39–96.08% aligned to a unique position. These data demonstrate high-quality sequencing results that fully meet the requirements for subsequent analysis.

[0163] Table 1 Overview of RNA sequencing of goat ovary granulosa cells

[0164]

[0165] Note: mimics indicates the miR-151-5p overexpression group, and NC indicates the control group; Q30 indicates the proportion of bases with a base recognition accuracy of more than 99.9%.

[0166] 6.2 Differential gene expression analysis

[0167] The study used Deseq2 to perform differential gene expression analysis. Based on the screening criteria of |log2 Fold Change|>1 and P value <0.05, differentially expressed genes (DEGs) between the mimics group and the NC group were screened, with the NC group serving as the control group. A total of 16,848 mRNAs were identified in the mimics group and the NC group, of which 1,350 were differentially expressed, of which 907 were upregulated and 443 were downregulated ( Figure 10 The top five genes down-regulated were SET 、 SAE1 、 RRM2 、 PGAM1 and MCM7. Cluster analysis results showed that the gene expression levels and patterns of the four samples in the mimics group were similar, and the expression levels and patterns of the four samples in the NC group were similar ( Figure 10 Middle B).

[0168] 6.3 Functional enrichment analysis of differentially expressed genes

[0169] GO and KEGG functional enrichment analysis was performed on the differentially expressed genes. GO functional enrichment analysis found that the differentially expressed genes were enriched in 9078 GO entries. The results are as follows Figure 11 As shown in center A, 1685 GO terms were significantly enriched (P < 0.05), including 1374 biological processes (BP), 101 cellular components (CC), and 210 molecular functions (MF). The four biological processes with the highest gene enrichment were cellular process, biological regulation, biological process regulation, and metabolic process. The two cellular components with the highest gene enrichment were cellular anatomical entities and protein-containing complexes. The four molecular functions with the highest gene enrichment were adhesion, catalytic activity, molecular function regulator, and transport activity.

[0170] KEGG enrichment analysis was performed on the differentially expressed genes, and the results were as follows Figure 11 As shown in Figure B, the differentially expressed genes were enriched in 311 pathways, of which 58 were significantly enriched KEGG signaling pathways (P < 0.05), including cell cycle, P53 signaling pathway, steroid biosynthesis, MAPK signaling pathway, PI3K-AKT signaling pathway, etc.

[0171] 6.4 Real-time fluorescence quantitative PCR verification

[0172] To validate the RNA-seq results, RT-qPCR analysis was performed on 8 differentially expressed mRNAs. Figure 12 As shown in the figure, the expression levels of the two genes showed the same trend, indicating that the sequencing results were reliable.

[0173] Example 7 Prediction and Verification of miR-151-5p Target Genes

[0174] RNAhybrid online software was used to predict the transcriptome data of goat ovarian granulosa cells after overexpression of miR-151-5p. Among the top five genes downregulated, PGAM1 The 3'UTR region of miR-151-5p has a target binding site with a binding free energy of -23.9 kcal / mol. The present invention constructed a dual-luciferase reporter vector containing wild-type and mutant miR-151-5p response elements, and then co-transfected the wild-type and mutant dual-luciferase reporter vectors containing miR-151-5p response elements with miR-151-5p into 293T cells. The results are as follows: Figure 13 As shown, the fluorescence activity of the group containing the wild-type miR-151-5p response element decreased significantly (P < 0.01), while the fluorescence activity of the group containing the mutant miR-151-5p response element had no effect (P > 0.05). PGAM1 There is a binding site between the 3' UTR region of miR-151-5p, indicating that PGAM1 It is the target gene of miR-151-5p.

[0175] After overexpression and interference of miR-151-5p in goat ovarian granulosa cells, RT-qPCR was used to detect PGAM1 Expression at the mRNA level. After overexpression of miR-151-5p, PGAM1 The mRNA levels and expression of Figure 14 Middle A), after interference with miR-151-5p PGAM1 The expression of mRNA levels was significantly upregulated (P<0.01) ( Figure 14 Middle B). Combined with dual luciferase assay, the results showed that miR-151-5p has a targeting relationship with PGAM1.

[0176] Example 8 PGAM1 Verification of siRNA interference efficiency

[0177] RT-qPCR analysis of goat ovarian granulosa cells transfected with interfering RNA PGAM1 The expression level of Figure 15 As shown, siRNA-1, siRNA-2 and siRNA-3 could significantly reduce PGAM1 The expression levels of α-amylase and α-amylase were significantly different (P<0.01). In summary, the three designed siRNAs all achieved the expected interference efficiency, among which siRNA-2 had the most obvious interference effect, so siRNA-2 was selected for the later PGAM1 Interference test.

[0178] Example 9 PGAM1 Effects on the proliferation of goat ovarian granulosa cells

[0179] 9.1 CCK-8 assay PGAM1 Effects on the proliferation activity of goat ovarian granulosa cells

[0180] Overexpression and interference in goat ovarian granulosa cells PGAM1 After that, CCK-8 was detected at 24 h, 48 h and 72 h. Figure 16 As shown, compared with the control group, overexpression and interference PGAM1 There was no significant difference in cell proliferation activity at 24 h (P>0.05). PGAM1 At 48 h and 72 h, the cell proliferation activity was significantly increased compared with the control group (P < 0.01). PGAM1 At 48 h and 72 h, the cell proliferation activity was significantly decreased compared with the control group (P < 0.01), indicating that PGAM1 Can promote cell proliferation.

[0181] 9.2 EdU detection PGAM1 Effects on the proliferation activity of goat ovarian granulosa cells

[0182] Overexpression and interference in goat ovarian granulosa cells using EdU detection PGAM1 The cell proliferation ratio after 48 hours. Figure 17 As shown in the figure, compared with the lentiviral plasmid transfection group and the si-NC transfection group, the PGAM1 interference group cells were significantly reduced (P < 0.01), which is consistent with the CCK-8 results. PGAM1 Can promote cell proliferation.

[0183] Example 10 PGAM1 Effects on the cell cycle of goat ovarian granulosa cells

[0184] Overexpression and interference in goat ovarian granulosa cells PGAM1 After 48 hours, the cells were collected and the cell cycle was detected by flow cytometry. Figure 18 As shown, compared with the si-NC transfection group, the interference PGAM1 The proportion of cells in the late G1 phase increased significantly (P < 0.01), the proportion of cells in the S phase decreased significantly (P < 0.01), and the proportion of cells in the G2 phase did not change significantly (P > 0.05). PGAM1 It can inhibit the cell cycle progression of ovarian granulosa cells from G1 phase to S phase.

[0185] Example 11 PGAM1Effects on proliferation-related genes of goat ovarian granulosa cells

[0186] RT-qPCR detection of transfection interference in goat ovarian granulosa cells PGAM1 After that, the result is as follows Figure 19 As shown, compared with the si-NC transfection group, the interference PGAM1 Group PCNA 、 CCND1 、 CDK4 and CDK6 The mRNA expression level was significantly decreased (P < 0.01). P53 The expression level was significantly increased (P<0.01). PGAM1 It can inhibit the expression of key genes for cell proliferation.

[0187] WB assay showed that after transfection of si-PGAM1 in goat ovarian granulosa cells, the protein expression levels of RB, PCNA, and CCND1 were significantly decreased (P < 0.01), and the protein expression level of CDK6 was significantly decreased (P < 0.05) compared with the si-NC transfection group. PGAM1 The protein expression level of PGAM1 was significantly decreased after treatment (P<0.05). PGAM1 After expression, the expression levels of cell proliferation-related proteins were significantly reduced ( Figure 20 The results show that interference PGAM1 It can inhibit the expression of key proteins in the process of cell proliferation.

[0188] Example 12 PGAM1 Effects on steroid hormone secretion in granulosa cells of goat ovaries

[0189] 12.1 ELISA PGAM1 Effects on steroid hormone secretion in granulosa cells of goat ovaries

[0190] Detection of goat ovarian granulosa cell transfection interference by ELISA PGAM1 The results showed that the levels of estrogen and progesterone in the cell supernatant were significantly decreased after the intervention. PGAM1 The secretion levels of estrogen (E2) and progesterone (P4) increased significantly after 6-8 weeks (P<0.01) ( Figure 21 AB), the results show that interference PGAM1 It can promote the secretion of steroid hormones in goat ovarian granulosa cells.

[0191] 12.2 PGAM1 Effects on genes related to steroid hormone secretion in ovarian granulosa cells

[0192] Detection of interference by RT-qPCR PGAM1 The results of gene expression related to hormone secretion were as follows Figure 22 As shown, STAR 、 CYP11A1 and 3β-HSD The gene expression levels of α, β, and β-actin genes were significantly increased (P < 0.05).

[0193] WB assay showed that after transfection of si-PGAM1 in goat ovarian granulosa cells, the protein expression levels of CYP11A1 and CYP19A1 were significantly upregulated compared with those in the si-NC transfection group (P < 0.05) ( Figure 23 The results show that interference PGAM1 It can inhibit the protein expression levels of key enzymes in the synthesis of steroid hormones.

[0194] Example 13 miR-151-5p regulates goat ovarian granulosa cells through the PI3K / AKT signaling pathway

[0195] MiR-151-5p mimics and inhibitors, as well as their corresponding control groups, were transfected into ovarian granulosa cells. Protein was collected 48 hours later to investigate whether miR-151-5p regulates PI3K / AKT. The results showed that there was no significant difference in the expression levels of PI3K and total AKT proteins between the miR-151-5p mimics transfection group and the mimics NC transfection group (P>0.05), while the protein expression level of p-AKT was significantly downregulated (P<0.01). Figure 24 AB), after transfection with miR-151-5 inhibitor, there was no significant difference in the expression levels of PI3K and total AKT proteins (P>0.05), while the protein expression level of p-AKT was significantly increased (P<0.01) ( Figure 24 These results suggest that miR-151-5p regulates the function of granulosa cells by regulating the phosphorylation status of AKT.

[0196] Example 14 PGAM1 Regulation of goat ovarian granulosa cells via PI3K / AKT signaling pathway

[0197] Si-PGAM1 and si-NC were transfected into ovarian granulosa cells, and the proteins were collected after 48 h. PGAM1 Whether it plays a regulatory role through PI3K / AKT. The results showed that compared with the si-NC transfection group, the PI3K protein expression level was significantly downregulated in the si-PGAM1 transfection group (P < 0.01), the total AKT protein expression level was not significantly different (P > 0.05), and the p-AKT protein expression level was significantly downregulated (P < 0.01) ( Figure 25 AB in the middle). Result description PGAM1It regulates the function of ovarian granulosa cells through the PI3K / AKT signaling pathway.

[0198] Example 15 Effect of miR-151-5p on mouse ovarian development

[0199] The miR-151-5p antagonist, agonist and their corresponding controls were injected into the mouse ovaries. The gene sequences of mouse and goat miR-151-5p were compared, and the results showed that the homology between the mouse miR-151-5p sequence and the goat miR-151-5p sequence was 100%. The ovaries of the treated mice were sliced ​​and stained with HE to observe their morphology and count the follicles at each stage. Compared with the control group, inhibiting the expression of miR-151-5p significantly increased the number of follicles (P < 0.01), and the number of primary follicles, secondary follicles, antral follicles and total follicles increased (P < 0.05) ( Figure 26 After overexpression of miR-151-5p, the number of follicles was significantly reduced (P < 0.05), and the number of early antral follicles and total follicles was significantly reduced (P < 0.05) ( Figure 26 CD), characterized by abnormal ovarian development.

[0200] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Use of miR-151-5p mimics in inhibiting the proliferation of goat ovarian granulosa cells or promoting the secretion of estrogen and / or progesterone by goat ovarian granulosa cells, wherein the use is in an in vitro environment; The nucleotide sequence of the forward chain of the miR-151-5p mimic is shown in SEQ ID No. 2, and the nucleotide sequence of the reverse chain is shown in SEQ ID No.

3.

2. Use of an agent that inhibits miR-151-5p expression in promoting proliferation of goat ovarian granulosa cells or inhibiting estrogen and / or progesterone secretion in goat ovarian granulosa cells, wherein the use is in an in vitro environment; The reagent for inhibiting the expression of miR-151-5p is the inhibitor of miR-151-5p shown in SEQ ID NO.4.