Primer, probe and kit for rapidly identifying male DNA and application of primer, probe and kit
By designing fluorescent RPA primer pairs F414 and R344 targeting human Y chromosome TSPY4, combined with fluorescence detection, the problem of rapid identification of male DNA on-site in forensic nucleic acid detection is solved, and simple and efficient detection results are achieved, and are suitable for forensic judicial identification and other fields.
Patent Information
- Application Number
- CN202510430319.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-08
- Publication Date
- 2025-07-04
AI Technical Summary
The existing forensic nucleic acid detection technology is difficult to achieve rapid on-site identification of male DNA, and requires professional equipment and complex operations, which cannot meet the needs of immediacy and on-site.
A primer and probe based on fluorescent RPA technology was developed to design RPA primer pairs F414 and R344 targeting the human Y chromosome-specific gene TSPY4, and combined with fluorescence detection, for isothermal nucleic acid amplification detection of male DNA, simplifying the operation process and achieving rapid identification.
It realizes male DNA testing without expensive equipment, simple operation, strong immediacy, short detection time and high sensitivity, and is suitable for forensic judicial identification, paternity identification and genetic research.
Smart Images

Figure CN120249459A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology and relates to an isothermal nucleic acid amplification detection technology for male DNA and its application in scenarios and fields such as forensic physical evidence and kinship identification that require gender discrimination or male-specific genes. Specifically, it relates to a primer, a probe, a kit for rapidly identifying male DNA and their applications. Background Art
[0002] Isothermal nucleic acid amplification technologies include various methods, such as LAMP (Loop-mediated Isothermal Amplification), RPA (Recombinase Polymerase Amplification), NASBA (Nucleic Acid Sequence-Based Amplification), etc. Because they do not require complex equipment, are easy to operate, and have rapid reactions, they are widely used in the development of on-site rapid detection methods. The LAMP technology amplifies DNA under isothermal conditions through specific primers, has high sensitivity, and is suitable for the detection of trace DNA in the forensic field. The RPA technology amplifies at low temperature and has a fast reaction speed, and is often used for emergency detection. CRISPR / Cas technologies, such as SHERLOCK (Specific High-sensitivity Enzymatic Reporter UnLOCKing) and DETECTR (DNA Endonuclease Targeted CRISPR Trans Reporter), combine the specificity of the CRISPR / Cas system and amplification technologies and can provide highly sensitive detection results in a short time, suitable for on-site applications. PCR (Polymerase Chain Reaction) technologies, including real-time quantitative PCR (qPCR, Quantitative PCR) and digital PCR (dPCR, Digital PCR), are also often used for nucleic acid detection and can provide highly accurate quantitative analysis. Gene Chip technology and Microfluidic Chip technology are suitable for large-scale screening and rapid detection of multiple gene markers. In addition, methods such as nanomaterial-assisted detection technologies and Colorimetric Methods also play important roles in improving detection sensitivity and simplifying operations. Although the applications of these isothermal nucleic acid amplification technologies in forensic physical evidence and forensic on-site inspections are still in the exploratory stage, they have shown certain potential and practical application prospects.
[0003] In contrast, the nucleic acid detection technologies commonly used in forensic medicine at present mainly include polymerase chain reaction (PCR), short tandem repeat (STR) analysis, DNA barcoding technology, etc. These technologies are relatively mature, but they rely on operators with certain professional qualities and require laboratory equipment, so they cannot meet the requirements of on-site and immediate sample detection. These technical disadvantages can be compensated by developing isothermal nucleic acid amplification technology.
[0004] Due to its amplification at low temperature, fast reaction speed, independence from equipment, portability and ease of operation, the RPA technology is particularly suitable for rapid or emergency on-site forensic detection, demonstrating its potential technical advantages in the handling of emergency cases. Male DNA detection is widely used in forensic judicial expertise, paternity testing, criminal investigation, genetic research and other fields. In forensic identification, the identity of male individuals can be accurately confirmed by detecting the Y-chromosome DNA unique to males. In criminal cases, the rapid detection of male DNA helps to extract DNA from on-site physical evidence (bloodstain or semen stain samples), helps narrow down the scope of suspects, and provides clues for solving cases in a timely manner. In addition, male DNA detection also has important applications in the identification of missing persons, the research of gender-related genetic diseases, and the verification of kinship in immigration visa applications. Therefore, developing an isothermal nucleic acid amplification detection technology for male DNA based on the RPA technology has technological leadership.
[0005] The characteristic sequences of male DNA mainly refer to the genes or regions located on the human Y chromosome, including mainly SRY (Sex-determining Region Y; Yp11.2), DYS series of gene short tandem repeats (Y-STR), AZF gene, Amelogenin Y allele (Azoospermia Factor), MEL1 (Mitochondrial Endogenous Loci1), and TSPY (Testis-Specific Protein Y; Yp11.2). In the published literature (Kubo S, Niimi H, Kitajima I. Rapid and direct detection of male DNA by recombinase polymerase amplification assay[J]. Forensic Science International: Genetics, 2022, 59:102704.), the researchers designed RPA detection primers and optimized the technology for a repeat sequence alphoid repeat sequence (GenBank accession number: AF522078; Yq74) located in the centromeric region of the human Y chromosome. However, the selection of this gene region is not a typical characteristic sequence, which limits its use in forensic field practice. Summary of the Invention
[0006] To solve the problem of the need for rapid identification of male DNA at the scene, the purpose of the present invention is to provide a primer, probe, and kit for isothermal nucleic acid amplification detection of male DNA at the scene based on fluorescence RPA technology. The present invention can rapidly, accurately, sensitively, and specifically identify and detect male DNA.
[0007] The purpose of the present invention is achieved through the following technical solutions:
[0008] In the first aspect of the present invention, there is provided an RPA primer for detecting male DNA, which is F414 and R344 with the nucleotide sequences shown as follows.
[0009] F414: CTGTCTCTGTAGAATACAGGGCTTCTCATTCCAC (SEQ ID NO.1),
[0010] R344: AACACATGGGGTCATTCCTCATGTTTCCCAGTGA (SEQ ID NO.2).
[0011] The primer pair described above is designed based on a partial sequence targeting the human Y-chromosome specific gene TSPY4 (testis specific protein Y-linked 4; GeneID: 728395; NC_000024.10), and the sequence is as follows: ATCACAGGTGACAGGTGGCTCCCAGGATGGGTAGTGGAAGGAAGATGGTGGGTGGATCATTGCCAACGGGATCCAGCCCCCTTCCCACAAAAACTC CTGTCTCTGTAGAATACAGGGCTTCTCATTCCAC TCCAATTGAGTGGTATCCGGATTATGAAGTGGAGGCCTATCGCCGCAGACACCACAACAGCAGCCTTAACTTCTTCAACTGGTTCTCTGACCACAACTTCGCAGGATCTAACAAGATTGCTGAGGTGAGTCC TCACTGGGAAACATGAGGAATGACCCCATGTGTT CCCAGCTGCTTGGGTCACCTTTCTGAGCCCTGATGAGGCCTTTCCCGATTGAGTCCC (SEQ ID NO: 3). Among them, the underlined sequences correspond to the above primers F414 and R344.
[0012] In the second aspect of the present invention, a composition for detecting male DNA is provided, which comprises the above RPA primers and probes. The probes are designed based on the amplified sequences of the above RPA primer pairs, and contain oligonucleotide sequences, fluorescent groups, quenching groups, THF (tetrahydrofuran) sites, and blocking groups. The fluorescent group on the probe is preferably dT-FAM. The quenching group on the probe can be any group sufficient to quench the corresponding fluorescent group. As a preference, dT-BHQ1 is used as the quenching group. The THF site on the probe can replace any base between the fluorescent group and the quenching group. The blocking group at the 3'-end of the probe can be any modified group capable of preventing the polymerase from synthesizing new bases. As a preference, the C3-Spacer group is used as the blocking group. Further preferably, the probe is: CTATCGCCGCAGACACCACAACAGCAGCC(dT-FAM)T(THF)AC(dT-BHQ1)TCTTCAACT GGTTC(C3-spacer).
[0013] In the third aspect of the present invention, a reagent for detecting male DNA is provided, which comprises the above RPA primers or the above RPA composition.
[0014] In the fourth aspect of the present invention, a kit for detecting male DNA is provided, which comprises the above RPA primers, the above composition or the above reagent.
[0015] In the fifth aspect of the present invention, there is provided the use of the above-mentioned RPA primers, compositions, reagents or kits in male DNA detection, and the detection includes on-site rapid identification.
[0016] In the sixth aspect of the present invention, there is provided an RPA method for detecting male DNA, which includes the following steps: adding a sample to be detected, the above-mentioned RPA primers or the above-mentioned composition into an RPA amplification reaction system for reaction, and analyzing the reaction product.
[0017] The conditions of the reaction are preferably 39 - 41 °C for 15 - 30 minutes.
[0018] In the method, it is preferred to use a fluorescence detection device to analyze the reaction product, and by detecting the fluorescence signal, a DNA detection result is obtained. The above-mentioned probe is a probe labeled with a fluorescent group, and the reaction product can be analyzed by detecting the increase in the fluorescence signal in the amplification reaction.
[0019] The present invention has the following advantages and beneficial effects compared with the prior art:
[0020] Compared with the existing PCR technology, the present invention does not require expensive detection equipment, has the characteristics of on-site and immediate detection, does not require a professional technical background, is simple to operate, and has a short detection time. Compared with the reported RPA detection methods for the Y chromosome, the present invention has stronger detection specificity and higher sensitivity.
[0021] Therefore, the present invention provides strong technical support for the immediate and rapid detection of male DNA (or human Y chromosome), and has a very broad application prospect in the fields of forensic judicial expertise, paternity testing, criminal investigation, and genetic research. Description of the Drawings
[0022] Figure 1 It is a diagram of the results of the first-round screening of RPA primers in Example 1. For the target sequence, 8 pairs of primers were designed from the upstream and downstream ends respectively, named F1 - F8 and R1 - R8. First, the upstream F1 primer was fixed, and the detection method of DNA recombinase polymerase amplification was performed to screen the downstream primer with the best amplification efficiency and amplification effect from R1 - R8 to form an optimal primer pair combination. The results showed that the F1 / R3 primer pair had the highest amplification efficiency ( Figure 1 A). Then, the downstream primer R3 was fixed, and F1 - F8 was screened according to the above process. The results showed that the F4 / R3 primer pair had the highest amplification efficiency ( Figure 1 B).
[0023] Figure 2It is the diagram of the second-round screening results of RPA primers in Example 1. In combination with the probe, the fluorescence method was used to compare the amplification efficiencies among different primer combinations. For the target sequence, based on the first-round screening and while retaining F4 and R3, 7 pairs of primers were newly designed from both the upstream and downstream ends through (single-base) sequence walking, named F41-F44, F45-F47, R31-R34, and R35-R37 respectively. First, the upstream F4 primer was fixed, and the detection method of DNA recombinase polymerase amplification was performed to screen the downstream primers with the best amplification efficiency and amplification effect from R31-R34, R3, and R35-R37 to form the optimal primer pair combination. The results showed that the F4 / R34 primer pair had the highest amplification efficiency ( Figure 2 A). Then, the downstream primer R34 was fixed, and F41-F44, F4, and F45-F47 were screened according to the above process. The results showed that the F41 / R34 primer pair had the highest amplification efficiency ( Figure 2 B).
[0024] Figure 3 It is the diagram of the third-round screening results of RPA primers in Example 1. In combination with the probe, the fluorescence method was used to compare the amplification efficiencies among different primer combinations. For the target sequence, based on the second-round screening and while retaining F41 and R34, with the 5'-end position of the primers unchanged, the primers were shortened or extended by 1 bp, and 7 pairs of primers were newly designed from both the upstream and downstream ends, named F411, F412, F413-F417, R341, R342, R343-R347 respectively. First, the upstream F41 primer was fixed, and the detection method of DNA recombinase polymerase amplification was performed to screen the downstream primers with the best amplification efficiency and amplification effect from R341, R342, R34, and R343-R347 to form the optimal primer pair combination. The results showed that the F41 / R344 primer pair had the highest amplification efficiency ( Figure 3 A). Then, the downstream primer R344 was fixed, and F411, F412, F41, and F413-F417 were screened according to the above process. The results showed that the F414 / R344 primer pair had the highest amplification efficiency ( Figure 3 B).
[0025] Figure 4 It is the diagram of the screening results of primer concentrations in Example 2.
[0026] Figure 5 It is the diagram of the sensitivity test results in Example 3. The detected samples were plasmids containing the target TSPY4 sequence at different concentrations.
[0027] Figure 6 It is the diagram of the specificity test results in Example 4.
[0028] Figure 7 It is the diagram of the detection results of clinical samples in Example 5. Detailed implementation manners
[0029] The following examples are used to further illustrate the present invention, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.
[0030] Example 1 Screening of RPA primers targeting the human Y chromosome-specific gene TSPY4
[0031] I. First-round screening of RPA primers
[0032] 1. Design of the primary candidate primer set
[0033] Using the TSPY4 sequence as a template, upstream and downstream primer sets were designed with a fixed length of 32 bp, and each primer in the set was spaced 10 bp apart. The upstream primer set was F1-8, and the downstream primer set was R1-8 (see Table 1).
[0034] Table 1 Primary candidate primer set
[0035]
[0036] 2. Recombinase polymerase amplification of RPA
[0037] The primers in Table 1 were subjected to recombinase polymerase isothermal amplification using the TwistDx RPA-nfo kit. The total volume of the RPA reaction system was 50 μL: 2.1 μL of the upstream primer with a concentration of 10 μmol / L was added, 2.1 μL of the downstream primer was added, 1 μL of male DNA template (plasmid containing the target TSPY4 sequence) with a concentration of 20 fg / μL was added, 29.5 μL of RPA reaction buffer, 1.4 μL of 0.5 M Mg 2+ was added, and ddH2O was added to make up to 50 μL. The RPA amplification reaction program was: amplification at 39°C for 20 minutes.
[0038] First, the F1 primer was fixed and paired with the R1-R8 primers for pairwise amplification. After comparing the amplification efficiencies of these primer pairs, the best-amplifying primer among the R primers was fixed and paired with the F1-F8 primers for pairwise amplification, and the amplification effects were compared.
[0039] 3. Detection of the first-round RPA amplification efficiency
[0040] Since it was the first-round (primary) screening, in order to improve work efficiency and save costs, agarose gel electrophoresis was used. The RPA amplification products were recovered using a PCR product recovery kit, then electrophoresed using a 2% agarose gel, and finally stained with EB and observed and photographed under ultraviolet light. The results are as Figure 1 shown, and F4 / R3 is the primer pair with the highest amplification efficiency.
[0041] II. Second-round screening of RPA primers
[0042] 1. Probe design
[0043] Using the sequence between primers F4 and R3 as a template, probes were designed according to the principles of RPA fluorescent probe design. The specific sequences are shown in Table 2.
[0044] Table 2 Probe sequences
[0045]
[0046] 2. Design of the second-round screening primer sets
[0047] Based on the optimal primer pair F4 / R3, new upstream and downstream primer sets were obtained through single-base sequence walking. The specific sequences are shown in Table 3.
[0048] Table 3 Second-round screening primer sets
[0049]
[0050] 3. RPA recombinase polymerase amplification
[0051] The primers in Table 3 were used for recombinase polymerase isothermal amplification with the TwistDx RPA-nfo kit. The total volume of the RPA reaction system was 50 μL: 2.1 μL of the upstream primer with a concentration of 10 μmol / L was added, 2.1 μL of the downstream primer was added, 0.6 μL of the probe P1 with a concentration of 10 μmol / L was added, 1 μL of male DNA template (plasmid containing the target TSPY4 sequence) with a concentration of 2 fg / μL was added, 29.5 μL of RPA reaction buffer, 1.4 μL of 0.5 M Mg 2+ was added, and ddH2O was added to make up to 50 μL. The RPA reaction system was placed in a constant-temperature fluorescence detector and amplified at 39 °C for 20 minutes.
[0052] To implement the second-round primer screening, first fix the upstream F4 primer, and perform the detection method of DNA recombinase polymerase amplification to screen the downstream primers with the best amplification efficiency and amplification effect from R31 - R34, R3, and R35 - R37 to form the optimal primer pair combination. Among them, F4 / R3 is the best primer combination screened by agarose gel electrophoresis in the first-round screening, and they can serve as the reference group in this round of screening. Then fix the best amplification primer among the R primers, pair it with F41 - F44, F4, and F45 - F47 primers for pairwise amplification, and compare the amplification efficiency using fluorescence method.
[0053] 4. Detection of the second-round RPA amplification efficiency
[0054] The change of fluorescence signal was recorded in real time using a constant temperature fluorescence detector, and a curve was plotted. Subsequently, the starting time of each reaction signal and the strength of the signal were compared to determine the amplification efficiency. The results showed that when the upstream primer F4 was fixed, the F4 / R34 primer pair had the highest amplification efficiency ( Figure 2 A). Then, with the downstream primer R34 fixed, F41-F44, F4, and F45-F47 were screened according to the above procedure. The results showed that the F41 / R34 primer pair had the highest amplification efficiency ( Figure 2 B).
[0055] III. Third-round screening of RPA primers
[0056] Based on the optimal primer pair F41 / R34, while keeping the 5'-end position of the primer unchanged, the primer was shortened or extended by 1 bp to obtain a new upstream primer set and downstream primer set. The specific sequences are shown in Table 4.
[0057] Table 4 Primer sets for the third-round screening
[0058]
[0059]
[0060] Referring to the method in the second-round screening, the amplification efficiency of different primer pairs was detected, but the plasmid template concentration was adjusted to 0.2 fg / μL. The results ( Figure 3 ) showed that the F414 / R344 primer pair had the highest amplification efficiency.
[0061] Example 2 Screening of the optimal working concentration of the F414 / R344 primer pair
[0062] Recombinase polymerase isothermal amplification was performed using the TwistDx RPA-nfo kit. The total volume of the RPA reaction system was 50 μL: 2.1 μL of upstream primer F414 at a certain concentration, 2.1 μL of downstream primer R344, 0.6 μL of 10 μmol / L probe P1, 1 μL of the test sample, 29.5 μL of RPA reaction buffer, 1.4 μL of 0.5 M Mg 2+ was added, and ddH2O was added to make up to 50 μL. Among them, the final concentrations of the upstream and downstream primers were set to 300 nM, 400 nM, 500 nM, and 600 nM respectively; a male DNA template (plasmid containing the target TSPY4 sequence) was selected as the test sample, and the template concentration was set to 1 pg / μL. Water was selected as the negative control sample. The RPA reaction system was placed in a constant temperature fluorescence detector and amplified at 39°C for 20 minutes.
[0063] The change of fluorescence signal was recorded in real time using a constant temperature fluorescence detector. The results are shown in Figure 4, the optimal working concentration of the F414 / R344 primer pair is 500 nM.
[0064] Example 3 Sensitivity Test
[0065] I. A plasmid containing the target TSPY4 sequence is used as the test sample
[0066] Recombinase polymerase isothermal amplification is carried out using the TwistDx RPA-nfo kit. The total volume of the RPA reaction system is 50 μL: 2.5 μL of the 10 μmol / L upstream primer F414 is added, 2.5 μL of the downstream primer R344 is added, 0.6 μL of the 10 μmol / L probe P1 is added, 1 μL of the test sample, 29.5 μL of the RPA reaction buffer, and 1.4 μL of 0.5 M Mg 2+ is added, and ddH2O is made up to 50 μL. Among them, a male DNA template (a plasmid containing the target TSPY4 sequence) is selected as the test sample, and the concentration gradient of the test sample is set to 1.2×10 4 copies, 1.2×10 3 copies, 1.2×10 2 copies, 1.2×10 1 copies; water is selected as the negative control sample. The RPA reaction system is placed in a constant temperature fluorescence detector and amplified at 39°C for 20 minutes.
[0067] The constant temperature fluorescence detector is used to record the change of the fluorescence signal in real time. The results are shown in Figure 5 , and the detectable amount of the plasmid DNA template can be as low as 1.2×10 1 copies.
[0068] II. Male genomic DNA is used as the test sample
[0069] Referring to the above method, different concentrations of male genomic DNA are selected as the test sample, and the concentration gradient of the test sample is set to 50 ng / μL, 10 ng / μL, 1 ng / μL, 0.1 ng / μL, 0.01 ng / μL, 0.001 ng / μL, 0.0001 ng / μL. The results show that the detectable amount of male genomic DNA is as low as 0.001 ng / μL.
[0070] Example 4 Specificity Test
[0071] Recombinase polymerase isothermal amplification is carried out using the TwistDx RPA-nfo kit. The total volume of the RPA reaction system is 50 μL. Among them, 2.5 μL of the 10 μmol / L upstream primer F414 and 2.5 μL of the downstream primer R344 are added respectively, 0.6 μL of the 10 μmol / L probe P1 is added, 1 μL of the test sample, 29.5 μL of the RPA reaction buffer, and 0.5 M Mg 2+Add 1.4 μL and make up to 50 μL with ddH2O. Among them, the test samples are genomic DNA from humans and different animals, namely male DNA, female DNA, dog DNA, cat DNA, pig DNA, horse DNA, bovine DNA, and mouse DNA, and the sample concentration is 10 ng / μL. Place the RPA reaction system in a constant-temperature fluorescence detector and amplify at 39°C for 20 minutes.
[0072] Use a constant-temperature fluorescence detector to record the change of fluorescence signal in real time. The results are shown in Figure 6 , and only male DNA shows positive amplification.
[0073] Example 5 Detection of Clinical Samples
[0074] Use the TwistDx RPA-nfo kit for recombinase polymerase isothermal amplification. The total volume of the RPA reaction system is 50 μL. Among them, add 2.5 μL of the upstream primer F414 at 10 μmol / L, 2.5 μL of the downstream primer R344, 0.6 μL of the probe P1 at 10 μmol / L, 1 μL of the test sample, 29.5 μL of the RPA reaction buffer, and 1.4 μL of 0.5 M Mg 2+ Add 1.4 μL and make up to 50 μL with ddH2O. Among them, the test samples are 2 copies of male genomic DNA and 6 copies of female genomic DNA, and the DNA concentration is 10 ng / μL. Place the RPA reaction system in a constant-temperature fluorescence detector and amplify at 39°C for 20 minutes.
[0075] Use a constant-temperature fluorescence detector to record the change of fluorescence signal in real time. The results are shown in Figure 7 , and only 2 copies of male DNA show positive amplification, indicating that the present invention is applicable to the detection of real clinical or forensic samples.
[0076] The above examples are only used to help illustrate the present invention. The implementation modes of the present invention are not limited by the above examples. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.
Claims
1. An RPA primer pair for detecting male DNA, characterized in that: The primer pair is F414 and R344 with the nucleotide sequences as follows: F414: CTGTCTCTGTAGAATACAGGGCTTCTCATTCCAC, R344: AACACATGGGGTCATTCCTCATGTTTCCCAGTGA.
2. A composition for detecting male DNA, characterized in that: Comprising the RPA primer pair and probe according to claim 1; the probe is designed based on the amplification sequence of the RPA primer pair and contains an oligonucleotide sequence, a fluorophore, a quencher, a THF site, and a blocking group.
3. The composition for detecting male DNA according to claim 2, wherein The probe is: CTATCGCCGCAGACACCACAACAGCAGCC(dT-FAM)T(THF)AC(dT-BHQ1)TCTTCAACT GGTTC(C3-spacer).
4. A reagent for detecting male DNA, characterized in that: Comprising the RPA primer pair according to claim 1 or the composition according to claim 2 or 3.
5. A kit for detecting male DNA, characterized in that: Comprising the RPA primer pair according to claim 1, the composition according to claim 2 or 3, or the reagent according to claim 4.
6. Use of the RPA primer pair according to claim 1, the composition according to claim 2 or 3, the reagent according to claim 4, or the kit according to claim 5 in male DNA detection.
7. An RPA method for detecting male DNA, characterized in that, Comprising the following steps: adding the sample to be tested and the RPA primer pair according to claim 1 or the composition according to claim 2 or 3 into an RPA amplification reaction system for reaction, and analyzing the reaction product.
8. The RPA method for detecting male DNA according to claim 7, wherein: The conditions of the reaction are reaction at 39 - 41 °C for 15 - 30 minutes.
9. The RPA method for detecting male DNA according to claim 7, wherein: Analyzing the reaction product using a fluorescence detection device.
Citation Information
Patent Citations
Method for rapidly detecting body fluid spots based on RT-RPA-LFD technology
CN114672576A
Systems and methods to predict autism before onset of behavioral symptoms and / or to diagnose autism
US20180142298A1