Chronic heart failure diagnostic kit and detection method based on RBM25 gene expression level
By detecting the mRNA and protein levels of RBM25, using specific primers and antibodies, combined with optimized processes, high sensitivity and specific detection of chronic heart failure are achieved, solving the shortcomings of early detection and prognostic evaluation in the prior art, and providing a new tool for heart failure pathogenesis and individualized treatment.
Patent Information
- Application Number
- CN202510328846.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-19
- Publication Date
- 2025-07-04
AI Technical Summary
The existing chronic heart failure detection methods have insufficient sensitivity and specificity in early detection and prognostic evaluation. BNP, as a biomarker, is susceptible to factors such as age and renal function, and cardiac ultrasound examination is less sensitive to early myocardial injury.
Using a bimodal detection strategy based on RBM25 gene expression level, the detection index was calculated for myocardial injury status evaluation by detecting the mRNA and protein levels of RBM25, using specific primers and high affinity antibodies, combined with optimized sample processing and detection procedures.
It improves the sensitivity and specificity of chronic heart failure detection, provides new tools for early detection and prognostic evaluation, can detect heart failure earlier and reflect the degree of myocardial remodeling, providing a reference for individualized treatment.
Smart Images

Figure BDA0005319670740000241
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of kits, and particularly to a diagnostic kit for chronic heart failure and a detection method based on the expression level of the RBM25 gene. Background Art
[0002] Chronic heart failure is a common cardiovascular disease that seriously threatens human health. Its early detection and accurate assessment are of great significance for improving the prognosis of patients. Currently, the commonly used heart failure detection methods in clinical practice mainly include B-type natriuretic peptide (BNP) or N-terminal pro-brain natriuretic peptide (NT-proBNP) detection, echocardiography, etc. However, these methods still have certain limitations in early detection and prognosis assessment.
[0003] As a currently widely used heart failure biomarker, BNP has certain value in detection and prognosis assessment, but its specificity is insufficient and it is easily affected by factors such as age and renal function. Although echocardiography can directly reflect the changes in cardiac structure and function, its sensitivity to early myocardial injury is low and it is highly operator-dependent. Therefore, developing new, more sensitive and specific heart failure detection methods has important clinical significance.
[0004] In recent years, with the development of molecular biology techniques, researchers have begun to focus on the role of changes in gene expression levels in the occurrence and development of heart failure. Among them, the importance of members of the RNA-binding protein (RBPs) family in the regulation of cardiomyocyte function has been gradually recognized. As a member of the RBPs family, RBM25 has been confirmed to be involved in the regulation of multiple cellular processes, including alternative splicing, mRNA stability, and translation. However, the application potential of RBM25 in heart failure detection has not been fully explored. Summary of the Invention
[0005] Based on in-depth research on the role of RBM25 in the occurrence and development of heart failure, the present invention proposes a new method for detecting chronic heart failure. This method comprehensively assesses the state of myocardial injury by simultaneously detecting the mRNA and protein levels of RBM25. This dual-modal detection strategy not only improves the sensitivity and specificity of detection, but also provides a new tool for the early detection and prognosis assessment of heart failure.
[0006] The object of the present invention is to provide a diagnostic kit for chronic heart failure based on the expression level of the RBM25 gene, and the kit includes:
[0007] (1) An RNA detection module, comprising:
[0008] a) A set of RBM25-specific primers, wherein the forward primer sequence is SEQ ID NO.2 and the reverse primer sequence is SEQ ID NO.3;
[0009] b) GAPDH internal reference primer set;
[0010] c) RNA extraction kit;
[0011] d) Reverse transcription premix;
[0012] e) qPCR premix;
[0013] (2) Protein detection module, including:
[0014] a) Anti-RBM25 monoclonal antibody;
[0015] b) Biotin-labeled detection antibody;
[0016] c) Streptavidin-HRP;
[0017] d) TMB chromogenic solution;
[0018] e) RBM25 protein standard.
[0019] Specifically, the RBM25 specific primer set targets the conserved region of RBM25 mRNA, and the sequence of the conserved region is SEQ ID NO.1.
[0020] Specifically, the anti-RBM25 monoclonal antibody recognizes the C-terminal domain of RBM25 protein, and the amino acid sequence of the C-terminal domain is SEQ ID NO.4.
[0021] Specifically, the RNA extraction kit includes erythrocyte lysate, Trizol LS, chloroform and RNA washing buffer.
[0022] Specifically, the reverse transcription premix includes MMLV reverse transcriptase, 5×First-Strand Buffer, DTT, dNTP Mix, Random hexamers and RNase inhibitor.
[0023] Specifically, the qPCR premix includes 2×SYBR Green PCR Master Mix, ROX Reference Dye and Nuclease-free water.
[0024] The method for detecting chronic heart failure using the detection kit includes the following steps:
[0025] (1) Collect peripheral venous blood from the subject and isolate plasma and peripheral blood mononuclear cells (PBMC);
[0026] (2) Use the RNA detection module to detect the relative expression level of RBM25 mRNA in PBMC;
[0027] (3) Detect the concentration of RBM25 protein in plasma using a protein detection module;
[0028] (4) Calculate the detection index based on the relative expression level of RBM25 mRNA and the concentration of RBM25 protein.
[0029] Specifically, the calculation formula for the detection index is:
[0030] Detection index = 0.6 × (relative mRNA expression fold) + 0.4 × (protein concentration / 30 ng / mL).
[0031] Specifically, it further includes the following steps:
[0032] When the detection index ≥ 1.2, it is determined as positive for chronic heart failure;
[0033] When the detection index is between 1.0 - 1.2, it is recommended to retest after 2 weeks.
[0034] Specifically, it further includes a dynamic monitoring step:
[0035] Conduct a review 3 months after the first detection. If the detection index drops by < 30%, it indicates poor prognosis.
[0036] The core innovation points of the present invention are as follows: First, specific primer design targeting the conserved region of RBM25 is adopted, avoiding known common SNP sites and improving the accuracy of mRNA detection. Second, a monoclonal antibody against RBM25 with high affinity and specificity is developed to achieve precise quantification of RBM25 protein. Third, through optimized sample processing and detection procedures, the sensitivity and repeatability of detection are significantly improved. Finally, an innovative comprehensive detection algorithm based on mRNA and protein levels is proposed to achieve more accurate assessment of heart failure status.
[0037] From a molecular biology perspective, RBM25 binds to specific sequences of target mRNA through its RNA recognition motif (RRM), regulating the expression of multiple key genes in cardiomyocytes. During heart failure, the expression level of RBM25 changes significantly, and this change is not only reflected at the mRNA level but also in the abnormal accumulation or release at the protein level. The method of the present invention provides a molecular basis for the early detection of myocardial injury by capturing changes at these two levels simultaneously.
[0038] In addition, the present invention also reveals the potential role of RBM25 in the process of myocardial remodeling. The change in the expression level of RBM25 shows a strong correlation with the degree of myocardial fibrosis and the degree of left ventricular remodeling. This finding provides a new perspective for the in-depth understanding of the pathogenesis of heart failure. At the same time, the dynamic change in the expression pattern of RBM25 may also predict the patient's response to specific treatments, providing a new reference index for the formulation of individualized treatment plans.
[0039] Generally speaking, by integrating the latest progress in molecular biology, immunology and clinical medicine, the present invention has developed a highly sensitive and highly specific detection method for chronic heart failure. This method not only shows significant advantages in early detection and prognosis evaluation, but also provides new tools and ideas for the research on the pathogenesis of heart failure and individualized treatment. Compared with the prior art, the present invention shows obvious superiority in terms of detection accuracy, early prediction ability and clinical application value, and is expected to bring important breakthroughs to the prevention, detection and treatment of heart failure. Detailed implementation manners
[0040] Example 1
[0041] This example provides a detection kit and a detection method for chronic heart failure based on the expression level of the RBM25 gene. The kit includes an RNA detection module and a protein detection module, which can simultaneously detect the mRNA and protein levels of RBM25, realizing a dual-modal detection strategy.
[0042] The RBM25 gene and its conserved region:
[0043] The RBM25 gene (NCBI Gene ID: 58517) is located on human chromosome 14q24.3, with a full length of about 95 kb and contains 22 exons. The present invention selects the conserved region (NM_001102567.2) of RBM25 mRNA as the detection target, and the specific sequence is as follows:
[0044] 5'-CGATGCCTACGTGATCAAGAACCTGGTGAAGGTGGACGAGGACG GCTTCGTGGTGGTGCAGAACAAGAGATACGGGCAGCTTGCAGAGACGG TGGATTACATCAACAAGATGAAGACAGCCGTACCA-3' (SEQ ID NO.1)
[0045] This sequence is located at the junction of exons 9-10 of RBM25 mRNA, with a length of 120 bp and a GC content of about 55%, avoiding known common SNP sites.
[0046] First of all, the RNA detection module includes the following components:
[0047] (1) RBM25 specific primer set (2× freeze-dried powder):
[0048] Forward primer (SEQ ID NO.2): 5'-CGATGCCTACGTGATCAAGA-3'
[0049] Reverse primer (SEQ ID NO.3): 5'-TGGTACGGCTGTCTTCATCT-3'
[0050] This pair of primers targets the conserved region of RBM25 mRNA (SEQ ID NO.1), avoiding known common SNP sites, and improving the specificity and universality of detection. Primer design principles:
[0051] Length: 20 nt; Tm value: 58 - 60 °C; GC content: 45 - 55%; 3'-end stability: no more than 3 GC bases in the last 5 bases; avoid self-complementarity and primer dimers; amplification product length: 100 bp.
[0052] PCR amplification conditions
[0053] (1) Reaction system (25 μL):
[0054] 2× SYBR Green PCR Master Mix: 12.5 μL;
[0055] Forward primer (10 μM): 0.5 μL;
[0056] Reverse primer (10 μM): 0.5 μL;
[0057] cDNA template: 2 μL;
[0058] Nuclease-free water: 9.5 μL;
[0059] (2) Amplification program:
[0060] Initial denaturation: 95 °C, 3 min;
[0061] 40 cycles: Denaturation: 95 °C, 15 s Annealing / extension: 60 °C, 30 s;
[0062] Melting curve analysis: 60 - 95 °C, 0.3 °C / s;
[0063] The preparation method of the primers includes the following steps:
[0064] a) Prepare 100 μM stock solutions of forward and reverse primers respectively;
[0065] b) Mix 100 μL of forward primer, 100 μL of reverse primer and 100 μL of lyoprotectant (5% trehalose + 1% BSA);
[0066] c) Aliquot at 200 μL / tube;
[0067] d) Pre-freeze at -80 °C for 2 h;
[0068] e) Vacuum freeze-dry for 12 h;
[0069] f) Fill with nitrogen and store in the dark at 4 °C.
[0070] (2) GAPDH internal reference primer set (2× freeze-dried powder):
[0071] Forward primer (SEQ ID NO.5): 5'-GAAGGTGAAGGTCGGAGTC-3'
[0072] Reverse primer (SEQ ID NO.6): 5'-GAAGATGGTGATGGGATTTC-3'The preparation method of the GAPDH internal reference primer is the same as that of the RBM25 specific primer set.
[0073] (3) RNA extraction kit:
[0074] Red blood cell lysate 155 mM NH4Cl, 10 mM KHCO3, 0.1 mM EDTA, pH 7.4Trizol LS (Invitrogen, Cat.No.10296028)
[0075] Chloroform (analytical grade, ≥99.5%)
[0076] RNA washing buffer: 75% ethanol (v / v, in DEPC-treated water)
[0077] (4) Reverse transcription premix:
[0078] MMLV reverse transcriptase (200 U / μL): 1 μL;
[0079] 5× First-Strand Buffer: 4 μL;
[0080] DTT (0.1 M): 2 μL;
[0081] dNTP Mix (10 mM each): 1 μL;
[0082] Random hexamers (50 μM): 1 μL;
[0083] RNase inhibitor (40 U / μL): 0.5 μL;
[0084] Nuclease-free water: 0.5 μL;
[0085] The preparation method of the reverse transcription premix includes the following steps:
[0086] a) Mix the above components on ice;
[0087] b) Gently mix well and centrifuge at 4000 rpm for 30 s;
[0088] c) Aliquot 20 μL per tube and store at -20 °C.
[0089] (5) qPCR premix:
[0090] 2×SYBR Green PCR Master Mix: 500 μL;
[0091] ROX Reference Dye (50×): 20 μL;
[0092] Nuclease-free water: 480 μL;
[0093] The preparation method of the qPCR premix includes the following steps:
[0094] a) Mix the above components on ice;
[0095] b) Gently mix well and centrifuge at 4000 rpm for 30 s;
[0096] c) Aliquot 50 μL per tube and store at -20 °C in the dark.
[0097] Secondly, the protein detection module contains the following components:
[0098] (1) Anti-RBM25 monoclonal antibody (coated):
[0099] Antibody concentration: 1 mg / mL in PBS (pH 7.4);
[0100] Coating of 96-well plate: 100 μL per well, incubate overnight at 4 °C;
[0101] Blocking: 1% BSA in PBS, 200 μL per well, 2 h at room temperature;
[0102] a. Immunogen: Recombinant human RBM25 protein C-terminal fragment (amino acids 790 - 843), sequence is as follows: MPPPPPPPPPPPPPPPRGRGGYGGDRGRGGYGGGYGGGYGGGYGGGYGPPRGSYGGGYGGGYGG (SEQ ID NO.4)
[0103] This antibody recognizes the C-terminal domain of the RBM25 protein (amino acids 790 - 843, SEQ ID NO.4), improving the specificity of detection.
[0104] b. Immunization protocol:
[0105] Day 0: 100 μg immunogen + complete Freund's adjuvant, subcutaneous injection;
[0106] Day 14: 50 μg immunogen + incomplete Freund's adjuvant, subcutaneous injection;
[0107] Day 28: 50 μg immunogen + incomplete Freund's adjuvant, subcutaneous injection;
[0108] Day 42: 50 μg immunogen, intravenous injection;
[0109] c. Cell fusion:
[0110] Spleen cells from immunized mice are fused with SP2 / 0 myeloma cells at a ratio of 5:1;
[0111] Fusion agent: 50% PEG 1500 (w / v);
[0112] The fused cells are seeded into 96-well plates at a density of 1×10 5 cells / mL;
[0113] d. Hybridoma screening:
[0114] Selection with HAT medium (for 2 weeks);
[0115] Screening of positive clones by ELISA;
[0116] Purification of monoclonal hybridomas by limiting dilution method;
[0117] e. Antibody purification:
[0118] Expand hybridomas in serum-free medium;
[0119] Purify the antibody by Protein G affinity chromatography;
[0120] Dialyze with PBS and filter through 0.22 μm;
[0121] (2) Biotin-labeled detection antibody:
[0122] Antibody concentration: 0.5 mg / mL in PBS (pH 7.4);
[0123] Biotin-labeling ratio: 4 - 6 mol biotin / mol antibody;
[0124] The preparation method of biotin-labeled detection antibody includes the following steps:
[0125] a) Mix the antibody with NHS-LC-Biotin at a molar ratio of 1:20;
[0126] b) React at room temperature for 2 h;
[0127] c) Purify with a 10 kDa cut-off molecular weight centrifugal tube;
[0128] d) Dialyze overnight with PBS;
[0129] e) Filter with 0.22 μm and store at 4 °C.
[0130] (3) Streptavidin-HRP: 100× concentrated solution (1 mg / mL in 50% glycerol)
[0131] (4) TMB chromogenic solution:
[0132] TMB: 0.4 g / L;
[0133] H2O2: 0.02% (v / v);
[0134] Citrate-phosphate buffer (pH 5.0);
[0135] The preparation method of TMB chromogenic solution includes the following steps:
[0136] a) Prepare TMB stock solution (10 mg / mL in DMSO);
[0137] b) Prepare citrate-phosphate buffer;
[0138] c) Mix TMB stock solution, H2O2 and buffer;
[0139] d) Filter with 0.22 μm and store in the dark at 4 °C.
[0140] (5) RBM25 protein standard:
[0141] Recombinant human RBM25 protein (full length, His-tagged)
[0142] Concentration gradient: 0, 5, 10, 25, 50, 100, 200 ng / mL
[0143] Diluent: 1% BSA in PBS
[0144] The preparation method of RBM25 protein standard includes the following steps: a) Prepare 1 mg / mL recombinant RBM25 protein stock solution;
[0145] b) Gradually dilute with 1% BSA in PBS;
[0146] c) 200 μL / tube;
[0147] d) Pre-freeze at -80°C for 2h;
[0148] e) vacuum freeze drying for 12 h;
[0149] f) Fill with nitrogen and store at 4°C away from light.
[0150] In this embodiment, the chronic heart failure detection method includes the following steps:
[0151] (1) Sample collection and processing:
[0152] a) Collect 5 mL of peripheral venous blood from the subject into a heparin anticoagulation tube; b) Complete sample processing within 30 minutes;
[0153] c) Centrifugation: 1,500 × g, 4°C, 10 min;
[0154] d) collecting the plasma layer for protein detection;
[0155] e) Add an equal volume of red blood cell lysis solution to the remaining blood cells;
[0156] f) Centrifuge at 2,000×g for 15 min to obtain PBMCs.
[0157] (2) RNA detection operation:
[0158] a) RNA extraction:
[0159] PBMCs were fully lysed by adding 1 mL of Trizol LS;
[0160] Add 0.2 mL of chloroform and shake vigorously for 15 seconds; centrifuge at 12,000 × g for 15 minutes at 4°C;
[0161] Take the supernatant and precipitate RNA with an equal volume of isopropanol; wash twice with 75% ethanol;
[0162] Dissolve in 20 μL RNase-free water.
[0163] b) Reverse transcription:
[0164] 1 μg total RNA + 10 μL reverse transcription premix;
[0165] Incubate at 42°C for 30 min.
[0166] Incubate at 85°C for 5 min to inactivate the enzyme.
[0167] c) qPCR amplification:
[0168] Reaction system: 10 μL qPCR premix + 1 μL cDNA + 0.5 μM primer;
[0169] Amplification program: 95°C for 3 min; [95°C for 15 s, 60°C for 30 s] × 40 cycles;
[0170] Relative quantification: 2 -ΔΔCt Method, with the mean of the healthy control group as the calibration benchmark.
[0171] (3) Protein detection operation:
[0172] a) Sample dilution: Plasma is diluted 1:10 (using 1% BSA in PBS);
[0173] b) Sample addition: 100 μL / well, incubated at 37°C for 1 h;
[0174] c) Washing: Wash 3 times with PBST (0.05% Tween-20 in PBS);
[0175] d) Detection antibody: 50 μL / well (diluted 1:2000), incubated at 37°C for 30 min;
[0176] e) Washing: Same as step c;
[0177] f) Enzyme labeling: Streptavidin-HRP (diluted 1:5000), 50 μL / well, incubated at 37°C for 15 min;
[0178] g) Washing: Same as step c;
[0179] h) Color development: 100 μL / well of TMB, protected from light at room temperature for 10 min;
[0180] i) Termination: 50 μL / well of 2 M H2SO4;
[0181] j) Reading: Measure the OD value at a wavelength of 450 nm.
[0182] (4) Detection index calculation:
[0183] Detection index = 0.6 × (relative mRNA expression fold) + 0.4 × (protein concentration / 30 ng / mL)
[0184] (5) Result judgment:
[0185] Detection index ≥ 1.2: Determined as positive for chronic heart failure;
[0186] Detection index 1.0 - 1.2: It is recommended to recheck after 2 weeks;
[0187] Detection index < 1.0: Determined as negative.
[0188] (6) Dynamic monitoring:
[0189] Reexamination is conducted 3 months after the first detection. If the detection index drops by <30%, it indicates a poor prognosis.
[0190] The detection kit in this embodiment adopts a dual-modal detection strategy, combining the mRNA and protein levels of RBM25, which improves the accuracy and reliability of detection. The PBMC-plasma synchronous analysis reflects dual information of intracellular endogenous expression and pathological release, providing new ideas for the study of heart failure mechanisms. In addition, the innovative primer and antibody design improves the specificity of detection, while the comprehensive detection algorithm reasonably allocates the weights of mRNA and protein detection, making the detection results more reliable.
[0191] Example 2
[0192] This embodiment provides an optimization scheme for a chronic heart failure detection kit based on the RBM25 gene expression level. On the basis of Example 1, this embodiment adjusts some components and preparation methods to further improve the sensitivity and specificity of detection.
[0193] First, the optimization of the RNA detection module includes:
[0194] (1) RBM25 specific primer set (2× lyophilized powder):
[0195] Keep the original sequence unchanged, but adjust the composition of the lyoprotectant:
[0196] 6% trehalose + 1.5% BSA: 120 μL
[0197] The preparation method is adjusted as follows:
[0198] a) Prepare 120 μM forward and reverse primer stock solutions respectively;
[0199] b) Mix 100 μL of forward primer, 100 μL of reverse primer and 120 μL of lyoprotectant;
[0200] c) Aliquot 160 μL per tube;
[0201] d) Pre-freeze at -80 °C for 3 h;
[0202] e) Vacuum freeze-dry for 15 h;
[0203] f) Fill with nitrogen and store in the dark at -20 °C.
[0204] This optimization can improve the stability and storage period of the primers.
[0205] (2) Reverse transcription premix:
[0206] Adjust the proportion of some components:
[0207] MMLV Reverse Transcriptase (200 U / μL): 1.2 μL;
[0208] 5× First-Strand Buffer: 4 μL;
[0209] DTT (0.1 M): 2 μL;
[0210] dNTP Mix (10 mM each): 1.2 μL;
[0211] Random hexamers (50 μM): 1.2 μL;
[0212] RNase Inhibitor (40 U / μL): 0.6 μL;
[0213] Nuclease-free water: 0.8 μL;
[0214] The preparation method is adjusted to:
[0215] a) Mix the above components on ice;
[0216] b) Gently mix well and centrifuge at 5000 rpm for 40 s;
[0217] c) Aliquot 22 μL per tube and store at -80 °C.
[0218] This adjustment can improve the reverse transcription efficiency, especially for low-abundance transcripts. Secondly, the optimization of the protein detection module includes:
[0219] (1) Anti-RBM25 monoclonal antibody (coated):
[0220] The antibody concentration is increased to: 1.2 mg / mL in PBS (pH 7.4); 96-well plate coating: 80 μL per well, incubate at 4 °C for 16 h;
[0221] Blocking: 2% BSA in PBS, 200 μL per well, room temperature for 3 h;
[0222] This adjustment can improve the antibody coating efficiency and reduce non-specific binding.
[0223] (2) Biotin-labeled detection antibody:
[0224] Antibody concentration: 0.6 mg / mL in PBS (pH 7.4);
[0225] Biotin labeling ratio: 5 - 7 mol biotin / mol antibody;
[0226] The preparation method is adjusted to:
[0227] a) Mix the antibody with NHS-LC-Biotin at a molar ratio of 1:25;
[0228] b) React at room temperature for 2.5 h;
[0229] c) Purify using a 10 kDa molecular weight cut-off centrifugal tube and centrifuge at 3000 × g for 20 min;
[0230] d) Dialyze against PBS for 24 h and change the dialysis buffer three times;
[0231] e) Filter through a 0.22 μm filter and store at -20 °C.
[0232] This optimization can improve the sensitivity of the detection antibody.
[0233] (3) TMB chromogenic solution:
[0234] Adjusted the component ratio:
[0235] TMB: 0.5 g / L;
[0236] H2O2: 0.025% (v / v);
[0237] Citric acid-phosphate buffer (pH 5.2);
[0238] The preparation method was adjusted to:
[0239] a) Prepare a TMB stock solution (12 mg / mL in DMSO);
[0240] b) Prepare a citric acid-phosphate buffer (pH 5.2);
[0241] c) Mix the TMB stock solution, H2O2, and the buffer;
[0242] d) Filter through a 0.1 μm filter and store in the dark at 4 °C.
[0243] This adjustment can improve the chromogenic sensitivity and stability.
[0244] (4) RBM25 protein standard:
[0245] Adjusted the concentration gradient to: 0, 2.5, 5, 15, 30, 60, 120, 240 ng / mL
[0246] The preparation method was adjusted to:
[0247] a) Prepare a 1.2 mg / mL recombinant RBM25 protein stock solution;
[0248] b) Gradually dilute using 1.5% BSA in PBS;
[0249] c) Aliquot 180 μL per tube;
[0250] d) Pre-freeze at -80°C for 4 h;
[0251] e) Vacuum freeze-dry for 18 h;
[0252] f) Fill with nitrogen and store in the dark at -80°C.
[0253] This adjustment expands the range of the standard curve and improves the quantitative accuracy.
[0254] In this embodiment, the main steps of the chronic heart failure detection method are the same as those in Embodiment 1, but are optimized in the following aspects:
[0255] (1) RNA detection operation:
[0256] a) RNA extraction:
[0257] Add 1.2 mL of Trizol LS to PBMC and lyse thoroughly;
[0258] Add 0.24 mL of chloroform and shake vigorously for 20 s;
[0259] Centrifuge at 13,000×g for 18 min at 4°C;
[0260] Take the supernatant and precipitate RNA with 1.1 volumes of isopropanol;
[0261] Wash twice with 80% ethanol;
[0262] Dissolve in 18 μL of RNase-free water.
[0263] b) qPCR amplification:
[0264] Reaction system: 10 μL of qPCR premix + 1.2 μL of cDNA + 0.6 μM primer;
[0265] Amplification program: 95°C for 3 min; [95°C for 12 s, 60°C for 35 s] × 42 cycles.
[0266] (2) Protein detection operation:
[0267] a) Sample dilution: Dilute plasma 1:8 (using 1.5% BSA in PBS);
[0268] b) Loading: 90 μL / well, incubate at 37°C for 75 min;
[0269] c) Washing: Wash 4 times with PBST (0.1% Tween-20 in PBS);
[0270] d) Detection antibody: 45 μL / well (diluted 1:1800), incubate at 37°C for 35 min;
[0271] e) Enzyme labeling: Streptavidin-HRP (diluted 1:6000), 45 μL / well, incubated at 37 °C for 12 min;
[0272] f) Color development: TMB 90 μL / well, protected from light at room temperature for 12 min.
[0273] (3) Detection index calculation:
[0274] Detection index = 0.65 × (relative mRNA expression fold) + 0.35 × (protein concentration / 35 ng / mL)
[0275] This adjustment optimizes the weights of mRNA and protein detections, improving the accuracy of the detection.
[0276] Example 3
[0277] This example provides a further optimization scheme for a chronic heart failure detection kit based on the expression level of the RBM25 gene, with improvements specifically for high-throughput detection and automated operation.
[0278] First, the optimization of the RNA detection module includes:
[0279] (1) RBM25 specific primer set (4× lyophilized powder):
[0280] Keep the original sequence unchanged, but double the concentration and adjust the composition of the lyoprotectant:
[0281] 7% trehalose + 2% BSA + 0.1% PEG6000: 140 μL
[0282] The preparation method is adjusted as follows:
[0283] a) Prepare 200 μM forward and reverse primer stock solutions separately;
[0284] b) Mix 100 μL of the forward primer, 100 μL of the reverse primer, and 140 μL of the lyoprotectant; c) Aliquot 85 μL / tube;
[0285] d) Pre-freeze at -80 °C for 4 h;
[0286] e) Vacuum freeze-dry for 20 h;
[0287] f) Fill with nitrogen and store at -20 °C protected from light.
[0288] (2) qPCR premix:
[0289] Adjust the component ratio:
[0290] 2×SYBR Green PCR Master Mix: 550 μL;
[0291] ROX Reference Dye (50×): 22 μL;
[0292] Nuclease-free water: 428 μL;
[0293] BSA (10 mg / mL): 10 μL;
[0294] The preparation method was adjusted to:
[0295] a) Mix the above components on ice;
[0296] b) Gently mix well and centrifuge at 6000 rpm for 50 s;
[0297] c) Aliquot 40 μL per tube and store in the dark at -80 °C.
[0298] This optimization improved the stability and repeatability of the qPCR reaction.
[0299] Secondly, the optimization of the protein detection module includes:
[0300] (1) Anti-RBM25 monoclonal antibody (coated):
[0301] Antibody concentration: 1.5 mg / mL in PBS (pH 7.2)
[0302] Coating of 384-well plate: 30 μL per well, incubate at 4 °C for 18 h
[0303] Blocking: 3% BSA + 0.1% Tween-20 in PBS, 50 μL per well, 2 h at room temperature. This adjustment meets the requirements of high-throughput detection.
[0304] (2) Biotin-labeled detection antibody:
[0305] Antibody concentration: 0.8 mg / mL in PBS (pH 7.2)
[0306] Biotin-labeling ratio: 6 - 8 mol biotin / mol antibody
[0307] The preparation method was adjusted to:
[0308] a) Mix the antibody with NHS-PEG4-Biotin at a molar ratio of 1:30;
[0309] b) React at room temperature for 3 h;
[0310] c) Purification with a 7 kDa molecular weight cut-off centrifugal tube, centrifuging at 3500×g for 25 min;
[0311] d) Dialysis with PBS for 36 h, changing the dialysis fluid every 12 h;
[0312] e) Filtering with 0.1 μm and storing at -80 °C.
[0313] (3) Streptavidin-HRP:
[0314] Adjusted to 200× concentrated solution (2 mg / mL in 60% glycerol)
[0315] (4) TMB chromogenic solution:
[0316] The component ratio was adjusted:
[0317] TMB: 0.6 g / L
[0318] H2O2: 0.03% (v / v)
[0319] Citric acid-phosphate buffer (pH 5.4)
[0320] The preparation method was adjusted to:
[0321] a) Prepare TMB stock solution (15 mg / mL in DMSO);
[0322] b) Prepare citric acid-phosphate buffer (pH 5.4);
[0323] c) Mix the TMB stock solution, H2O2 and buffer;
[0324] d) Filter with 0.05 μm and store at 4 °C in the dark.
[0325] In this example, the main steps of the chronic heart failure detection method are similar to those in Example 2, but the following optimizations were made for high-throughput detection:
[0326] (1) Sample processing:
[0327] Use an automated sample processing system to achieve standardized operations for plasma separation and PBMC extraction.
[0328] (2) RNA detection operation:
[0329] a) RNA extraction:
[0330] Adopt a magnetic bead method RNA extraction kit and use it in conjunction with an automated liquid handling workstation.
[0331] b) qPCR amplification:
[0332] Reaction system: 8 μL qPCR premix + 1 μL cDNA + 0.7 μM primer;
[0333] Amplification program: 95°C for 2 min; [95°C for 10 s, 60°C for 30 s] × 45 cycles.
[0334] (3) Protein detection operation:
[0335] Operate using an automated ELISA workstation. The main steps are as follows:
[0336] a) Sample dilution: Dilute plasma 1:6 (using 2% BSA in PBS);
[0337] b) Sample addition: 25 μL / well, incubate at 37°C for 60 min;
[0338] c) Washing: Wash 5 times with PBST (0.05% Tween-20 in PBS);
[0339] d) Detection antibody: 20 μL / well (diluted 1:2000), incubate at 37°C for 30 min;
[0340] e) Enzyme labeling: Streptavidin-HRP (diluted 1:8000), 20 μL / well, incubate at 37°C for 10 min;
[0341] f) Color development: 30 μL / well of TMB, keep away from light at room temperature for 15 min.
[0342] (4) Detection index calculation:
[0343] Detection index = 0.7 × (relative mRNA expression fold) + 0.3 × (protein concentration / 40 ng / mL)
[0344] (5) Result judgment:
[0345] Detection index ≥ 1.3: Determined to be highly likely to have chronic heart failure;
[0346] Detection index 1.1 - 1.3: It is recommended to retest after 1 week;
[0347] Detection index < 1.1: Determined to be at low risk.
[0348] These optimization measures have significantly improved the detection throughput and automation level, while maintaining high sensitivity and specificity.
[0349] Control Example 1: Single RBM25 mRNA detection method
[0350] This comparative example aims to verify the superiority of the dual-modal detection strategy, and only the RNA detection module is used for the detection of chronic heart failure. This method corresponds to Example 1, but the protein detection module is omitted.
[0351] First, the composition of the RNA detection module is the same as that in Example 1, including the RBM25 specific primer set, the GAPDH internal reference primer set, the RNA extraction kit, the reverse transcription premix, and the qPCR premix. Among them, the preparation method of the RBM25 specific primer set is as follows:
[0352] a) Prepare 100 μM stock solutions of the forward primer (SEQ ID NO.2) and the reverse primer (SEQ ID NO.3);
[0353] b) Mix 100 μL of the forward primer, 100 μL of the reverse primer, and 100 μL of the cryoprotectant (5% trehalose + 1% BSA);
[0354] c) Aliquot at 200 μL / tube;
[0355] d) Pre-freeze at -80 °C for 2 h;
[0356] e) Vacuum freeze-dry for 12 h;
[0357] f) Fill with nitrogen and store in the dark at 4 °C.
[0358] Secondly, the detection method includes the following steps:
[0359] (1) Sample collection and processing:
[0360] Collect 5 mL of peripheral venous blood from the subject into a heparin anticoagulant tube and complete the sample processing within 30 minutes. Obtain the plasma layer by gradient centrifugation (1,500×g, 4 °C, 10 min). Add an equal volume of red blood cell lysate to the remaining blood cells and centrifuge at 2,000×g for 15 min to obtain PBMC.
[0361] (2) RNA detection operation:
[0362] a) RNA extraction: Use the Trizol LS method to extract total RNA from PBMC;
[0363] b) Reverse transcription: Use MMLV reverse transcriptase to reverse transcribe 1 μg of total RNA into cDNA;
[0364] c) qPCR amplification: Use the RBM25 specific primer and the SYBR Green method for real-time fluorescence quantitative PCR.
[0365] (3) Data analysis:
[0366] Adopt 2 -ΔΔCtThe method calculates the relative expression level of RBM25 mRNA, with the mean of the healthy control group as the calibration benchmark.
[0367] (4) Detection and judgment:
[0368] The relative expression level of RBM25 mRNA is used as the only index for detection and judgment. The critical value is set as ≥2.0 of the relative expression level for a positive determination of chronic heart failure.
[0369] Through this comparative example, the detection effect of the single mRNA detection method can be evaluated. However, due to the lack of protein level information, this method may not comprehensively reflect the expression changes of RBM25 in chronic heart failure, especially in cases of abnormal post-transcriptional regulation and protein release. This highlights the necessity and superiority of the dual-modal detection strategy of the present invention.
[0370] Comparative Example 2: Detection of RBM25 protein by conventional ELISA
[0371] This comparative example aims to verify the superiority of the optimized protein detection method of the present invention by detecting the plasma RBM25 protein level using the traditional ELISA method. This method corresponds to the protein detection module in Example 2, but uses conventional ELISA reagents and operating procedures.
[0372] First, the protein detection module includes the following components:
[0373] (1) Anti-RBM25 polyclonal antibody (coated):
[0374] Antibody concentration: 10 μg / mL in carbonate buffer (pH 9.6);
[0375] Coating of 96-well plate: 100 μL / well, incubation overnight at 4°C;
[0376] Blocking: 5% non-fat milk in PBS, 200 μL / well, 2 h at room temperature;
[0377] (2) Biotin-labeled detection antibody:
[0378] Antibody concentration: 1 μg / mL in PBS (pH 7.4)
[0379] Biotin-labeling ratio: 3 - 4 mol biotin / mol antibody;
[0380] (3) Streptavidin-HRP: Conventional concentration (diluted 1:3000);
[0381] (4) TMB chromogenic solution: Commercially available conventional formulation
[0382] (5) RBM25 protein standard:
[0383] Recombinant Human RBM25 Protein (Full Length)
[0384] Concentration gradient: 0, 10, 20, 40, 80, 160, 320 ng / mL
[0385] Secondly, the detection method includes the following steps:
[0386] (1) Sample dilution: Dilute plasma 1:5 (using PBS)
[0387] (2) Sample addition: 100 μL / well, incubate at 37 °C for 2 h
[0388] (3) Washing: Wash 3 times with PBST (0.05% Tween-20 in PBS)
[0389] (4) Detection antibody: 100 μL / well (diluted 1:1000), incubate at 37 °C for 1 h
[0390] (5) Washing: Same as step (3)
[0391] (6) Enzyme labeling: Streptavidin-HRP (diluted 1:3000), 100 μL / well, incubate at 37 °C for 30 min
[0392] (7) Washing: Same as step (3)
[0393] (8) Color development: 100 μL / well of TMB, avoid light at room temperature for 15 min
[0394] (9) Termination: 50 μL / well of 2M H2SO4
[0395] (10) Reading: Measure the OD value at a wavelength of 450 nm
[0396] Finally, calculate the plasma RBM25 protein concentration according to the standard curve, and set the critical value at ≥100 ng / mL to determine positive for chronic heart failure.
[0397] Through this comparative example, the performance of the conventional ELISA method in the detection of RBM25 protein can be evaluated. However, this method may have disadvantages such as low sensitivity, narrow linear range, and cumbersome operation. In contrast, the optimized protein detection method of the present invention uses monoclonal antibodies, improved biotin labeling technology, and optimized detection procedures, which can significantly improve the sensitivity and specificity of the detection and shorten the detection time.
[0398] Comparative Example 3: Detection Method for BNP Single Index
[0399] This comparative example aims to compare the effects of the present invention with the commonly used clinical BNP detection method. This method uses a commercially available BNP ELISA kit for detection, and forms a comparison with Example 3.
[0400] First, the BNP detection kit includes the following main components:
[0401] (1) Anti-BNP monoclonal antibody (coated);
[0402] (2) HRP-labeled anti-BNP detection antibody;
[0403] (3) BNP standard (0 - 1000 pg / mL);
[0404] (4) TMB chromogenic solution;
[0405] (5) Stop solution;
[0406] Secondly, the detection method includes the following steps:
[0407] (1) Sample treatment: Collect 2 mL of peripheral venous blood from the subject into an EDTA anticoagulant tube, and centrifuge at 1500×g for 10 min to separate the plasma.
[0408] (2) Sample addition: 50 μL / well for both the standard and the plasma sample to be tested;
[0409] (3) Add HRP-labeled antibody: 50 μL / well, incubate at 37 °C for 1 h;
[0410] (4) Washing: Wash 5 times with the washing solution;
[0411] (5) Chromogenic reaction: 100 μL / well of TMB, keep in the dark at room temperature for 15 min;
[0412] (6) Termination: 50 μL / well of the stop solution;
[0413] (7) Reading: Measure the OD value at a wavelength of 450 nm;
[0414] Finally, calculate the plasma BNP concentration according to the standard curve, and set the detection critical value according to the clinical guidelines: When BNP ≥ 100 pg / mL, the possibility of chronic heart failure is considered to be relatively high.
[0415] Through this comparative example, the effectiveness of the BNP single-index detection method can be evaluated. Although BNP is a widely used heart failure biomarker in clinical practice at present, its specificity is insufficient and it is easily affected by factors such as age and renal function. In contrast, the dual-modal detection strategy based on RBM25 of the present invention can provide more comprehensive myocardial injury information and is expected to improve the accuracy and specificity of early detection.
[0416] Comparative Example 4: Combined detection method of RBM25 and BNP (non-optimized version)
[0417] This comparative example aims to explore the potential of the combined detection of RBM25 and BNP, but uses a non-optimized detection method. This method combines the RBM25 mRNA detection in Comparative Example 1 and the BNP protein detection in Comparative Example 3, and is used as a control for Example 3.
[0418] First, the detection module includes:
[0419] (1) RBM25 mRNA detection module: the same as in Comparative Example 1;
[0420] (2) BNP protein detection module: the same as in Comparative Example 3;
[0421] Second, the detection method includes the following steps:
[0422] (1) Sample collection and processing:
[0423] Collect 7 mL of peripheral venous blood from the subject, of which 5 mL is used for RBM25 mRNA detection (refer to Comparative Example 1), and 2 mL is used for BNP detection (refer to Comparative Example 3).
[0424] (2) RBM25 mRNA detection: carried out according to the method in Comparative Example 1
[0425] (3) BNP protein detection: carried out according to the method in Comparative Example 3
[0426] Finally, a simple linear combination method is used to calculate the combined detection index:
[0427] Detection index = 0.5 × (relative expression multiple of RBM25 mRNA) + 0.5 × (BNP concentration / 100 pg / mL);
[0428] Set the critical value to ≥1.5 for the detection index to determine positive for chronic heart failure.
[0429] Through this comparative example, the potential of the combined detection of RBM25 and BNP can be preliminarily evaluated. However, this non-optimized method has the following limitations:
[0430] 1. Ignores the RBM25 protein level information, which may lead to incomplete detection information;
[0431] 2. The simple linear combination may not fully reflect the relative importance and synergistic effect of the two indicators;
[0432] 3. The detection process is cumbersome and requires separate mRNA and protein detections, which is not conducive to clinical application.
[0433] In contrast, the optimized dual-modal detection strategy of the present invention can more comprehensively and accurately reflect the myocardial injury status by simultaneously detecting the mRNA and protein levels of RBM25, combined with an optimized weighting algorithm, and is expected to provide more reliable detection results.
[0434] Through the above four comparative examples, the superiority of the chronic heart failure detection kit and detection method based on the RBM25 gene expression level of the present invention was comprehensively verified. These comparative examples cover methods such as single mRNA detection, conventional protein detection, clinically common biomarker detection, and simple combined detection, highlighting the innovation and advantages of the present invention in terms of detection sensitivity, specificity, comprehensiveness, and practicality. These comparisons not only prove the creativity of the present invention but also provide important references for further optimization and clinical application.
[0435] To comprehensively evaluate the detection effect and clinical application value of the present invention, a series of performance test experiments were designed. These experiments were aimed at verifying the core innovation points of the present invention, including the superiority of the dual-modal detection strategy, detection sensitivity and specificity, and application effects in different clinical scenarios.
[0436] Experiment 1: Evaluation of detection accuracy
[0437] This experiment was aimed at comparing the accuracy of the method of the present invention with existing detection methods. 300 subjects were recruited, including 100 patients with confirmed chronic heart failure, 100 patients suspected of having heart failure, and 100 healthy controls. All subjects received the method of the present invention (Example 3), BNP detection (Comparative Example 3), and conventional cardiac ultrasound examination.
[0438] Experimental method:
[0439] 1. Collect peripheral venous blood from the subjects and perform sample processing and detection according to the methods of Example 3 and Comparative Example 3.
[0440] 2. Perform cardiac ultrasound examination and measure indicators such as left ventricular ejection fraction (LVEF).
[0441] 3. According to the 2021 European Society of Cardiology (ESC) heart failure detection guidelines, combined with clinical symptoms, signs, and auxiliary examination results, two experienced cardiologists independently made the detection.
[0442] 4. Calculate the sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) of various methods.
[0443] Results:
[0444] Table 1. Performance comparison of different detection methods
[0445] Method Sensitivity Specificity PPV NPV AUC The method of the present invention 92.5% 89.0% 89.3% 92.2% 0.953 BNP detection 85.0% 82.0% 82.5% 84.5% 0.891 Echocardiogram 88.0% 86.0% 86.3% 87.8% 0.920
[0446] Analysis: The method of the present invention is superior to single BNP detection and echocardiography in all indicators. Especially in terms of sensitivity and specificity, this method shows obvious advantages, which benefits from the dual-modal detection strategy of RBM25 mRNA and protein, and can more comprehensively reflect the myocardial injury status.
[0447] Experiment 2: Evaluation of early detection ability
[0448] This experiment aims to evaluate the detection ability of the method of the present invention in the early stage of heart failure. 100 subjects with high-risk factors for heart failure (such as a history of hypertension, diabetes, coronary heart disease, etc.) but without obvious symptoms were selected for a 1-year prospective follow-up study.
[0449] Experimental method:
[0450] 1. Blood samples were collected at baseline and detected using the method of the present invention (Example 2) and BNP detection (Comparative Example 3).
[0451] 2. Follow-up was conducted every 3 months, repeating the detection in step 1 and performing echocardiography.
[0452] 3. The number of cases of heart failure occurring within 1 year was recorded, and the ability of different methods to predict heart failure at an early stage was analyzed.
[0453] Results:
[0454] Table 2. Comparison of different methods for early prediction of heart failure
[0455] Method Prediction accuracy Average early detection time The method of the present invention 85 4.2 months BNP detection 70 2.8 months Echocardiogram 65 2.1 months
[0456] Analysis: The method of the present invention shows significant advantages in the early detection of heart failure, not only with a higher prediction accuracy but also being able to detect the occurrence of heart failure earlier than traditional methods. This result highlights the potential of RBM25 as a novel biomarker in the early detection of heart failure.
[0457] Experiment 3: Evaluation of treatment monitoring effect
[0458] This experiment aims to evaluate the application value of the method of the present invention in the treatment monitoring of heart failure. 80 patients with chronic heart failure receiving standardized treatment were selected for a 6-month follow-up study.
[0459] Experimental method:
[0460] 1. Blood samples were collected before treatment and baseline detection was performed using the method of the present invention (Example 3) and BNP detection (Comparative Example 3).
[0461] 2. The patients received standardized treatment, including ACEI / ARB, β-blockers, diuretics, etc.
[0462] 3. Blood samples were collected monthly for testing after treatment, and the improvement of clinical symptoms and changes in LVEF were evaluated simultaneously.
[0463] 4. Analyze the correlation between changes in RBM25 expression levels and clinical improvement.
[0464] Results:
[0465] Table 3. Correlation between changes in RBM25 and BNP levels and clinical improvement
[0466]
[0467] Analysis: Changes in the mRNA and protein levels of RBM25 showed a stronger correlation with the degree of clinical improvement in heart failure patients. This indicates that the method of the present invention is not only applicable to detection but also can be used as an effective tool for evaluating treatment effects and prognosis.
[0468] Through the above three experiments, the performance of the chronic heart failure detection kit and detection method based on the RBM25 gene expression level was comprehensively evaluated. The results showed that the method of the present invention is superior to traditional methods in terms of detection accuracy, early prediction ability, and treatment monitoring effects. These advantages mainly stem from the following aspects:
[0469] 1. Dual-modal detection strategy: Simultaneously detect the mRNA and protein levels of RBM25, providing more comprehensive myocardial injury information. The mRNA level reflects changes in gene transcriptional activity, while the protein level directly reflects the abundance of functional molecules. This strategy can capture changes at the transcriptional and translational levels, improving the sensitivity and specificity of detection.
[0470] 2. High sensitivity and specificity: Optimized primer design and antibody screening significantly improved the sensitivity and specificity of detection. Especially in early detection, this method can detect the occurrence of heart failure earlier than traditional BNP detection, providing the possibility for timely intervention.
[0471] 3. Dynamic monitoring value: Changes in RBM25 expression levels are highly correlated with the degree of clinical improvement in heart failure patients, which gives this method a unique advantage in evaluating treatment effects and prognosis.
[0472] 4. Wide applicability: This method is not only applicable to diagnosed patients but also has important value for screening high-risk populations and early intervention. This provides a new tool for the prevention and individualized treatment of heart failure.
[0473] Unexpected technical effects:
[0474] 1. Prognostic prediction ability: Unexpectedly, the experimental results showed that the changing trend of RBM25 expression level might predict the long-term prognosis of heart failure patients. The re-hospitalization rate within one year of patients with a decrease in RBM25 level of less than 30% after 6 months of treatment was significantly higher than that of patients with a decrease of more than 50%. This finding provides a new reference index for the formulation of individualized treatment plans.
[0475] 2. Myocardial remodeling marker: In-depth analysis revealed that the change in RBM25 expression level was strongly correlated with the degree of myocardial remodeling. This implies that RBM25 may be involved in the molecular mechanism of myocardial remodeling, providing a new target for the study of the pathogenesis of heart failure.
[0476] 3. Drug response prediction: In the treatment monitoring experiment, it was unexpectedly found that the change in the RBM25 expression pattern might predict the patient's response to specific drugs. This finding opens up a new research direction for the precise treatment of heart failure.
[0477] 4. Detection potential for multiple diseases: Preliminary studies showed that characteristic changes in RBM25 expression levels also existed in some other cardiovascular diseases (such as myocarditis, cardiomyopathy, etc.). This implies that this method may have a broader application prospect and the potential to develop into a detection tool for multiple cardiovascular diseases.
[0478] The chronic heart failure detection kit and detection method based on the RBM25 gene expression level exhibit excellent detection performance and clinical application value. Its dual-modal detection strategy, high sensitivity and specificity, as well as its advantages in early detection and treatment monitoring, provide new tools for the detection, prevention, and individualized treatment of heart failure. In addition, this study also reveals the potential role of RBM25 in the pathogenesis and prognostic prediction of heart failure, opening up new directions for future basic research and clinical applications.
[0479] The above are only examples of the present invention and are not intended to limit the present invention. For those skilled in the art, various changes and modifications can be made to the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the scope of the claims of the present invention.
Claims
1. A detection kit for chronic heart failure based on the expression level of the RBM25 gene, characterized in that, The kit includes: (1) RNA detection module, comprising: a) RBM25 specific primer set, where the forward primer sequence is SEQ ID NO.2 and the reverse primer sequence is SEQ ID NO.3; b) GAPDH internal reference primer set; c) RNA extraction kit; d) Reverse transcription premix; e) qPCR premix; (2) Protein detection module, comprising: a) Anti-RBM25 monoclonal antibody; b) Biotin-labeled detection antibody; c) Streptavidin-HRP; d) TMB chromogenic solution; e) RBM25 protein standard.
2. The detection kit according to claim 1, wherein The RBM25 specific primer set targets the conserved region of RBM25 mRNA, and the sequence of the conserved region is SEQ ID NO.
1.
3. The detection kit according to claim 1, characterized in that, The anti-RBM25 monoclonal antibody recognizes the C-terminal domain of RBM25 protein, and the amino acid sequence of the C-terminal domain is SEQ ID NO.
4.
4. The detection kit according to claim 1, wherein The RNA extraction kit includes erythrocyte lysate, Trizol LS, chloroform and RNA washing buffer.
5. The detection kit according to claim 1, wherein The reverse transcription premix includes MMLV reverse transcriptase, 5×First-Strand Buffer, DTT, dNTP Mix, Random hexamers and RNase inhibitor.
6. The detection kit according to claim 1, characterized in that The qPCR premix includes 2×SYBR Green PCR Master Mix, ROX Reference Dye and Nuclease-free water.
7. A method for detecting chronic heart failure using the detection kit according to any one of claims 1-6, characterized in that, It includes the following steps: (1) Collect peripheral venous blood of the subject and isolate plasma and peripheral blood mononuclear cells (PBMC); (2) Use the RNA detection module to detect the relative expression level of RBM25 mRNA in PBMC; (3) Use the protein detection module to detect the concentration of RBM25 protein in plasma; (4) Calculate the detection index according to the relative expression level of RBM25 mRNA and the concentration of RBM25 protein.
8. The detection method according to claim 7, wherein The calculation formula of the detection index is: Detection index = 0.6×(relative expression multiple of mRNA) + 0.4×(protein concentration / 30 ng / mL).
9. The detection method according to claim 7, wherein It also includes the following steps: When the detection index ≥ 1.2, it is determined as positive for chronic heart failure; When the detection index is between 1.0 - 1.2, it is recommended to retest after 2 weeks.
10. The detection method according to claim 7, wherein It also includes a dynamic monitoring step: Conduct a review 3 months after the first detection. If the decrease in the detection index < 30%, it indicates poor prognosis.