Application of long-chain non-coding RNA Nucb1 in preparation of medicine for treating Alzheimer disease
Through the application of long-chain non-coding RNAs Nucb1 and miR-493-3p, as diagnostic markers and therapeutic means for Alzheimer's disease, inhibits microglia pyroptosis and cytotoxicity, solves the problem of lack of effective diagnosis and treatment of AD in the prior art, and provides a new therapeutic direction.
Patent Information
- Application Number
- CN202510520751.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-24
- Publication Date
- 2025-07-04
AI Technical Summary
The existing technology lacks effective early diagnosis and prevention methods, and existing drugs can only alleviate the clinical symptoms of Alzheimer's disease to a certain extent, but cannot inhibit the progress of the disease. The space-time-specific expression of long non-coding RNA has not been fully explored.
Using long-chain non-coding RNA Nucb1 and/or miR-493-3p as diagnostic markers for Alzheimer's disease, intervene in the microglia pyroptosis process, inhibit cytotoxicity and alleviate neuroinflammatory by detecting its expression level and overexpressing Nucb1.
Nucb1 can significantly inhibit microglia pyroptosis and cytotoxicity, reduce neuroinflammation, and has the potential to become a new strategy for preventing and treating Alzheimer's disease, and shows good diagnostic value in AD patients.
Smart Images

Figure BDA0005373878740000062 
Figure BDA0005373878740000091 
Figure BDA0005373878740000101
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of long non-coding RNA Nucb1 in the preparation of drugs for treating Alzheimer's disease. Background Art
[0002] Alzheimer's disease (AD) is a neurodegenerative disease of the central nervous system, and its clinical manifestations are mainly progressive memory loss, cognitive dysfunction, various mental symptoms and behavioral abnormalities.
[0003] At present, there are only six drugs approved by the US FDA for the treatment of AD, including cholinesterase inhibitors (donepezil, rivastigmine and galantamine), glutamate receptor antagonists (memantine), and aducanumab and lecanemab for reducing Aβ plaques. The above drugs can only alleviate clinical symptoms to a certain extent and cannot effectively inhibit and reverse the progression of the disease. Moreover, since the pathogenesis of AD has not been fully elucidated, there is a lack of effective early diagnosis and prevention and treatment means at the present stage. Therefore, exploring the molecular mechanism of the occurrence and development of AD and finding specific biomarkers for diagnosis are urgent problems to be solved in the basic and clinical research of AD.
[0004] In recent years, with the continuous research on AD, a series of abnormally expressed long non-coding RNAs have been discovered, which are closely related to the onset and progression of AD. However, lncRNAs with novel functions and spatiotemporal specific expressions still need to be explored. Summary of the Invention
[0005] In order to explore the molecular mechanism of the occurrence and development of AD and find specific biomarkers for diagnosis, the present invention provides the application of long non-coding RNA Nucb1 in the preparation of drugs for treating Alzheimer's disease, and discloses the action target of long non-coding RNA Nucb1. The specific technical solutions are as follows:
[0006] The application of long non-coding RNA Nucb1 and / or miR-493-3p as a diagnostic biomarker for Alzheimer's disease, wherein the nucleotide sequence of the long non-coding RNA Nucb1 is as shown in SEQ ID NO.1; the nucleotide sequence of the miR-493-3p is as shown in SEQ ID NO.2.
[0007] The present invention also provides the application of a reagent for detecting the expression level of long non-coding RNA Nucb1 in the preparation of a diagnostic product for Alzheimer's disease, wherein the nucleotide sequence of the long non-coding RNA Nucb1 is as shown in SEQ ID NO.1.
[0008] The present invention also provides the use of long non-coding RNA Nucb1 and / or miR-493-3p in the preparation of a medicament for treating Alzheimer's disease, wherein the nucleotide sequence of the long non-coding RNA Nucb1 is as shown in SEQ ID NO.1; the nucleotide sequence of the miR-493-3p is as shown in SEQ ID NO.2.
[0009] The present invention also provides a biological material for overexpressing long non-coding RNA Nucb1, and the biological material includes one or more of the cDNA of long non-coding RNA Nucb1, a primer set for amplifying the cDNA, a recombinant expression vector including the cDNA, and a recombinant microorganism including the recombinant expression vector.
[0010] Preferably, the sequence of the cDNA is as shown in SEQ ID NO.3.
[0011] Preferably, the primer set includes a Nucb1-forward primer as shown in SEQ ID NO.8 and a Nucb1-reverse primer as shown in SEQ ID NO.9.
[0012] Preferably, the initial vector of the recombinant expression vector includes a plasmid vector.
[0013] Preferably, the plasmid vector includes a pcDNA3.1 expression vector.
[0014] The present invention also provides the use of the biological material as described in any one of the above in the preparation of a medicament for treating Alzheimer's disease.
[0015] The present invention also provides a medicament for treating Alzheimer's disease, which includes a biological material for overexpressing long non-coding RNA Nucb1, and the nucleotide sequence of the long non-coding RNA Nucb1 is as shown in SEQ ID NO.1.
[0016] The beneficial effects of the present invention are as follows:
[0017] The present invention discloses the application of long non-coding RNA Nucb1 and / or miR-493-3p as diagnostic markers for Alzheimer's disease. The nucleotide sequence of the long non-coding RNA Nucb1 is shown as SEQ ID NO.1; the nucleotide sequence of the miR-493-3p is shown as SEQ ID NO.2. The long non-coding RNA Nucb1 of the present invention is closely related to the onset and progression of AD. The long non-coding RNA Nucb1 can intervene in the occurrence and progression of AD by promoting the expression of its downstream target miR-493-3p. Drugs that can promote the expression of RNA Nucb1 can inhibit the process of microglial pyroptosis and cytotoxicity. The abnormal activation of microglia is related to the neuroinflammation of AD. Nucb1 may reduce neuroinflammation by inhibiting the pyroptosis and cytotoxicity of microglia, indicating that Nucb1 may become a new strategy for the prevention and treatment of AD. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments.
[0019] Figure 1 Schematic diagram of the screening results of lncRNA molecules with significantly different expressions in the cerebral cortex of 7-month-old 5×FAD mice by RNA high-throughput sequencing in Example 1;
[0020] Figure 2 Schematic diagram of the results of the effect of overexpression and knockdown of Nucb1 on the release of LDH in EOC20 cells stimulated by LPS / nigericin in Example 1; among them, *** indicates a significant difference between the LDH expression levels of the Nucb1 group and the Vector group; indicates a significant difference between the LDH expression levels of the Nucb1SiRNA group and the NC group;
[0021] Figure 3 Schematic diagram of the relative quantification results of PI after overexpression and knockdown of Nucb1 in EOC20 cells stimulated by LPS / nigericin in Example 1; among them, * indicates a significant difference between the relative fluorescence intensities of the PI staining results of the Nucb1 group and the Vector group; # indicates a significant difference between the relative fluorescence intensities of the PI staining results of the Nucb1SiRNA group and the NC group;
[0022] Figure 4Schematic diagram of the relative quantification results of Hoechst33342 after overexpression and knockdown of Nucb1 in LPS / nigericin-stimulated EOC20 cells in Example 1; where *, # indicate significant differences in the relative fluorescence intensity of the Hoechst 33342 staining results between the Nucb1 group and the Vector group, and between the Nucb1SiRNA group and the NC group, respectively.
[0023] Figure 5 Schematic diagram of the representative PI / Hoechst 33342 staining image results after overexpression and knockdown of Nucb1 in LPS / nigericin-stimulated EOC20 cells in Example 1; where Bar: 400μm.
[0024] Figure 6 Results of the relative expression levels of Nucb1 in the cytoplasm and nucleus of the cerebral cortex of 5×FAD mice analyzed by nuclear-cytoplasmic separation and qPCR experiments in Example 1; where GAPDH is used as a positive control for cytoplasmic distribution and U6 is used as a positive control for nuclear distribution.
[0025] Figure 7 Schematic diagram of the expression levels of Nucb1 in the cerebral cortex and hippocampus of 7-month-old 5×FAD mice and WT mice of the same age in Example 1; where ** and *** indicate significant differences in the expression levels of Nucb1 between the cerebral cortex and hippocampus of WT mice and 5×FAD mice, respectively.
[0026] Figure 8 Schematic diagram of the expression levels of Nucb1 in the cerebral cortex of 1-, 3-, 6-, 9- and 12-month-old APP / PS1 mice and WT mice of the same age in Example 1; where *, ** and *** indicate significant differences in the expression levels of Nucb1 between the cerebral cortex of WT mice and APP / PS1 mice of different ages, respectively.
[0027] Figure 9 Schematic diagram of the expression levels of Nucb1 in the hippocampus of 1-, 3-, 6-, 9- and 12-month-old APP / PS1 mice and WT mice of the same age in Example 1; where *, ** and *** indicate significant differences in the expression levels of Nucb1 between the hippocampus of WT mice and APP / PS1 mice of different ages, respectively.
[0028] Figure 10Schematic diagram of the expression levels of Nucb1 in EOC20 and primary mouse microglia co-stimulated with LPS / nigericin in Example 1; where, *** indicates a significant difference in the expression levels of Nucb1 between EOC20 cells or microglia in the Control group and the LPS + nigericin co-induced group;
[0029] Figure 11 Schematic diagram of the expression levels of miR-493-3p, miR-485-5p, and miR-365b-5p in the cerebral cortex of 5×FAD mice in Example 1; where, * indicates a significant difference in the relative expression levels of miRNAs between WT mice and 5×FAD mice;
[0030] Figure 12 Schematic diagram of the expression levels of miR-493-3p, miR-485-5p, and miR-365b-5p in the cerebral cortex of APP / PS1 mice in Example 1; where, * indicates a significant difference in the relative expression levels of miRNAs between WT mice and APP / PS1 mice;
[0031] Figure 13 Schematic diagram of the expression levels of miR-493-3p, miR-485-5p, and miR-365b-5p in EOC20 cells co-stimulated with LPS / nigericin in Example 1; where, *, ** indicate a significant difference in the relative expression levels of miRNAs between the Control group and LPS / nigericin-stimulated EOC20 cells or microglia;
[0032] Figure 14 Schematic diagram of the results of the effect of overexpression and knockdown of Nucb1 on the expression of miR-493-3p at the transcriptional level in EOC20 cells in Example 1; where, * indicates a significant difference in the relative expression levels of miR-493-3p between EOC20 cells in the Nucb1 group and the Vector group; ## indicates a significant difference in the relative expression levels of miR-493-3p between EOC20 cells in the Nucb1 siRNA group and the NC group;
[0033] Figure 15 Schematic diagram of the representative Western blot image results of NLRP3, ASC, Cleaved GSDMD, GSDMD, Caspase1p20, and Caspase1 in LPS / nigericin-stimulated EOC20 cells after overexpression and knockdown of Nucb1 in Example 1;
[0034] Figure 16Schematic diagram of the relative quantification results of NLRP3, ASC, Cleaved GSDMD, GSDMD, Caspase1p20, and Caspase1 in EOC20 cells stimulated with LPS / nigericin after overexpression and knockdown of Nucb1 in Example 1; where *, ** indicate that there are significant differences in the relative expression levels of NLRP3, ASC, Cleaved GSDMD, GSDMD, Caspase1p20, and Caspase1 in EOC20 cells between the Nucb1 group and the Vector group; ##, indicate that there are significant differences in the relative expression levels of NLRP3, ASC, Cleaved GSDMD, GSDMD, Caspase1p20, and Caspase1 in EOC20 cells between the Nucb1 siRNA group and the NC group;
[0035] Figure 17 Schematic diagram of the results of ELISA detection of the effect of overexpression and knockdown of Nucb1 on the release of IL-1β in EOC20 cells stimulated with LPS / nigericin in Example 1; where ** indicates that there is a significant difference in the relative expression level of IL-1β in EOC20 cells between the Nucb1 group and the Vector group; ## indicates that there is a significant difference in the relative expression level of IL-1β in EOC20 cells between the Nucb1 siRNA group and the NC group;
[0036] Figure 18 Schematic diagram of the results of ELISA detection of the effect of overexpression and knockdown of Nucb1 on the release of IL-18 in EOC20 cells stimulated with LPS / nigericin in Example 1; where * indicates that there is a significant difference in the relative expression level of IL-18 in EOC20 cells between the Nucb1 group and the Vector group; indicates that there is a significant difference in the relative expression level of IL-18 in EOC20 cells between the Nucb1 siRNA group and the NC group;
[0037] Figure 19 Schematic diagram of the results of constructing the structures of Nucb1WT and MUT 3'-UTR using the pmirGLO vector in Example 1;
[0038] Figure 20 Schematic diagram of the relative luciferase activity after co-transfection of Nucb1WT / MUT and NC / miR-493-3p in EOC20 cells in Example 1; where ** indicates that there is a significant difference in the relative luciferase activity between the NC group and the miR-493-3p group after transfection of Nucb1WT in EOC20 cells;
[0039] Figure 21Schematic diagram of the results of qPCR detection of the expression level of lncRNA Nucb1 in the plasma of AD patients and healthy volunteers (HAV) of the same age in Example 1.
[0040] Figure 22 Schematic diagram of the correlation results between the expression level of lncRNA Nucb1 detected by qPCR and the MMSE score of AD patients in Example 1;
[0041] Figure 23 Schematic diagram of the results of analyzing the diagnostic value of Nucb1 in AD disease using the ROC curve in Example 1;
[0042] Note: In the above figures, * indicates P < 0.05, ** and ## indicate P < 0.01, *** and indicate P < 0.001. Detailed implementation manners
[0043] The present invention provides the application of long non-coding RNA Nucb1 and / or miR-493-3p as diagnostic markers for Alzheimer's disease, wherein the nucleotide sequence of the long non-coding RNA Nucb1 is as shown in SEQ ID NO.1; the nucleotide sequence of the miR-493-3p is as shown in SEQ ID NO.2.
[0044] SEQ ID NO.1: The sequence with the identifier ENSMUST00000210394 in the Ensembl database;
[0045]
[0046] SEQ ID NO.2: 5'-UGAAGGUCCUACUGUGUGCCAGG-3';
[0047] The present invention also provides the use of a reagent for detecting the expression level of long non-coding RNA Nucb1 in the preparation of a diagnostic product for Alzheimer's disease; the nucleotide sequence of the long non-coding RNA Nucb1 is as shown in SEQ ID NO.1. As an implementation manner, the kit of the present invention is a kit prepared based on immunoassay technology. As an implementation manner, the reagent of the present invention includes a reagent for detecting the expression level of long non-coding RNA Nucb1. As another implementation manner, the reagent includes a reagent for detecting the down-regulation of the expression level of long non-coding RNA Nucb1. As an implementation manner, the kit realizes the diagnosis of Alzheimer's disease by detecting the expression level of the long non-coding RNA Nucb1 in a subject sample. As an implementation manner, the sample includes but is not limited to a plasma sample.
[0048] The present invention also provides the use of long non-coding RNA Nucb1 and / or miR-493-3p in the preparation of a medicament for treating Alzheimer's disease, and the nucleotide sequence of the long non-coding RNA Nucb1 is as shown in SEQ ID NO.1.
[0049] The present invention also provides a biological material for overexpressing long non-coding RNA Nucb1, and the biological material includes one or more of: cDNA of long non-coding RNA Nucb1, a primer set for amplifying the cDNA, a recombinant expression vector including the cDNA, and a recombinant microorganism including the recombinant expression vector.
[0050] The sequence of the cDNA of the present invention is as shown in SEQ ID NO.3.
[0051]
[0052] The primer set described in the present invention includes the Nucb1 forward primer shown in SEQ ID NO.8 and the Nucb1 reverse primer shown in SEQ ID NO.9; the miR-493-3p forward primer shown in SEQ ID NO.16 and the miR-493-3p reverse primer shown in SEQ ID NO.20 (i.e., the miRNA universal reverse primer).
[0053] Nucb1 forward primer (SEQ ID NO.8): 5’-AAGCCCAGTTGAAGGAGGTG-3’;
[0054] Nucb1 reverse primer (SEQ ID NO.9): 5’-AGGTTAGGGCGTAAGAGGCT-3’;
[0055] miR-493-3p forward primer (SEQ ID NO.16): 5’-CGCGTGAAGGTCCTACTGTGT-3’;
[0056] miR-493-3p reverse primer (SEQ ID NO.20): 5’-AGTGCAGGGTCCGAGGTATT-3’;
[0057] As an implementation mode, the initial vector of the recombinant expression vector described in the present invention includes a plasmid vector; as another implementation mode, the plasmid vector includes the pcDNA3.1 expression vector. As an implementation mode, the insertion position of the pcDNA3.1 expression vector is EcoRv.
[0058] The present invention also provides the use of the biological material as described above in the preparation of a medicament for treating Alzheimer's disease.
[0059] The present invention also provides a medicament for treating Alzheimer's disease, including a biological material overexpressing the long non-coding RNA Nucb1, and the nucleotide sequence of the long non-coding RNA Nucb1 is as shown in SEQ ID NO.1. As an implementation mode, the biological material includes one or more of the cDNA of the long non-coding RNA Nucb1, the primer set for amplifying the cDNA, the recombinant expression vector including the cDNA, and the recombinant microorganism including the recombinant expression vector. As an implementation mode, the above biological material is the same as that described above and will not be elaborated here.
[0060] To further illustrate the present invention, the application of long non-coding RNA Nucb1 and / or miR-493-3p provided by the present invention as diagnostic markers for Alzheimer's disease will be described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.
[0061] The sources of the experimental materials used in the following examples are as follows:
[0062] 1) Cell sources
[0063] (1) Mouse microglia (EOC20) were purchased from ATCC (USA) (product number: CRL-2469);
[0064] (2) Mouse bone marrow lymphocytes (LADMAC) were purchased from ATCC (USA) (product number: CRL-2420);
[0065] (3) Primary mouse microglia were purchased from Wuhan Saisi Biological Technology Co., Ltd. (product number: PC-118m);
[0066] (4) APP / PS1 mice at 1, 3, 6, 9, and 12 months of age were purchased from Zhishan (Beijing) Health Medicine Research Institute Co., Ltd.;
[0067] (5) 7-month-old 5×FAD mice were kindly provided by the Institute of Military Medicine, Academy of Military Sciences of the Chinese People's Liberation Army;
[0068] (6) Wild control mice at 1, 3, 6, 7, 9, and 12 months of age were purchased from Zhishan (Beijing) Health Medicine Research Institute Co., Ltd.
[0069] 2) Sources of drugs and reagents
[0070] (1) DMEM and MEM media were purchased from Wuhan Saiweier Biological Technology Co., Ltd.;
[0071] (2) Fetal bovine serum (FBS) was purchased from Gibco (USA) (product number: 25200072);
[0072] (3) Trypsin digestion solution was purchased from Suzhou Xinsaimi Biological Technology Co., Ltd. (product number: C100C1);
[0073] (4) The pcDNA3.1-Nucb1 overexpression plasmid was synthesized by Beijing Lainuo Biological Technology Co., Ltd., and negative control (NC) and Nucb1 siRNA were synthesized by Sangon Biotech (Shanghai) Co., Ltd.;
[0074] (5) Lipopolysaccharide (LPS from Escherichia coli O55:B5) was purchased from Sigma-Aldrich, Germany (Catalog number: L2880);
[0075] (6) Nigericin was purchased from InvivoGen, USA (Catalog number: tlrl-nig);
[0076] (7) jetPRIME transfection reagent was purchased from Polyplus-transfection (Catalog number: 101000046);
[0077] (8) Lactate dehydrogenase (LDH) activity detection kit (Catalog number: BC0685) and Hoechst 33342 / PI Double Stain Kit (Catalog number: CA1120) were purchased from Beijing Solarbio Science & Technology Co., Ltd.;
[0078] (9) RNA extraction kit (Catalog number: CW0581M), RIPA lysis buffer (strong) (Catalog number: CW2333S), BCA protein quantification kit (Catalog number: CW0014S), SDS-PAGE loading buffer (non-reducing, 5×) (Catalog number: CW0028S), high-sensitivity chemiluminescence detection kit (Catalog number: CW0049M) were purchased from CWBIO Co., Ltd.;
[0079] (10) HiScript III RT SuperMix for qPCR (+gDNA wiper), ChamQ Universal SYBR qPCR Master Mix, miRNA 1st Strand cDNA Synthesis Kit (by stem-loop), miRNA Universal SYBR qPCR Master Mix and Dual Luciferase Reporter Assay Kit were purchased from Nanjing Novoprotein Science & Technology Co., Ltd. (Catalog number: R323, Q711, MR101, MQ101, DL101);
[0080] (11) Serum RNA extraction kit (miRNeasy Serum) was purchased from QIAGEN, Germany (Catalog number: 1071073);
[0081] (12) Cytoplasmic and Nuclear Purification Kit was purchased from Norgen Biotek Corporation (Catalog number: NGB-21000);
[0082] (13)ELISAMAX TM The Deluxe Set Mouse IL-1β was purchased from (product number: 432604);
[0083] (14)Mouse IL-18 (Interleukin 18) ELISA Kit was purchased from Wuhan Ealrite Biotech Co., Ltd. (product number: E-EL-M0730).
[0084] 3) Source of experimental instruments
[0085] (1) The LS-CO110 carbon dioxide incubator was purchased from Thermo Fisher Company, USA;
[0086] (2) The Spark 20M microplate reader was purchased from TECAN Company, Switzerland;
[0087] (3) The real-time fluorescence quantitative PCR instrument was purchased from Bioer Technology Company, Hangzhou, China;
[0088] (4) The protein electrophoresis analysis system was purchased from Bio-Rad Company, USA;
[0089] (5) EVOS TM The FL cell fluorescence imaging system was purchased from Thermo Fisher Company, USA;
[0090] (6) The Fusion-FX6 imaging system was purchased from Vilber Company, France.
[0091] Example 1 Screening experiment of AD-related lncRNA molecules
[0092] In this example, using the new generation of RNA sequencing technology, a novel lncRNA molecule Nucb1 with the function of improving AD cognitive dysfunction was first discovered. The identifier of this lncRNA in the Ensembl database is ENSMUST00000210394, which is expected to become a potential AD biomarker and drug intervention target.
[0093] In this example, the cerebral cortexes of three 7-month-old 5×FAD mice and three WT mice of the same age were selected as the research objects, and each mouse tissue sample was used as an independent sample for RNA sequencing analysis. Total RNA was isolated from the cerebral cortex using TRIzol reagent. rRNA was removed from the total RNA by the Ribo-off rRNA Depletion kit, and VAHTSTM Stranded mRNA-seq Library Prep Kit by RNA fragmentation, cDNA synthesis, cDNA fragment modification, magnetic bead purification, fragment sequencing, and library amplification were performed to construct an lncRNA library. For transcripts with polyA tails, lncRNA molecules were screened according to the following criteria: the number of exons in the transcript (the number of exons ≥ 2), the length of the transcript (>200 bp), the known annotation status, and the potential for protein coding (evaluating the coding potential using tools such as CPC2, CNCI, Pfam, and PLEK). DESeq2 was used to perform differential expression analysis on the lncRNAs detected in the cerebral cortex of 5×FAD mice and WT mice. Subsequently, the screening conditions were set as: q-value < 0.01 and fold change |FoldChange| > 2 to obtain significantly differentially expressed lncRNAs. The above steps were entrusted to Sangon Biotech (Shanghai) Co., Ltd.
[0094] Through the experiments described above, the present invention first discovered lncRNA molecules with differential expression in 7-month-old 5×FAD five-transgenic AD mice, and constructed a differential expression profile for lncRNAs with good species homology among the lncRNA molecules with differential expression in 5×FAD five-transgenic AD mice. The results are as Figure 1 shown. Using multiple AD animal models, lncRNAs with significant downregulation in diseases were screened, and lncRNA Nucb1 was obtained. LncRNA Nucb1 showed the pathological characteristics of significant downregulation in APP / PS1 mice and 5×FAD mice of different months of age.
[0095] 1) Preparation before the experiment:
[0096] In this example, Beijing Lainuo Biotechnology Co., Ltd. was entrusted to clone the cDNA of Nucb1 into the pcDNA3.1 expression vector to construct an Nucb1 overexpression plasmid (pcDNA3.1-Nucb1). This vector carried a CMV strong promoter to ensure high-efficiency transcription.
[0097] Small interfering RNA (siRNA) of Nucb1 was used to silence the expression of Nucb1. The sequence information of Nucb1 siRNA is shown in Table 1.
[0098] Table 1 Nucleotide sequences for cell transfection
[0099]
[0100] EOC20 and primary microglia were respectively inoculated into 6-well plates at a density of 2×10 5 cells / mL, with 2 mL inoculated in each well.
[0101] Prepare a 1 mg / mL LPS stock solution with sterile water, store it at -20 °C, and dilute it to a final concentration of 1 μg / mL with DMEM before the experiment.
[0102] Prepare a 5 mg / mL nigericin stock solution with 100% ethanol, store it at -20 °C. Before the experiment, dilute it to a final concentration of 7.5 mg / mL with DMEM and directly add it to the cells for stimulation.
[0103] 2) Cell culture
[0104] According to the ATCC instructions, culture LADMAC cells in MEM medium containing 10% FBS. When the LADMAC cells grow to a density of 80%, collect its supernatant and remove cell debris by centrifugation at 750 rpm for 3 minutes to prepare the conditioned medium for EOC20 cells. EOC20 cells are cultured in DMEM conditioned medium rich in 10% FBS and 20% LADMAC cell supernatant. When the EOC20 cells grow to a density of 80%, after aspirating the supernatant of the 100 mm cell culture dish, digest the EOC20 microglia with 2 mL of 0.25% trypsin (containing EDTA) and inoculate them into the culture plate.
[0105] Mouse primary microglia are cultured in DMEM complete medium containing 10% FBS.
[0106] 3) Cell transfection and construction of microglial pyroptosis model
[0107] To explore whether Nucb1 is involved in the process of microglial pyroptosis, four groups were set up in this example, namely the overexpression group (denoted as Nucb1), the knockdown expression group (denoted as Nucb1siRNA), the negative control group (denoted as NC), and the empty vector group (denoted as Vector). In the overexpression group, pcDNA3.1-Nucb1 was transfected into EOC20 cells respectively; in the knockdown expression group, Nucb1siRNA was transfected into EOC20 cells respectively; in the negative control group, NC was transfected into EOC20 cells; in the empty vector group, pcDNA3.1 was transfected into EOC20 cells respectively.
[0108] The transfection process is as follows: Seed EOC20 cells at 5×10 5Cells / well density was seeded into 6-well plates. When the confluence of EOC20 cells reached 80%, 2 μg of the target plasmid or siRNA with a final concentration of 50 nM was added to 200 μL of jetPRIME transfection buffer. After vortexing for 10 s, it was briefly centrifuged, then 5 μL of jetPRIME transfection reagent was added and mixed well. After vortexing for 1 s, it was briefly centrifuged again and left to stand at room temperature for 10 min. The transfection reagent mixture containing the target gene was dropped into the supernatant of EOC20 cells. After 24 h, the cell supernatant was aspirated, and 2 mL of DMEM blank medium containing 1 μg / mL LPS was added to each well to stimulate the cells for 4 hours. Then, 20 μL of nigericin with a concentration of 750 μg / mL was directly added to this medium to activate the NLRP3 inflammasome pathway for 2 hours. The supernatant was collected into a centrifuge tube, and the cells were gently washed once with pre-cooled PBS. After aspirating the PBS, 200 μL of RIPA buffer was added to each well. After standing on ice for 5 min, the cells were gently scraped off with a cell scraper and transferred to a sterile centrifuge tube for subsequent research on related biological functions and molecular mechanisms.
[0109] 4) LDH release assay
[0110] The supernatants of EOC20 cells in different groups described in step 3) were collected into centrifuge tubes and centrifuged at 400 g for 5 min respectively. The supernatant was retained, and the cell debris at the bottom was discarded. The supernatant was placed on ice. According to the instructions provided by the lactate dehydrogenase (LDH) activity detection kit, the corresponding reagents were added in sequence, mixed well, and left to stand at room temperature for 3 min. Then, 200 μL of each group was transferred to a 96-well plate, and the absorbance value was measured and recorded at a wavelength of 450 nm using a microplate reader.
[0111] The calculation formula is as follows: ΔA = A measurement tube - A control tube. Where A is the absorbance value.
[0112] The criteria for standard curve drawing are as follows: A standard curve was made based on the measured values and concentrations of the standard tubes. y is the concentration of the standard product, with the unit of μmol / mL; x is the relative absorbance (subtracting the OD value of the standard tube with a concentration of 0). Calculate the content of pyruvate in the sample, then substitute ΔA into the regression equation (x) to calculate the y value. The results are as Figure 2 shown,
[0113] Cell released LDH (U / mL) = y × V sample ÷ V sample ÷ T × 103 = 66.7 × y. Where V sample is the content of pyruvate in the sample.
[0114] From Figure 2It can be seen that in the overexpression group, Nucb1 significantly inhibited the release of LDH in EOC20 cells co-stimulated with LPS / nigericin, while silencing the expression of Nucb1 significantly promoted the release of LDH in EOC20 cells co-stimulated with LPS / nigericin. The release level of LDH in EOC20 cells co-stimulated with LPS / nigericin in the empty vector group was similar to that in the NC group, and there was no significant difference between the two groups.
[0115] 5) PI / Hoechst 333342 staining experiment of EOC20 cells
[0116] According to the instructions of the Hoechst 33342 / PI Double Stain Kit, add 1 mL of staining buffer (containing 5 μL of Hoechst 33342 and 5 μL of PI staining solution) to the EOC20 cells in the overexpression group, silencing expression group, negative control group, and empty vector group in step 3). After incubating at 4 °C for 20 min, wash once with PBS, take pictures of the PI / Hoechst 333342 staining under a fluorescence microscope, and analyze the fluorescence intensity of the images using ImageJ software. The results are as Figures 3 - 5 shown.
[0117] From Figures 3 - 5 the staining results of PI and Hoechst 333342, it can be seen that the fluorescence intensity of EOC20 cells in the overexpression group was significantly lower than that in the negative control group and the empty vector group, and the fluorescence intensity of EOC20 cells in the silencing expression group was significantly higher than that in the negative control group and the empty vector group. In summary, overexpressing Nucb1 can inhibit cell bursting death, thereby reducing the cytotoxicity of pyroptosis. After knocking down Nucb1, the cytotoxicity of pyroptosis was further aggravated. It can be seen that the Nucb1 gene can interfere with the process of pyroptotic cells and thus participate in the disease pathology process of AD.
[0118] 6) RNA extraction and qPCR analysis
[0119] Using 1-, 3-, 6-, 9-, and 12-month-old APP / PS1 mice (denoted as APP / PS1 mice), 7-month-old 5×FAD mice (denoted as 5×FAD mice), and 1-, 3-, 6-, 7-, 9-, and 12-month-old wild control mice (denoted as WT mice) as experimental materials, the above-mentioned mice were sacrificed by excessive inhalation of ether, and the cerebral cortex and hippocampus of the mice were isolated to obtain brain tissues of different AD transgenic mice at different months. Immediately put them into liquid nitrogen and transfer them to a -80 °C refrigerator for storage for later use.
[0120] Use RNA extraction and qPCR techniques to detect the gene expression levels of Nucb1, miR493-3p, miR-485-5p, and miR-365b-5p in the brain tissues as described above, in the EOC20 and primary mouse microglia cells stimulated with LPS / nigericin and the EOC20 and primary mouse microglia cells without LPS / nigericin stimulation (control group) in step 3), and the miR-493-3p gene expression level in the EOC20 cells stimulated with LPS / nigericin after transfection with Vector, Nucb1, NC, and Nucb1 siRNA in step 3). The detection steps are as follows:
[0121] (1) Cut the animal tissues stored at -80°C into small pieces. Add 1 mL of TRIzon Reagent to every 30 mg of tissue and homogenize using a homogenizer to obtain brain tissue samples. For EOC20 and primary mouse microglia cells, after aspirating the cell supernatant, seed the EOC20 and primary mouse microglia cells into 6-well plates at a cell density of 5×10 5 cells per well. After the cells grow stably, add LPS / nigericin to stimulate and construct a microglial pyroptosis model. Then add 1 mL of TRIzon Reagent to each well of the 6-well cell culture plate and repeatedly pipette to mix evenly to lyse the cells, obtaining EOC20 cell samples and primary mouse microglia cell samples.
[0122] (2) Let the samples obtained in step (1) stand at room temperature for 5 min to completely separate the protein-nucleic acid complexes. Then add chloroform according to the ratio of 1 mL of TRIzon Reagent: 200 μl of chloroform, cover the tube cap, shake vigorously for 15 s, and let it stand at room temperature for 2 min. Then centrifuge the samples at 12,000 rpm at 4°C for 10 min. At this time, the sample is divided into three layers: a red organic phase, a middle layer, and an upper colorless aqueous phase. RNA is mainly in the upper aqueous phase. Therefore, transfer the upper aqueous phase solution of the sample to a new RNase-Free centrifuge tube for standby.
[0123] (3) Add an equal volume of 70% ethanol (prepared with RNase-free water) to the aqueous phase solutions of different samples obtained in step (2), invert and mix well to obtain different samples to be tested. Add all the different samples to be tested into the adsorption columns (Spin Columns RM) already installed in the collection tubes. If the samples to be tested cannot be added all at once, they can be transferred in multiple times. Then centrifuge at 12,000 rpm for 20 s, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube.
[0124] (4) Add 700 μl of Buffer RW1 to the adsorption column, centrifuge at 12,000 rpm for 20 s, pour out the waste liquid in the collection tube, and place the adsorption column back into the collection tube.
[0125] (5) Add 500 μl of Buffer RW2 (check whether absolute ethanol has been added before use) to the adsorption column, centrifuge at 12,000 rpm for 20 s, pour out the waste liquid in the collection tube, and place the adsorption column back into the collection tube.
[0126] (6) Repeat step (5).
[0127] (7) Centrifuge at 12,000 rpm for 2 min, pour out the waste liquid in the collection tube. Place the adsorption column at room temperature until it is completely dry.
[0128] (8) Place the adsorption column into a new RNase-free centrifuge tube, add 40 μl of RNase-Free Water to the middle part of the adsorption column, let it stand at room temperature for 1 min, centrifuge at 12,000 rpm for 1 min, collect the RNA solution, and store it at -80 °C to prevent degradation.
[0129] The concentration and purity of total RNA were determined using a Spark 20M microplate reader. The expression levels of lncRNA in mouse brain tissue, EOC20, primary mouse microglia, and plasma RNA samples from AD patients and healthy individuals were detected. The lncRNA was reverse transcribed into cDNA using the HiScript III RT SuperMix for qPCR (+gDNA wiper) kit as the template to be tested, and then the ChamQ Universal SYBR qPCR MasterMix reagent was used for qPCR experiments. The qPCR experimental steps are as follows:
[0130] ① Genomic DNA removal: Prepare the mixture shown in Table 2 in an RNase-free centrifuge tube:
[0131] Table 2 Reagent components in the RNase-free centrifuge tube
[0132] Reagent components Dosage RNA 1 μg 4×gDNAwiperMix 4 μl <![CDATA[RNase-free ddH2O]]> Quantified to 16 μl
[0133] Pipette to mix the components in the RNase-free centrifuge tube evenly, and incubate at 42 °C for 2 min.
[0134] ② Prepare the reverse transcription reaction system: Directly add 4 μl of 5×HiScript III qRT SuperMix to each tube in the reaction tube from step ①, gently pipette to mix evenly, and perform the reverse transcription reaction. The reverse transcription reaction program is shown in Table 3:
[0135] Table 3 Reverse transcription reaction program
[0136] Temperature Reaction time 37℃ 15 min 85℃ 5 sec
[0137] After reverse transcription, the product can be immediately used for qPCR reaction or stored at -20 °C for qPCR reaction.
[0138] ③ Prepare the mixture as shown in Table 4 in the qPCR tube:
[0139] Table 4 Components of the mixture in the qPCR tube
[0140] Component Volume 2×ChamQ Universal SYBR qPCR Master Mix 10.0 μl Forward primer (10 μM) 0.4 μl Reverse primer (10 μM) 0.4 μl Template cDNA 2 μl <![CDATA[ddH2O]]> 7.2 μl
[0141] The upstream and downstream sequences of the primers for qPCR detection are shown in Table 5:
[0142] Table 5 Primers in the qPCR detection process
[0143] Primer name Primer sequence (5’ - 3’) Nucb1 - forward primer SEQ ID NO.8: 5’ - AAGCCCAGTTGAAGGAGGTG - 3’ Nucb1 - reverse primer SEQ ID NO.9: 5’ - AGGTTAGGGCGTAAGAGGCT - 3’ GAPDH - forward primer SEQ ID NO.10: 5’ - TTGATCTGAAGTCAGGAATCCC - 3’ GAPDH - reverse primer SEQ ID NO.11: 5’ - TGTAGACCATGTAGTTGAGGTCA - 3’
[0144] Note: In Table 5, F is the upstream primer (forward primer); R is the downstream primer (reverse primer).
[0145] ④ Perform qPCR reaction according to the conditions shown in Table 6:
[0146] Table 6 qPCR detection program
[0147]
[0148] After the qPCR reaction, according to the obtained cycle number CT value, using GAPDH as the internal reference, apply the 2 -ΔΔCT method to calculate the relative expression level of lncRNA Nucb1, and the results are as Figures 6 - 10 shown.
[0149] By Figures 6 - 10It can be seen that since the subcellular localization of lncRNA is closely related to its biological function, in order to clarify the distribution of Nucb1 in the brains of AD animals, through nuclear-cytoplasmic separation and qPCR techniques, it was found that Nucb1 was mainly distributed in the cytoplasm of the cerebral cortex of 5×FAD mice. In this experiment, the cerebral cortex and hippocampal tissues of 7-month-old 5×FAD mice and APP / PS1 mice of different months were used, and the pathological feature of the significant downregulation of Nucb1 in the pathological process of AD was further verified by qPCR experiments. In addition, in the pyroptosis models of EOC20 and primary mouse microglia induced by LPS / nigericin, the expression of Nucb1 was also significantly downregulated. To sum up, the expression level of lncRNA Nucb1 in AD animals decreased significantly, showing a significant difference compared with APP / PS1 mice, and there was a correlation between the expression level of lncRNA Nucb1 and the occurrence of AD disease.
[0150] Use the miRNA 1st Strand cDNA Synthesis Kit and miRNA Universal SYBR qPCR Master Mix reagents to evaluate the expression levels of miRNAs in mouse brain tissues and EOC20 cells according to the instructions. The experimental steps are as follows:
[0151] ① Genomic DNA removal reaction: Equilibrate all reagents to room temperature for later use. Prepare the following mixture in an RNase-free centrifuge tube:
[0152] Table 7 Reagent components in the RNase-free centrifuge tube
[0153] Reagent components Volume (μL) <![CDATA[RNase-free ddH2O]]> Quantified to 10 μL 5×gDNAwiperMix 2 μL RNA 1 μg
[0154] Use a pipette to pipette and mix the reagent components in the RNase-free centrifuge tube, and then incubate at 42 °C for 2 min.
[0155] ② First-strand cDNA synthesis: Synthesize cDNA using the reagent components shown in Table 8.
[0156] Table 8 Reagent components for cDNA synthesis
[0157]
[0158]
[0159] After mixing the reagent components in Table 8, gently pipette and mix with a pipette. Perform the first-strand cDNA synthesis reaction according to the following program:
[0160] 25 °C, 5 min; 50 °C, 15 min; 85 °C, 5 min.
[0161] Store the obtained cDNA products at -20 °C or perform qPCR reaction immediately.
[0162] The primer sequences used in the cDNA synthesis are shown in Table 9:
[0163] Table 9 Primers used in cDNA synthesis
[0164]
[0165] ③ Prepare the qPCR reaction system as shown in Table 10:
[0166] Table 10 qPCR reaction system
[0167] Reagent components Dosage 2×miRNA Universal SYBR qPCR Master Mix 10 μL Forward primer (10 μM) 0.4 μL Reverse primer (10 μM) 0.4 μL mQPrimerR (10 μM) 0.4 μL Template cDNA 2 μL <![CDATA[ddH2O]]> 6.8 μL
[0168] The upstream and downstream primer sequences are shown in Table 11:
[0169] Table 11 Upstream and downstream primers used in qPCR
[0170] Primer name Primer sequence (5’ - 3’) miR - 493 - 3p - forward primer SEQ ID NO.16: 5’ - CGCGTGAAGGTCCTACTGTGT - 3’ miR - 485 - 5p - forward primer SEQ ID NO.17: 5’ - CGAGAGGCTGGCCGTGAT - 3’ miR - 365b - 5p - forward primer SEQ ID NO.18: 5’ - AGGGACUUUCAGGGGCAGCUGUG - 3’ U6 - forward primer SEQ ID NO.19: 5’ - CAAATTCGTGAAGCGTTCCA - 3’ miRNA universal - reverse primer SEQ ID NO.20: 5’ - AGTGCAGGGTCCGAGGTATT - 3’
[0171] Set the following program in the real-time fluorescence quantitative PCR instrument to perform qPCR reaction:
[0172] Pre-denaturation: 95 °C, 5 min;
[0173] Cycling reaction: 95 °C, 10 s; 60 °C, 30 s; 95 °C, 15 s; Number of cycles 40;
[0174] Melting curve: 60 °C, 60 s; 95 °C, 15 s.
[0175] Use the 2 -ΔΔCT method to calculate the relative expression level of miR-493-3p, with U6 as the internal reference, and the results are as Figures 11 - 13 shown.
[0176] From Figures 11 - 13It is known that Nucb1 mainly exerts its biological functions as a cytoplasmic lncRNA in AD. Since cytoplasmic lncRNAs mainly act as ceRNAs to competitively bind miRNAs, three miRNAs (miR-493-3p, miR-485-5p, and miR-365b-5p) that potentially bind to Nucb1 were predicted through the miRDB database. To explore whether there is a targeting relationship between Nucb1 and the above miRNAs, the expression levels of these three miRNA molecules were first verified using 5×FAD mice, APP / PS1 mice, and the EOC20 cell pyroptosis model. It was found that miR-493-3p showed significant upregulation in the 5×FAD mice, APP / PS1 mice, and the EOC20 cell pyroptosis model. To explore the upstream and downstream regulatory relationship between Nucb1 and miR-493-3p, the expression changes of miR-493-3p were verified using the EOC20 cell model stimulated by LPS / nigericin after overexpressing and knocking down Nucb1. It was found that overexpression of Nucb1 significantly decreased the expression level of miR-493-3p, while knockdown of Nucb1 promoted the expression level of miR-493-3p. The results are as Figure 14 shown.
[0177] 7) Detection of the expression of NLRP3 inflammasome and pyroptosis-related proteins by Western blot
[0178] Total proteins in microglia and mouse brain tissues were extracted using RIPA lysis buffer. After measuring the protein concentration using a BCA kit, equal amounts of protein samples were loaded onto a 10% SDS-polyacrylamide gel, and the proteins were transferred onto a PVDF membrane using the wet transfer method. Subsequently, the membrane was blocked with TBST solution containing 5% BSA for two hours. The membrane was incubated overnight at 4°C with anti-NLRP3 Rabbit mAb (dilution ratio 1:1000), anti-GSDMD Rabbit mAb (dilution ratio 1:1000), anti-Cleaved Gasdermin D (Asp276) Rabbit mAb (dilution ratio 1:1000), anti-Caspase1 p20 Mouse mAb (dilution ratio 1:100), anti-Caspase1 Mouse mAb (dilution ratio 1:200), anti-ASC Rabbit mAb (dilution ratio 1:1000), and anti-GAPDH rabbit mAb (dilution ratio 1:1000) as primary antibodies. The next day, the membrane was incubated with goat anti-rabbit IgG-HRP (dilution ratio 1:5000) and goat anti-mouse IgG-HRP (dilution ratio 1:5000) as secondary antibodies at RT for two hours. The bands were developed by incubation with ECL exposure solution (1:1), and their images were obtained using a Fusion-FX6 imaging system. The results are as shown in Figure 15 ; The gray values of protein expression were calculated using Image J software, and the gray value of the GAPDH band was used as an endogenous control. The results are as shown in Figure 16 .
[0179] As can be seen from Figures 15 - 16 , the high expression levels of NLRP3, ASC, Caspase-1 p20 / Caspase1, and Cleaved GSDMD / GSDMD in the classical inflammasome pathway were significantly inhibited after overexpression of Nucb1.
[0180] 8) Detection of the expression levels of IL-1β and IL-18 by ELISA
[0181] After collecting and centrifuging the cell supernatants of each group, ELISA kits were used for detection. The operations were carried out according to the instructions of the ELISA kits to detect the expression levels of IL-1β and IL-18 respectively. The results are as shown in Figures 17 - 18 .
[0182] As can be seen from Figures 17 - 18It can be seen that after overexpressing Nucb1, the release of IL-1β and IL-18 in EOC20 cells decreased, while in the group with silenced Nucb1, the release of IL-1β and IL-18 in EOC20 cells increased significantly. This indicates that Nucb1 can regulate the release of IL-1β and IL-18.
[0183] 9) Detection of the subcellular distribution of Nucb1 by nuclear and cytoplasmic separation of mouse brain tissue
[0184] Take 15 mg of brain tissue from 7-month-old 5×FAD mice, add 200 μL of Lysis Buffer J lysate containing 1% β-mercaptoethanol, and homogenize until the tissue is dissolved to obtain a cell lysate. Transfer the cell lysate to an RNase-free EP tube and centrifuge at 14,000 rpm for 10 min. Take the supernatant and carefully transfer the supernatant (containing cytoplasmic RNA) to a new RNase-free EP tube. The precipitate containing nuclear RNA is at the bottom of the RNase-free EP tube.
[0185] According to the instructions of the Cytoplasmic and Nuclear Purification Kit for nuclear and cytoplasmic separation reagents, perform steps such as specific binding, washing, and RNA elution of cytoplasmic RNA and nuclear RNA on the supernatant obtained above, collect the purified RNA products to measure the concentration and purity of total RNA, and perform qPCR experiments according to the steps described above to detect the expression level of Nucb1, using GAPDH and U6 as cytoplasmic and nuclear positive controls respectively, and the results are as Figure 6 shown.
[0186] Calculation formula for the proportion of lncRNA in the nucleus and cytoplasm: Nuclear% = 2 -胞核CT值 / (2 -胞浆CT值 +2 -胞核CT值 ), Cytoplasmic% = 1 - Nuclear%.
[0187] As Figure 6 can be seen, lncRNA Nucb1 is mainly distributed in the cytoplasm of the cerebral cortex of 5×FAD mice; the positive control U6 is mainly distributed in the nucleus, and GAPDH is mainly distributed in the cytoplasm. It can be seen that lncRNA Nucb1 mainly plays a pathological role as a cytoplasmic lncRNA in AD.
[0188] 10) Dual-luciferase reporter gene detection system
[0189] According to the potential binding sequence information of lncRNA Nucb1 and miR-493-3p predicted by the miRDB database, the wild-type (WT) plasmid of lncRNA Nucb1 and the mutant (MUT) plasmid with base mutations at the binding site were constructed using the pmirGLO dual-luciferase reporter system plasmid (Promega).
[0190] The inserted sequence in the wild-type (WT) plasmid of lncRNA Nucb1 is shown in SEQ ID NO.21:
[0191] SEQ ID NO.21: 5’-GCGGAAGGAGGCCGAGAGGAAGCTCCAAGAGCAACAGCGCAGACACC GGGAACACCCCAAAGTCAATGTTCCTGGCAGCCAAGCCCAGTTGAAGGAGGTGTGGGAGGAGTTGGATGGATTGGACCCCAACAGGTTCAACCCCAAGACCTTCTTCATACTGCATGACATCAACAGTGATGGTGTCCTAGATGAGCAAGAACTGGAAGCTCTCTTTACCAAGGAGGTGAGTGTAATGGAAGCTTTGTGAGCGAGACATACTTCAGCCTCTTACGCCCTAACCTATCCTCTGCTTTCCTGTCA-3’;
[0192] The inserted sequence in the mutant (MUT) plasmid of lncRNA Nucb1 is shown in SEQ ID NO.22:
[0193] SEQ ID NO.22: 5’-GCGGAAGGAGGCCGAGAGGAAGCTCCAAGAGCAACAGCGCAGACACCGGGAACACCCCAAAGTCAATGTTCCTGGCAGCCAAGCCCAGTTGAAGGAGGTGTGGGAGGAGTTGGATGGATTGGACCCCAACAGGTTCAACCCCACAGATGGTTTCATACTGCATGACATCAACAGTGATGGTGTCCTAGATGAGCAAGAACTGGAAGCTCTCTTTACCAAGGAGGTGAGTGTAATGGAAGCTTTGTGAGCGAGACATACTTCAGCCTCTTACGCCCTAACCTATCCTCTGCTTTCCTGTCA-3’;
[0194] The sequence of miR-493-3p mimics is shown in SEQ ID NO.2:
[0195] SEQ ID NO.2: 5’-UGAAGGUCCUACUGUGUGCCAGG-3’;
[0196] The above plasmids and miRNA mimics were constructed and synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0197] Using the liposome transfection method, 2 μg of pmirGLO-lncRNA Nucb1-WT / pmirGLO-lncRNA Nucb1-MUT plasmid and 50 nM of NC / miR-493-3p mimics were added to 200 μL of jetPRIME transfection buffer, vortexed for 10 s and then centrifuged briefly, and then 5 μL of jetPRIME transfection reagent was added and mixed evenly, vortexed for 1 s and then centrifuged briefly, and left to stand at room temperature for 10 min. The transfection reagent mixture containing the target gene was dropped into the supernatant of EOC20 cells, and EOC20 cells were cultured for 48 h. After the culture was completed, the EOC cells were washed twice with PBS, then 50 μL of 1× cell lysis buffer was added to the cells, lysed on a shaker for 15 min, centrifuged at 12,000 g for 2 min, the cell supernatant was taken, and the luciferase activity was detected according to the instructions of the Dual Luciferase Reporter Assay Kit. In this example, the miRDB database was used to further analyze the potential binding sites of Nucb1 and miR-493-3p, thereby constructing a dual luciferase reporter gene system, and the results are as Figure 19 shown. The relative fluorescence activity of each sample is the ratio of firefly fluorescence to Renilla fluorescence, and the results are as Figure 20 shown.
[0198] It can be seen from Figure 19 and 20 that compared with the control group co-transfected with the irrelevant sequence (NC), miR-493-3p can significantly reduce the luciferase activity of Nucb1 wild type (WT), but there is no significant change in the luciferase activity of Nucb1 mutant type (MUT).
[0199] 11) Expression changes of lncRNA in the blood of AD patients
[0200] 1. RNA extraction and qPCR analysis
[0201] Collect the blood of 17 AD patients and 13 healthy volunteers (HAV) of the same age. Using this as experimental material, the qPCR technique was used to detect the expression levels of lncRNA in the sera of AD patients and the plasma of healthy volunteers (HAV) of the same age. The detection steps are as follows:
[0202] 1.1 Extraction of lncRNA from blood samples
[0203] Use the miRNeasy Serum RNA extraction kit from QIAGEN. The specific experimental operations are as follows:
[0204] (1) Serum sample collection: Collect the blood of AD patients and healthy controls using anticoagulant tubes. Centrifuge at 1000g for 15 min and take the upper serum. Aliquot 200 μL per tube and freeze at -80 °C in the refrigerator;
[0205] (2) Take 200 μL of serum, add 1 mL of QIAzol Lysis Reagent, invert and mix well, and let stand at room temperature for 5 min;
[0206] (3) Add 200 μL of chloroform, shake vigorously for 30 s, let stand at room temperature for 3 min, and centrifuge at 12000g at 4 °C for 15 min;
[0207] (4) Pipette the upper aqueous phase, add 1.5 volumes of absolute ethanol, and mix by oscillation;
[0208] (5) Pipette the upper aqueous phase and absolute ethanol mixture into an RNeasy MinElute spin column, centrifuge at 8000g for 30 s, discard the filtrate, and collect the RNA;
[0209] (6) Add 700 μL of RWT buffer, centrifuge at 8000g for 30 s, and discard the filtrate;
[0210] (7) Add 500 μL of RPE buffer, centrifuge at 8000g for 30 s, and discard the filtrate;
[0211] (8) Add 500 μL of 80% ethanol, centrifuge at 8000g for 2 min, and discard the filtrate;
[0212] (9) Place the RNA collection column back into the collection tube, centrifuge at 8000g for 5 min, discard the filtrate and the collection tube;
[0213] (10) Transfer the RNA collection column to a new 1.5 mL centrifuge tube, add 14 μL of RNase-free water dropwise, and centrifuge at 8000g for 1 min to elute and collect the RNA.
[0214] (11) Measure the concentration and purity of the RNA on a Spark 20M multi-functional microplate reader, store at -80 °C, and perform subsequent experiments.
[0215] 1.2 qPCR analysis
[0216] The analysis method was the same as that in step 6) RNA extraction and qPCR analysis to detect the relative expression levels of lncRNA Nucb1 in the blood of AD patients and healthy volunteers (HAV) of the same age. The results were as Figure 21 shown, where the results were expressed as mean ± SD, and * indicated P < 0.05 compared with the blood of healthy volunteers (HAV) of the same age.
[0217] In this example, the Mini-Mental State Examination (MMSE) was used to evaluate the cognitive function of the subjects. This scale included the following 7 aspects: time orientation, place orientation, immediate memory, attention and calculation ability, delayed memory, language, and visual space. There were a total of 30 questions. Each correct answer was scored 1 point, and an incorrect answer or answering "don't know" was scored 0 points. The total score range of the scale was 0 - 30 points. The MMSE assessment results of different patients were summarized in Figure 22 the following.
[0218] According to Figure 21 and 22 it could be seen that lncRNA Nucb1 was significantly down-regulated in the blood of AD patients and was significantly positively correlated with the MMSE score of AD patients (R 2 = 0.657, P < 0.001). Among them, the MMSE score results were used to evaluate the cognitive function of patients according to the Mini-Mental State Examination (MMSE) for Alzheimer's disease. The total score of the MMSE scale was 30 points. 0 - 9 points indicated severe cognitive impairment, 10 - 20 points indicated moderate cognitive impairment, 21 - 26 points indicated mild cognitive impairment, and > 27 points indicated normal cognitive function.
[0219] 2. ROC curve detection
[0220] Taking the expression level of lncRNA Nucb1 as the independent variable and AD patients and HAV healthy controls as the dependent variable, the sample values were substituted back. Taking the sensitivity as the ordinate (true positive rate) and 1 - specificity as the abscissa (false positive rate), the fitting ROC curves of each index were drawn to judge the value of the biomarker in the blood as an independent diagnosis and combined diagnosis. The results were as Figure 23 shown. According to Figure 23It can be seen that the receiver operating characteristic curve (ROC) analysis showed that Nucb1 exhibited good diagnostic value as a biomarker in the plasma of AD patients and healthy controls with hepatic steatosis (HAV). Nucb1 was significantly downregulated in the plasma of AD patients and was significantly positively correlated with the MMSE score of AD patients. The receiver operating characteristic curve (ROC) analysis showed that Nucb1 exhibited good diagnostic value as a biomarker in the plasma of AD patients and healthy controls with hepatic steatosis (HAV) (AUC = 0.964, Sensitivity = 100%, Specificity = 88.2%). Combined with Figures 21 - 23 , lncRNA Nucb1 was significantly downregulated during the pathological process of AD and had good clinical diagnostic value in the blood of AD patients.
[0221] In summary, during the process of lipopolysaccharide (LPS) / nigericin-induced pyroptosis of microglia, the expression of Nucb1 was also significantly downregulated, suggesting that it participates in the pathological process of AD by interfering with the process of microglial pyroptosis.
[0222] In addition, promoting the expression level of Nucb1 can inhibit the process of microglial pyroptosis and cytotoxicity. Microglia are the main immune cells in the central nervous system, and their abnormal activation is related to the neuroinflammation of AD. Since Nucb1 can inhibit the pyroptosis and cytotoxicity of microglia, it may reduce neuroinflammation, indicating that Nucb1 may become a new strategy for the prevention and treatment of AD.
[0223] Based on this, experimental techniques such as cytotoxicity detection (LDH release and PI / Hoechst 33342 staining), gene overexpression and silencing were used to explore the role and molecular mechanism of Nucb1 in the pathological process of microglial pyroptosis in AD. The results showed that overexpression of Nucb1 significantly inhibited the release of LDH in EOC20 cells co-stimulated with LPS / nigericin, inhibited cell swelling and death, and reduced pyroptotic cytotoxicity. In addition, the high expression levels of NLRP3, ASC, Caspase-1 p20, Cleaved GSDMD, IL-1β and IL-18 in the classical inflammasome pathway were significantly inhibited after overexpression of Nucb1, while knockdown of Nucb1 further promoted the expression of these protein molecules. The above results showed that overexpression of Nucb1 significantly inhibited the process of microglial pyroptosis and the level of cell pyroptosis was improved.
[0224] Microglia are the main immune cells in the central nervous system and play an important role in the pathological process of AD. In AD, microglia are activated in response to other damage signals such as β-amyloid (Aβ) plaques and Tau protein phosphorylation. Over-activated microglia release pro-inflammatory cytokines, leading to neuroinflammatory responses, which is one of the key factors in the progression of AD disease. The present invention first discovered a novel lncRNA Nucb1 specific to AD disease, which shows good clinical diagnostic value in the blood of AD patients. In addition, Nucb1 can inhibit the process of microglial pyroptosis and cytotoxicity, contribute to reducing the microglia-mediated inflammatory response, and thus have a positive impact on the pathological process of AD. In view of the above mechanism, up-regulating the expression of Nucb1 may help slow down the progression of AD and provide a new direction for the treatment of AD. Nucb1 has the potential to become a novel biomarker for diagnosing AD disease and a potential target for drug intervention.
[0225] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all embodiments. People can also obtain other embodiments without creative efforts as in this embodiment, and these embodiments all belong to the protection scope of the present invention.
Claims
1. Use of long non-coding RNA Nucb1 and / or miR-493-3p as a diagnostic marker for Alzheimer's disease, characterized in that, The nucleotide sequence of the long non-coding RNA Nucb1 is shown as SEQ ID NO.1; the nucleotide sequence of miR-493-3p is shown as SEQ ID NO.
2.
2. Use of a reagent for detecting the expression level of long non-coding RNA Nucb1 in the preparation of a diagnostic product for Alzheimer's disease, characterized in that, The nucleotide sequence of the long non-coding RNA Nucb1 is shown as SEQ ID NO.
1.
3. Use of long non-coding RNA Nucb1 and / or miR-493-3p in the preparation of a medicament for treating Alzheimer's disease, characterized in that, The nucleotide sequence of the long non-coding RNA Nucb1 is shown as SEQ ID NO.1; the nucleotide sequence of miR-493-3p is shown as SEQ ID NO.
2.
4. A biological material for overexpressing long non-coding RNA Nucb1, characterized in that, The biological material includes one or more of cDNA of the long non-coding RNA Nucb1, a primer set for amplifying the cDNA, a recombinant expression vector including the cDNA, and a recombinant microorganism including the recombinant expression vector.
5. The biomaterial according to claim 4, wherein The sequence of the cDNA is shown as SEQ ID NO.
3.
6. The biomaterial according to claim 4, characterized in that, The primer set includes a Nucb1-forward primer as shown in SEQ ID NO.8 and a Nucb1-reverse primer as shown in SEQ ID NO.
9.
7. The biomaterial according to claim 4, wherein The initial vector of the recombinant expression vector includes a plasmid vector.
8. The biomaterial according to claim 7, wherein, The plasmid vector includes a pcDNA3.1 expression vector.
9. Use of the biological material according to any one of claims 4 to 8 in the preparation of a medicament for treating Alzheimer's disease.
10. A drug for treating Alzheimer's disease, characterized in that, A biological material including overexpressing the long non-coding RNA Nucb1, and the nucleotide sequence of the long non-coding RNA Nucb1 is shown as SEQ ID NO.1.