Application of IFIT5 protein or coding gene thereof in regulation and control of poultry immune response

Abstract

The invention relates to an application abstract of IFIT5 protein or a coding gene thereof in regulation and control of poultry immune response. The invention belongs to the technical field of biology, and particularly relates to an application of chicken IFIT5 protein or a coding gene thereof in regulation and control of poultry immune response. Through transcriptome sequencing of MG infected cells and chicken lung tissues, the IFIT5 gene expression quantity is found to be remarkably increased. Through overexpression of the IFIT5 gene in chicken macrophages, it is found that the IFIT5 effectively inhibits MG proliferation and adhesion protein expression by activating I-type interferon, the resistance of poultry to MG is improved, and the IFIT5 can be applied to treatment of MG or used as a disease-resistant molecular marker. In addition, the dynamic change of IFIT5 in chicken primary alveolar type II epithelial cells and macrophages is related to the MG infection process, and a new target is provided for early diagnosis of MG. The discovery provides an important theoretical basis for MG diagnosis, MG prevention and poultry disease resistance breeding.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to application of IFIT5 protein or its encoding gene in regulating poultry immune response. Background Art

[0002] Mycoplasma gallisepticum (MG) is the main pathogen that causes chronic respiratory disease (CRD) in poultry. Chickens of different breeds, ages and genders can be infected all year round. MG spreads vertically and horizontally. Once it enters a poultry farm, it is difficult to eliminate. It spreads for a long time in the poultry farm and repeatedly infects. It is also a trigger for other bacterial and viral infections, causing huge economic losses to the poultry industry and has become a major problem that plagues the sustainable development of the poultry industry.

[0003] At present, the main means of prevention and control of MG are vaccination and antibiotics. Vaccination is difficult to provide long-term immunity and safe protection for poultry, while the abuse of antibiotics leads to frequent drug resistance and endangers food safety. Breeding disease-resistant varieties is one of the fundamental strategies to solve MG infection. Therefore, screening and identifying disease resistance / susceptibility genes is of great significance.

[0004] IFIT5 belongs to the type I interferon-stimulated gene and is the only member of the avian IFIT family. In antiviral immunity, it inhibits the replication of viral RNA (such as avian influenza virus) by binding to it, and can also inhibit the type I interferon pathway by disrupting the formation of the TBK1-IKKε-IRF3 signaling complex, indicating that IFIT5 plays a dual role in antiviral immunity. Previous studies by the research team found that the expression of IFIT5 in MG-infected chicken macrophages, alveolar cells, and lung tissues increased significantly, but its role in mycoplasma infection has not been reported. Therefore, exploring the role of IFIT5 in MG infection will help provide new strategies for the diagnosis and prevention of CRD. Summary of the invention

[0005] The purpose of the present invention is to provide application of IFIT5 protein or its encoding gene in regulating poultry immune response.

[0006] Another object of the present invention is to provide the use of IFIT5 protein or its encoding gene in regulating poultry's resistance to MG infection.

[0007] In order to achieve the above object, the present invention adopts the following technical measures:

[0008] In a first aspect, the present invention provides the application of IFIT5 in the diagnosis of MG, characterized in that the dynamic changes of the chicken IFIT5 gene in MG-infected cells are related to the MG infection process, and it is used to indicate that IFIT5 is used as a disease-resistant marker.

[0009] In a second aspect, the present invention provides the application of a preparation for promoting the expression of the chicken IFIT5 gene by targeting the IFIT5 protein or its coding gene in regulating the immune response of poultry, or in the prevention and treatment of MG infection.

[0010] The chicken IFIT5 gene described above includes the IFIT5 gene with the NCBI accession number NC_052537.1 in chickens or the IFIT5 gene homologous to this gene in chickens, the nucleotide sequence is shown as SEQ ID NO.1, and the amino acid sequence is shown as SEQ ID NO.2.

[0011] The increase in the expression of IFIT5 in the host cell or animal can be achieved by any technical means. In a specific embodiment of the present invention, the preparation for promoting the expression of the IFIT5 gene is a recombinant overexpression vector, and the recombinant overexpression vector is recombined by inserting the DNA sequence of the above-mentioned IFIT5 gene into the pcDNA3.1(+)-myc-His-C vector through the XhoI restriction site.

[0012] In a third aspect, the present invention provides the application of the IFIT5 protein or its coding gene in enhancing the immune response of poultry.

[0013] Preferably, the poultry in the present invention is a chicken.

[0014] Preferably, the immune response of the poultry refers to the immune response initiated by chickens sensing MG infection.

[0015] In a fourth aspect, the present invention provides a method for restricting the proliferation of MG using the IFIT5 protein or its coding gene.

[0016] Preferably, the IFIT5 gene in the present invention is ligated to the eukaryotic expression vector pcDNA3.1(+)-myc-His-C, which is easy to produce, has low cost and high efficiency, and provides a stable way to inhibit MG.

[0017] Preferably, the method is to transfect the above-mentioned expression vector into cells producing MG.

[0018] In a fifth aspect, the present invention provides the application of the IFIT5 protein or its coding gene in the ability to restrict the proliferation of MG.

[0019] In a sixth aspect, the present invention provides the application of the IFIT5 protein or its coding gene in inhibiting the inflammatory response induced by MG infection.

[0020] The beneficial effects of the present invention are as follows:

[0021] Based on the dynamic changes in the replication level of MG and the expression level of IFIT5 in host cells (chicken HD11 and chicken alveolar type II epithelial cells) at different stages of MG infection, it is found that as the expression level of the IFIT5 gene decreases, the proliferation of MG significantly increases. Further, by overexpressing the IFIT5 gene in chicken HD11 cells, it is found that IFIT5 can effectively increase the expression of type I interferon, significantly inhibit the replication, virulence protein expression and inflammatory response of MG, and enhance the host's resistance to MG. The discovery of the disease-resistant gene IFIT5 provides a new strategy for the diagnosis and prevention and control of MG. Brief Description of the Drawings

[0022] The present invention will be further described below in conjunction with the drawings. These displays are only for illustrating the embodiments of the present invention and are not intended to limit the scope of the present invention.

[0023] Figure 1 It is to detect the expression levels of the IFIT5 gene and the MG adhesion protein GapA gene in chicken HD11 cells and primary chicken alveolar type II epithelial cells at different time periods of MG infection by using qPCR technology.

[0024] Figure 2 It is to detect the promotion of IFIT5 expression by the IFIT5 overexpression vector in chicken HD11 cells by using qPCR technology.

[0025] Figure 3 It is to detect the expression levels of the IFN-α and IFN-β genes in chicken HD11 cells of the IFIT5 overexpression group and the control group at 0h, 6h, 12h and 24h of MG infection by using qPCR technology.

[0026] Figure 4 Overexpression of IFIT5 restricts the adhesion and proliferation of MG in chicken HD11 cells

[0027] Among them, (A) is to detect the expression level of the GapA gene in chicken HD11 cells of the IFIT5 overexpression group and the control group at 6h, 12h and 24h of MG infection by using qPCR technology.

[0028] (B) is to detect the copy number of the MG gene MGC2 in chicken HD11 cells of the IFIT5 overexpression group and the control group at 6h, 12h and 24h of MG infection by using absolute quantification technology.

[0029] Figure 5The expression levels of NF-κB / p-NF-κB and IκB / p-IκB proteins in chicken HD11 cells of the IFIT5 overexpression group and the control group at 0 h, 6 h, 12 h, and 24 h after MG infection were detected by Western blot technology.

[0030] Figure 6 The content of IL-1β protein in the supernatant of chicken HD11 cells of the IFIT5 overexpression group and the control group at 0 h, 6 h, 12 h, and 24 h after MG infection was detected by Elisa technology. Specific implementation mode

[0031] The technical solutions of the present invention will be further explained below in conjunction with the accompanying drawings and specific embodiments. Those skilled in the art make modifications and substitutions to the technical solutions of the present invention on the basis of fully understanding the technical solutions of the present invention, which all fall within the protection scope of the present invention.

[0032] Example 1 IFIT5 gene as a marker for MG infection

[0033] 1. Culture of primary chicken alveolar type II epithelial cells

[0034] Sterilely isolate the lung tissues of SPF eggs with similar size and weight of chicken embryos hatched for 13.5 - 14.5 days, and remove other tissues except lung tissues, such as trachea, lung mucosa, etc. The taken-out lung tissues are placed in a glass bottle pre-added with PBS, washed with PBS until the liquid is clear, and the chicken lung tissues are cut into 1 mm pieces with sterile scissors. Add 1 ml of pre-warmed 0.25% trypsin to each pair of lung tissues, pipette and mix evenly, place in a 37 °C, 5% CO2 incubator for digestion for 10 min, take out and shake once every 2 min. After the digestive juice becomes turbid and the cell clumps are completely digested, pipette with a pipette tip to form single cells, add an equal amount of medium containing 10% FBS to terminate digestion, centrifuge at 800 r / min for 10 min, and discard the supernatant. Resuspend the cell pellet with medium containing 0.1% type IV collagenase, place in a 37 °C, 5% CO2 incubator for digestion for 15 min, centrifuge, discard the supernatant, add medium containing 10% FBS, gently pipette and mix evenly, and filter the cells through a 70um cell sieve. Inoculate the above cell suspension into a cell culture dish, place in a 37 °C, 5% CO2 incubator for culture for 1 h, inoculate the non-adherent cell suspension into a new cell culture dish, and repeat the above operation twice to remove impurities by making fibroblasts adhere as much as possible. Collect the non-adherent suspension into a centrifuge tube, centrifuge at 1200 r / min for 5 min, resuspend with medium, centrifuge, and repeat 3 times. Resuspend the cells with medium containing 20% FBS, mix evenly, filter through a 40um cell sieve, and adjust the cell concentration of the cell filtrate to 1.5×10 6cells / mL, and the adjusted cells were seeded into a cell culture plate and cultured in an incubator at 37°C with 5% CO2 for 18 h. After 18 h of culture, the medium was changed, and the adherent cells were chicken alveolar type II epithelial cells.

[0035] 2. Culture of chicken HD11 cells

[0036] (1)Resuscitation of chicken HD11 cells: The cryopreserved cells were taken out from the -80°C refrigerator and quickly thawed in a 37°C water bath, and the cryopreservation tube was shaken constantly during the thawing process; the thawed cell mixture was transferred into a 15 mL centrifuge tube, 4 mL of cell culture medium was added, and centrifuged at 1000 r / min for 5 min, and the supernatant was discarded; 1 mL of cell culture medium was added to resuspend the cells, which were seeded into a culture flask and the medium was supplemented to 4 mL; the culture flask was gently shaken to evenly spread the cells on the bottom of the flask, and placed in an incubator at 37°C with 5% CO2 for culture, and the cell growth status was observed at any time.

[0037] (2)Subculture of chicken HD11 cells: Observe the cells. When the cells in the culture flask are basically confluent and the cell density reaches more than 90%, the cells need to be subcultured. The basic subculture operation is as follows: Aspirate the cell culture medium in the culture flask, add PBS to wash the cells, and repeat the operation twice; after discarding the PBS, add an appropriate amount of trypsin to cover the bottom of the flask, place it in the incubator and let it stand for 1 min, observe the cell digestion situation under the microscope, and add cell culture medium with twice the volume of trypsin to terminate the digestion when the cells begin to shrink, become round and smaller; pipette the cells in the culture flask to form a single cell suspension; collect the cell suspension into a 15 mL centrifuge tube, centrifuge at 1000 r / min for 5 min, and discard the supernatant; resuspend the cells with cell culture medium, transfer the cells into a new culture flask, supplement an appropriate amount of cell culture medium, and place it in a constant temperature incubator at 37°C with 5% CO2 for culture, and observe the cell growth status at any time.

[0038] (3)Cryopreservation of chicken HD11 cells: Select cells with strong growth. After the cells are basically confluent in the culture flask, according to the cell subculture operation steps, finally resuspend the collected cell pellet with cell cryopreservation solution, aliquot it into cryopreservation tubes, mark the cryopreservation tubes and cryopreserve them at -80°C.

[0039] 3. Construction of MG-infected cell model

[0040] One day before, an appropriate amount of cells were seeded into a 6-well cell culture plate. When the cell density reached about 80% and the cell state was good, a cell challenge test was performed. A control group was set up. The original cell culture medium was aspirated, washed twice with PBS buffer, and replaced with fresh 2 mL of cell culture medium. 100 μL of the virus with a virulence of 1×10 8MG of CCU. Place a 6-well cell culture plate in an incubator at 37 °C with 5% CO2 for culture. Collect samples of chicken HD11 cells at 0 hour, 6 hours, 12 hours, and 24 hours after MG infection, and collect samples of chicken alveolar type II epithelial cells at 0 hour, 6 hours, 12 hours, 24 hours, and 48 hours after MG infection.

[0041] 4. Extraction of total cellular RNA

[0042] Aspirate and discard the cell culture medium, wash 3 times with PBS, and resuspend and collect the cells by adding 1 mL of RNA isolater Total RNA Extraction Reagent (Vazyme R401-01) to each well. Add chloroform at 1 / 5 of the volume of the cell suspension to the collected cells, shake vigorously, let stand at room temperature for 3 min, and centrifuge at 12,000 r / min for 15 min at 4 °C; aspirate the supernatant into a new 1.5 mL RNase-free centrifuge tube, add an equal volume of isopropanol, invert the centrifuge tube several times to mix well, let stand at -20 °C for 15 min, centrifuge at 12,000 r / min for 15 min at 4 °C, and discard the supernatant; add 1 mL of 75% ethanol to wash the precipitate, centrifuge at 7,800 r / min for 5 min at 4 °C, discard the supernatant, and repeat 2 times. Let stand at room temperature until dry, add an appropriate amount of DEPC water to dissolve the RNA precipitate, detect the integrity of RNA by electrophoresis, measure the concentration and purity of RNA with a NanoDrop-2000 instrument, and store the RNA at -80 °C.

[0043] 5. Reverse transcription

[0044] Further reverse transcribe the RNA into a cDNA library according to the instructions of HiScript II Q RT SuperMix for qPCR (Vazyme R223-01).

[0045] 6. Detection of the expression levels of the IFIT5 gene and the GapA gene by qPCR:

[0046] Retrieve the gene sequences of each gene in the NCBI database and design PCR primers. Using cDNA as a template and GAPDH as an internal reference gene, perform qPCR according to ChamQ SYBR qPCR Master Mix (Vazyme Q311-02) to detect the expression of the IFIT5 gene and the GapA gene.

[0047] The qPCR reaction procedure is as follows: 95 °C: 3 min; (95 °C: 25 s; 58 °C: 25 s; 72 °C: 25 s) × 40.

[0048] The primers are as follows:

[0049] IFIT5-F: CTCAAGCTGAAGCACTCCGA

[0050] IFIT5-R: ATCATCCGGTCATCGTCTGC

[0051] GapA-F: CAAGGTGCGTTCATTAGT

[0052] GapA-R: GGATTGTTTTGAGGTGGA

[0053] GAPDH-F: GAGGGTAGTGAAGGCTGCTG

[0054] GAPDH-R: CACAACACGGTTGCTGTATC

[0055] 7. Results

[0056] See Figure 1 , which shows the expression levels of IFIT5 gene and GapA gene in primary chicken alveolar type II epithelial cells infected with MG for 0 h, 6 h, 12 h, 24 h and 48 h and in chicken HD11 cells infected with MG for 0 h, 6 h, 12 h and 24 h detected by qPCR. Using GAPDH as an internal reference, the relative expression levels of IFIT5 and GapA to GAPDH were calculated by the 2 -ΔΔct method. As can be seen from the figure, the dynamic changes of IFIT5 gene in MG-infected cells are related to the MG infection process.

[0057] Example 2 Overexpression of IFIT5 recombinant vector promotes IFIT5 expression

[0058] 1. Construction of IFIT5 overexpression vector

[0059] Retrieve the chicken IFIT5 CDS region sequence in the NCBI database, design primers to amplify and purify the full-length CDS region sequence of IFIT5, and insert the purified IFIT5 gene into the linearized vector pcDNA3.1(+)-myc-His-C treated with XhoI restriction endonuclease. The primers are

[0060] F: GCACAGTGGCGGCCGCTCGAGATGAGTACCATTTCCAAGAATTCC

[0061] R: GTTCGAATGGGTGACCTCGAGCGCTTGAGAGGGAAAGTC

[0062] The specific operation steps are as follows:

[0063] (1)Using chicken lung tissue cDNA as a template, amplify the full-length CDS region of IFIT5 according to the Phanta Max Super-Fidelity DNA Polymerase kit (Vazyme P505-d1).

[0064] (2)Gel extraction of the full-length amplification product of the IFIT5 CDS region

[0065] Recover the amplified product of the IFIT5 CDS region according to the instructions of the Universal DNA Purification and Recovery Kit (Tiangen DP214-03).

[0066] (3)Digest the pcDNA3.1(+)-myc-His-C complete plasmid

[0067] Use the XhoI restriction endonuclease (Thermo Fisher FD0694) quick cutter to digest the pcDNA3.1(+)-myc-His-C complete plasmid.

[0068] (4)Ligation of the recovered products

[0069] Ligate the recovered IFIT5 CDS fragment with the pcDNA3.1(+)-myc-His-C fragment according to the ClonExpress Ultra One Step Cloning Kit V3 (Vazyme C117-02).

[0070] (5)Transformation of the ligation product

[0071] Transform the recombinant product into DH5α competent cells according to the instructions of DH5α Chemically Competent Cell (TSINGKE TSC-C14). The next day, pick a single colony into a sterile 1.5 mL centrifuge tube, add 1 mL of LB liquid medium containing 1‰ ampicillin, and culture it at 37°C with shaking at 220 r / min for 6 h.

[0072] (6)Plasmid extraction

[0073] Extract the plasmid of the positive bacterial solution with correct sequencing using the EndoFree Mini Plasmid Kit II (Tiangen DP118-03) kit. Store the plasmid at -20°C.

[0074] 2. The culture of chicken HD11 cells refers to Example 1.

[0075] 3. Construct an IFIT5 overexpression cell model

[0076] Prepare a cell suspension of chicken HD11 cells in the logarithmic growth phase according to the steps of subculturing chicken HD11 cells, add an appropriate amount of medium, inoculate it into a 6-well plate, and culture for 12 - 24 h. When the cell density reaches about 70%, perform transfection according to the instructions of the jetPRIME transfection reagent. Set up groups: the IFIT5 overexpression group and the control group. Culture the cells for 24 h and conduct subsequent experiments.

[0077] 4. Extraction, reverse transcription, and qPCR detection of total cellular RNA to detect the expression of the IFIT5 gene refer to Example 1.

[0078] 5. Results

[0079] See Figure 2 , which shows the efficiency of IFIT5 overexpression detected by qPCR. IFIT5 is the experimental group, and Vector is the control group. Using GAPDH as the internal reference, the relative expression levels of IFIT5 and GAPDH were calculated using the 2 -ΔΔct method. As can be seen from the figure, IFIT5 significantly promotes the expression of IFIT5.

[0080] Example 3 IFIT5 Promotes the Expression of Type I Interferon

[0081] 1. Culture of chicken HD11 cells and construction of the IFIT5 overexpression cell model refer to Example 1 and Example 2.

[0082] 2. After constructing the IFIT5 overexpression cell model, infect chicken HD11 cells with MG at a virulence of 1×10 8 CCU, and collect the cellular RNA of MG-infected cells at 0 h, 6 h, 12 h, and 24 h respectively.

[0083] 3. Extraction of cellular RNA and cDNA synthesis refer to Example 1.

[0084] 4. qPCR detection of the expression of type I interferon IFN-α and IFN-β genes.

[0085] Retrieve the gene sequences in the NCBI database and design PCR primers. Using cDNA as the template and GAPDH as the internal reference gene, detect the expression of IFN-α and IFN-β genes, and the reaction program refers to Example 1. The quantitative primers are as follows:

[0086] IFN-α-F: AACCACCCACGACATCCTTC

[0087] IFN-α-R: TGTCGCTGCTGTCCAAGC

[0088] IFN-β-F: GTGCTTGTACCTGGGACCAT

[0089] IFN-β-R: GGAGGAAGGCTTAGCGAGTG

[0090] 5. Results

[0091] See Figure 3 , which shows the expression levels of IFN-α and IFN-β in IFIT5 overexpressing cells infected with MG for 0 h, 6 h, 12 h, and 24 h detected by qPCR. IFIT5+MG is the experimental group, and Vector+MG is the control group. Using GAPDH as the internal reference, the relative expression levels of IFN-α and IFN-β to GAPDH were calculated using the 2 -ΔΔct method. As can be seen from the figure, IFIT5 can effectively promote the expression of IFN-α and IFN-β.

[0092] Example 4 IFIT5 restricts the adhesion and proliferation of MG

[0093] 1. The culture of chicken HD11 cells and the construction of the IFIT5 overexpressing cell model were referred to Example 1 and Example 2.

[0094] 2. After constructing the IFIT5 overexpressing cell model, infect chicken HD11 cells with MG with a virulence of 1×10 8 CCU, and collect the cell RNA and DNA at 6 h, 12 h, and 24 h after MG infection, respectively.

[0095] 3. The extraction of cell RNA, cDNA synthesis, and qPCR detection of the expression of the GapA gene were referred to Example 1.

[0096] 4. Extraction of cell DNA

[0097] Discard the cell culture medium, wash 3 times with PBS, add 1 mL of PBS, scrape and collect the cells with a cell scraper into a 1.5 mL centrifuge tube, centrifuge at 1000 r / min for 5 min, and discard the supernatant. Extract the cell genomic DNA according to the instructions of the Blood / Cell / Tissue Genomic DNA Extraction Kit (Tiangen DP304-02).

[0098] 5. Use absolute quantification to detect the copy number of the MG gene MGC2

[0099] Using DNA as a template, primers MGC2-F: GGATGAGAACCAGTAGGGCG, MGC2-R: CTCCTTGAATGTCACCCGCT, perform qPCR to detect the expression of MGC2 according to ChamQ SYBR qPCR Master Mix (Vazyme Q311-02), and obtain its copy number according to the MGC2 standard curve.

[0100] 6. Results

[0101] See Figure 4 A, which shows the expression level of GapA in IFIT5-overexpressing cells infected with MG for 6 hours, 12 hours, and 24 hours detected by qPCR. IFIT5+MG is the experimental group, and Vector+MG is the control group. Using GAPDH as an internal reference, the relative expression levels of GapA and GAPDH were calculated using the 2 -ΔΔct method. As can be seen from the figure, IFIT5 effectively inhibits the expression of GapA.

[0102] See Figure 4 B, which shows the copy number of MG in IFIT5-overexpressing cells infected with MG for 6 hours, 12 hours, and 24 hours detected by qPCR. IFIT5+MG is the experimental group, and Vector+MG is the control group. As can be seen from the figure, IFIT5 effectively inhibits the proliferation of MG.

[0103] Example 5 IFIT5 inhibits the activation of the NF-κB pathway

[0104] 1. The culture of chicken HD11 cells and the construction of the IFIT5-overexpressing cell model were referred to Example 1 and Example 2.

[0105] 2. After constructing the IFIT5-overexpressing cell model, chicken HD11 cells were infected with MG with a virulence of 1×10 8 CCU, and cell proteins were collected at 0 hour, 6 hours, 12 hours, and 24 hours after MG infection, respectively.

[0106] 3. Aspirate the cell culture medium, wash 3 times with PBS, collect cell protein samples according to the instructions of the lysis buffer (Affinibody AIWB-012), measure and adjust the protein concentration by the BCA method (abbkine KTD3001), then add the loading buffer (Affinibody AIWB-0025), and incubate at 100 °C for 5 min to denature the proteins. The protein samples were aliquoted and stored at -20 °C.

[0107] 4. Western blot:

[0108] (1) Prepare the gel according to the instructions of the One-Step PAGE Gel Fast Preparation Kit (Vazyme E304-01), insert the prepared gel plate into the electrophoresis tank, add the electrophoresis buffer, and add the samples and protein Marker to the sample loading wells; first electrophorese at a constant voltage of 80 V. When the samples electrophorese into the separating gel, increase the voltage to 120 V and electrophorese for about 1.5 h until the loading buffer migrates to the bottom of the separating gel, then stop electrophoresis.

[0109] (2) Cut out the gel of the membrane to be transferred. Take filter paper and PVDF membrane and soak them in the electrotransfer buffer (the PVDF membrane was pre-soaked in methanol for 5 min). Stack the sponge, filter paper, gel, PVDF membrane, filter paper, and sponge in sequence, ensuring no air bubbles in each layer. The PVDF membrane side is connected to the anode, and the gel side is connected to the cathode. Transfer the membrane at a constant current of 200 mA at 4°C for 40 - 60 min.

[0110] (3) Incubate the PVDF membrane in a 5% skim milk powder solution on a shaker for 2 h.

[0111] (4) Immerse the membrane in the primary antibody solution diluted with the blocking solution and incubate overnight at 4°C. Rinse with TBST 5 times, 10 min each time.

[0112] (5) After washing, take out the membrane and immerse it in the secondary antibody solution diluted with TBST. Incubate on a shaker at room temperature for 1 h. Take out the PVDF membrane and wash it with TBST 5 times, 10 min each time.

[0113] (6) Mix solution A and solution B in the ECL kit at a ratio of 1:1. After mixing, evenly drip the mixture onto the membrane and take a picture with the instrument.

[0114] 5. Results

[0115] See Figure 5 , which shows the expression levels of NF-κB / p-NF-κB and IκB / p-IκB proteins in IFIT5 overexpressing cells infected with MG for 0 h, 6 h, 12 h, and 24 h detected by Western blot assay. Lanes 1 - 4 are the control group infected with MG for 0 h, 6 h, 12 h, and 24 h, and lanes 5 - 8 are the experimental group infected with MG for 0 h, 6 h, 12 h, and 24 h. As can be seen from the figure, IFIT5 effectively inhibits the phosphorylation of NF-κB and IκB, indicating that IFIT5 inhibits the activation of the NF-κB pathway.

[0116] Example 6 IFIT5 inhibits the expression of inflammatory factors

[0117] 1. The culture of chicken HD11 cells and the construction of the IFIT5 overexpressing cell model were referred to Example 1.

[0118] 2. After constructing the IFIT5 overexpressing cell model, infect chicken HD11 cells with MG with a virulence of 1×10 8 CCU, and collect the cell supernatants at 0 h, 6 h, 12 h, and 24 h after MG infection respectively. Aliquot and store at -20.

[0119] 3. Use an Elisa kit (Meimian MM-36910O1) to detect the content of the inflammatory factor IL-1β in the cell supernatant.

[0120] 4. Results

[0121] See Figure 6 , which shows the protein content of IL-1β in the supernatants of IFIT5 overexpressing cells infected with MG at 0 h, 6 h, 12 h, and 24 h detected by Elisa assay. IFIT5+MG is the experimental group and Vector+MG is the control group. As can be seen from the figure, the IFIT5 overexpression vector can effectively inhibit the secretion of IL-1β.

[0122] For all the above data, ANOVA analysis or two-tailed t-test was performed using SPSS 22.0 software. When p < 0.05, the difference was considered significant.

[0123] SEQ ID NO.1

[0124] Nucleotide sequence of chicken interferon induced protein with tetratricopeptide repeats 5 (IFIT5) gene:

[0125]

[0126] SEQ ID NO. 2

[0127] Amino acid sequence of chicken interferon induced protein with tetratricopeptide repeats 5 (IFIT5) gene:

[0128] MSTISKNSLKNSLLQLECYFTWTLLKEDVDLDSLEESIEDQIEFFIKPNISNYNLLSYVYHLKLSDEEALEYLQKAEEEIKKYYPGEIDRRSLVTWGNYAWIYYHMGRYEEAQVYINKVENSCKKLSNTAHLKIQLPEIYAEQGFALLKFGGKYYNRAKECFKNALREEPNNPEFNAGYAIAVYRLEEFSYRRCEEVDSSLEPLKRALKLNPMDTYLLALLALKLQDSDQVDEAEKCIEEGMKKTPYLPYFLRYAAKFYRRKKELDKAQEVLERALEISPKSTFLLHQLGLCYRAKLYELKNSTRYPPQDQIEELIQICISHFKVVTEQKPKFFSALIDLARMYAEANMYRKAEETFQKALNVNILTCSNKQEICYFYGNFLQYKKKSESEAIKYYKEGLKNGNYCFAEKIRQYLKRLLEKRIQGGLGGEDDFSTLGLIHKLDGEKLEAIECYEKANEYNPDNEEYLSVLLELRLSLSS

Claims

1. Use of the IFIT5 protein or its coding gene in regulating the innate immune response of poultry; Among them, The reference sequence number of the IFIT5 gene from chicken on NCBI is NM_001320422.

2.

2. The application according to claim 1, wherein The innate immune response of the poultry refers to the chicken's perception of Mycoplasma gallisepticum infection and the initiation of an immune response.

3. The application according to claims 1-2, characterized in that, When the expression level of the IFIT5 gene or protein increases, the innate immune response of the poultry is enhanced.

4. Use of the IFIT5 gene as a target gene in improving the innate immune response ability of poultry; Among them, The poultry is a chicken.

5. Use of the IFIT5 protein or its coding gene in regulating the resistance of poultry to MG infection; Among them, The poultry is a chicken.

6. The application according to claim 5, wherein When the expression level of the IFIT5 gene or protein increases, the resistance of the poultry to MG infection is enhanced.

7. Use of an activator of the IFIT5 gene or protein.

8. The use according to claim 7, characterized in that: ① A nucleic acid molecule capable of encoding IFIT5, or an expression cassette or recombinant vector containing the nucleic acid molecule, or an IFIT5 promoter; ② Preparation of a product for improving the innate immune response ability of poultry ③ Preparation of a product for preventing and / or treating the replication and infection of Mycoplasma gallisepticum; ④ Preparation of a cell model or animal model with enhanced resistance to Mycoplasma gallisepticum.

9. Use of an IFIT5 protein or its coding gene in the diagnosis of Mycoplasma gallisepticum. Among them, The reference sequence number of the IFIT5 gene from chicken on NCBI is NM_001320422.

2.

10. The application according to claim 9, characterized in that The dynamic change of the expression of the IFIT5 gene is related to the infection process of Mycoplasma gallisepticum, and is used as a disease resistance marker for Mycoplasma gallisepticum or for the early diagnosis of Mycoplasma gallisepticum.

Images