A single nucleotide polymorphism (SNP) primer for the Robo2 gene related to the natural musk yield trait of forest musk deer and its application

Abstract

The present invention relates to a single nucleotide polymorphism SNP primer of the Robo2 gene related to the yield trait of natural musk deer and its application, belonging to the field of biological detection technology. The present invention provides a single nucleotide polymorphism SNP primer of the Robo2 gene related to the yield trait of natural musk deer. The molecular marker corresponding to the SNP primer is located at the 27263478th base of chromosome 1 of the musk deer reference genome. The base mutation is A or G, and the genotype is AA, AG, GG. The deoxyribonucleotide sequence of the SNP primer is shown in SEQ ID NO: 1 and SEQ ID NO: 2. Its beneficial effect is that it can efficiently and quickly identify the high-yield musk trait of musk deer, and provide a scientific basis for the early breeding of high-quality musk deer. In addition, the detection method disclosed by the present invention is simple and easy to operate, can be carried out in the laboratory, and can also be applied to genomic breeding technology.

Description

Technical Field

[0001] The invention relates to a single nucleotide polymorphism (SNP) primer of a Robo2 gene related to the yield trait of natural musk deer larvae and application thereof, belonging to the technical field of biological detection. Background Art

[0002] Musk deer are a rare medicinal animal. The musk secreted by adult males is a raw material for traditional Chinese medicine and high-end spices. However, the sharp decline in wild musk deer populations has led to an extreme scarcity of musk resources. Although my country has been cultivating musk resources since 1958, the lack of mature breeding technology has made it difficult to meet market demand, and the price of musk remains as low as "soft gold."

[0003] Musk is a primary scent secreted by scent gland cells located in the scent sacs on the abdomen of adult male forest musk deer. After a long period of maturation, it eventually matures into mature musk. Musk has a wide range of applications, including treating a variety of ailments. Records of its use in my country date back as far as 2,000 years. For the forest musk deer itself, the intense scent emitted during mature stages is a ubiquitous chemical signaling molecule in nature. It is used for intraspecific communication, mutual recognition, territory marking, and as a crucial means of attracting mates during the breeding season. Musk, as a pheromone, is a key adaptive trait for the survival and reproduction of musk deer. Research on musk not only reveals the subtle mechanisms of chemical ecology but also provides a scientific basis for the conservation of endangered species. Musk also has a significant contribution to medicine, with applications in various cardiovascular and central nervous system disorders, as well as anti-inflammatory and anti-tumor treatments. Therefore, research on increasing musk production is urgent. There are also differences in musk production between different individuals. Therefore, from the perspective of genetic genes, it is urgent to find suitable molecular markers to quickly and accurately identify high-musk-producing musk deer individuals, so as to realize early breeding and achieve the goal of increasing natural musk production. Summary of the Invention

[0004] The purpose of the present invention is to address the defects of the existing technology and propose a single nucleotide polymorphism (SNP) primer of the Robo2 gene related to the yield traits of natural musk deer and its application to quickly and accurately identify the yield-related traits of musk deer.

[0005] The Robo2 gene, a core member of the Slit-Robo signaling pathway, plays a key role in various biological processes, including the development of organs such as the kidneys, blood vessels, and glands, and regulating functions such as cell migration. Previous studies have shown that during the musk secretion period, serum testosterone levels in forest musk deer increase, and musk gland cells become sensitive to sex hormones. Hormonal changes play a key role in musk secretion. Testosterone, a male hormone, stimulates the proliferation and differentiation of musk gland cells, promoting musk synthesis and secretion. During musk secretion, Robo2 may regulate the directional migration of musk gland epithelial cells, influencing the formation of alveoli and ducts, and thus affecting the secretory capacity of the glands. Furthermore, the high metabolic activity during musk gland secretion depends on an adequate blood supply. Robo2 may also participate in the development of the gland's microvascular network, supporting the synthesis and transport of musk-related metabolites. Studies on musk yield traits in forest musk deer have shown a significant correlation between the Robo2 gene and musk yield traits.

[0006] This study considers the influence of environmental and genetic factors on musk yield. We collected musk yields from healthy adult musk deer aged 3-5 years under the same conditions to eliminate errors caused by environmental and age factors, and to explore the relationship between musk yield and its genetic factors. Using live musk extraction technology, we collected and recorded musk yields from musk deer for three years. Whole-genome resequencing was used to perform SNP genotyping analysis on musk deer. Whole-genome association analysis identified a Robo2 gene molecular marker significantly associated with musk yield, providing new genes and molecules for breeding high-yield musk deer.

[0007] The present invention solves the technical problem through the following technical solution: First, a single nucleotide polymorphism (SNP) primer for the Robo2 gene, which is associated with the natural musk yield trait of the forest musk deer, is provided. The site corresponding to the SNP primer is located at base 27263478 on chromosome 1 of the forest musk deer reference genome, with the base mutation to A or G, and the sequence is shown as base 216 in SEQ ID NO:3 or SEQ ID NO:4; the deoxyribonucleotide sequence of the SNP primer is shown in SEQ ID NO:1 and SEQ ID NO:2. The forest musk deer reference genome is the only high-quality forest musk deer reference genome at the chromosome level successfully assembled in 2022 and is published on the website http: / / muskdb.cn / .

[0008] The present invention further provides the use of SNP primers for the Robo2 gene related to the yield trait of musk deer, including molecular detection for detecting the yield trait of musk deer. The specific detection method includes the following steps:

[0009] The first step is to detect the musk deer DNA sample and perform PCR amplification using the SNP primers to obtain an amplified product;

[0010] The second step is to perform Sanger sequencing on the amplified product;

[0011] The third step is to determine the molecular marker genotype of the target site based on the sequencing results obtained in the second step.

[0012] The SNP primers in the first step of the above method are divided into

[0013] Upstream primer: 5'- TTTGTCTTCTTGTAACATTCCC-3' (SEQ ID NO: 1)

[0014] The downstream primer consists of 5'-TTCTCTACTGTGTCTTGCTGGG-3' (SEQ ID NO: 2). The amplified product is 486 bp in length and includes the 27263478th base on chromosome 1 of the forest musk deer.

[0015] In the first step, the final volume of the reaction system is 50 μl.

[0016] Musk deer DNA 4ng

[0017] 2 x Accurate Taq Master Mix 25μl

[0018] Upstream primer (10 μm / L) 2 μl

[0019] Downstream primer (10 μm / L) 2 μl

[0020] Sterile water is added to make up to 50 μl.

[0021] The reaction conditions for PCR amplification were as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 58°C for 15 sec, extension at 72°C for 15 sec, for a total of 35 cycles, and extension at 72°C for 5 min; and storage at 4°C.

[0022] The nucleotide sequence of the obtained amplified product is shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0023] In the third step, the judgment criterion is that the musk yield of the musk deer with the A / A genotype at the SNP site is higher than that of the A / G and G / G genotypes.

[0024] The present invention detects the genotype of the relevant traits of musk deer production by using the Robo2 gene molecular marker, and finds that the yield of individual musk deer with A / A genotype is higher than that of A / G and G / G genotypes. By using the genomic DNA of the musk deer to be tested as a template, using a specific primer pair to perform PCR amplification, and then performing Sanger sequencing and SNP molecular marker genotyping on the PCR amplification product, the musk yield trait of the musk deer can be selected based on the genotype of the SNP molecular marker. In breeding, according to the breeding goals, by eliminating the G / G genotype individuals and retaining the A / A or A / G genotype individuals, the beneficial effect is that the high-yield musk traits of the musk deer can be identified efficiently and quickly, providing a scientific basis for the early selection of high-quality musk deer. In addition, the detection method disclosed in the present invention is simple and easy to operate, can be carried out in the laboratory, and can also be applied to genomic breeding technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the Manhattan plot of the GWAS analysis of musk deer yield-related traits.

[0026] Figure 2 These are the Sanger sequencing results of the PCR amplification products of the two genotypes.

[0027] Figure 3 This is a violin plot of the phenotypic distribution of individuals with three genotypes of the chr1: 27263478 molecular marker. DETAILED DESCRIPTION

[0028] The following examples are applicable to the breeding of forest musk deer.

[0029] Example

[0030] In this example, the musk yield trait of forest musk deer was measured, SNP genotyping was performed using whole genome resequencing technology, and the Robo2 gene molecular marker significantly associated with musk yield was screened through whole genome association analysis. The results are as follows: Figure 1 shown.

[0031] This example uses the following experiments to identify and apply the Robo2 gene molecular marker related to the musk deer yield trait

[0032] 1. Phenotypic and genotypic testing

[0033] (1) Experimental materials and annual musk deer production determination

[0034] A total of 123 adult male forest musk deer were selected as experimental animals and housed under identical conditions with free access to food and water. Musk was collected from the musk deer in a harmless manner during the musk-bearing season (October each year). Musk production was recorded over a three-year period from 3 to 5 years of age.

[0035] (2) Extraction of genomic DNA

[0036] 1. According to the instructions of the TianGen DP602 kit, select 20 hairs with relatively rounded follicles. Aseptically collect the follicles (1 cm in length) and place them in an EP tube. Add 400 μl of Buffer GHA and 20 μl of Proteinase K reagent, mix thoroughly, centrifuge, and digest in a 65°C water bath overnight.

[0037] 2. Centrifuge the digested sample briefly and transfer it to a TGuide 96 deep-well plate. Place the 96 deep-well plate on the 96 deep-well plate base of the TGuide S16 fully automated nucleic acid extraction and purification instrument.

[0038] 3. Run the automatic extraction program of the TGuide S16 fully automatic nucleic acid extraction and purification instrument. The program is as follows:

[0039] slot name Mixing time (min) Magnetic segments Each magnetic attraction time (sec) Magnetic attraction speed (mm / s) 1 Cracking 2 1 0 6 Transfer magnetic beads 0.5 5 3 2.5 1 Combine 10 5 4 2.5 2 Rinse 1 5 5 3 2.5 3 Rinse 2 5 5 3 2.5 4 Rinse 3 5 5 3 2.5 5 Elution 10 5 5 2.5 6 Place magnetic beads 0.5 1 0 .

[0040] 4. After the program is completed, collect the DNA extract aseptically and store it at 4℃ for later use.

[0041] (3) PCR amplification

[0042] Using the genomic DNA extracted above as a template, a fragment containing the SNP molecular marker at base position 27263478 on chromosome 1 of the forest musk deer was amplified.

[0043] Upstream primer: 5'- TTTGTCTTCTTGTAACATTCCC-3' (SEQ ID NO: 1)

[0044] Downstream primer: 5'- TTCTCTACTGTGTCTTGCTGGG-3' (SEQ ID NO: 2)

[0045] The length of the amplified product is 486 bp, and the final concentration of the reaction system in 50 μl is:

[0046] Musk deer DNA 4ng

[0047] 2 x Accurate Taq Master Mix 25μl

[0048] Upstream primer (10 μM / L) 2 μl

[0049] Downstream primer (10 μm / L) 2 μl

[0050] Add sterile water to 50 μl.

[0051] The reaction conditions for PCR amplification were as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 58°C for 15 sec, extension at 72°C for 15 sec, for a total of 35 cycles, and extension at 72°C for 5 min; storage at 4°C; 10 μl was taken for agarose detection, and a single target band with a length of 486 bp was amplified, containing bases 27,263,478 of chromosome 1 of musk deer.

[0052] Sequence as SEQ ID NO:3

[0053] ATGGATTGTGAGTTTAGCCTTCTAATATAGAGATTAGGGACAAATGTAGTCCTAAAGTGTACCTATAAGTTATCGATTTTTAAAAAATCTACTTGTTTAAAACTTTTAGAGACATTTACAGAGACATGTGTTGGAAAACATTATCTAATATGCGTATGCAAGAGAATATTTAGCAAGAAAAAAGATTTTAAGGGTATTACTGATTGTTGTGACAGATACTAATACATACAATTATGGGGGGAA ATATACCAGTTTTCAATGGACAAAATGGGAAATTAAATGATGTTTTATTTTATTGAAATTCTTTGGAACTGAGAAAATGCAGGGAGTTTGTGCAAGTTAAGCTGTGAGTAGTATTTGAAATAATGTCACTGAATTAAAGAGTCCATACCACTTCCCCATTCTCGTTTAGACAGAAATGTCTCTAGGTCTAAAATATGATATGCAATATGAGATAAAACTGTTCATATACCCAGCAAGACAG,

[0054] SEQ ID NO: 4

[0055] CACCGAGGTGAGTTTAGCCTTCTATATAGAGATTAGGGACAAATGTAGTCCTAAAGTGTACCTATAAGTTATCGATTTTTAAAAAATCTACTTGTTTAAAACTTTTAGAGACATTTACAGAGACATGTGTTGGAAAACATTATCTAATATGCGTATGCAAGAGAATATTTAGCAAGAAAAAAGATTTTAAGGGTATTACTGATTGTTGTGACAGGTACTAATACATACAATTATGGGGGGAA ATATACCAGTTTTCAATGGACACAAAATGGGAAATTAAATGATGCTTTATTTTATTGAAATTCTTTGGAACTGAGAAAATGCAGGGAGTTTGTGCAAGTTAAGCTGTGAGTAGTATTTGAAATAATGTCACTGAATTAAAGAGTCCATACCACTTCCCCATTCTCATTTAGACAGAAATGTCTCTAGGTCTAAAATATGATATGCAATATGAGATAAAACTGTTCATATACCCAGCAAGACCG shown.

[0056] (4) Sequencing verification and genotyping

[0057] The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peak diagram was as follows: Figure 2 shown.

[0058] 2. Results Analysis

[0059] The correlation analysis between the annual musk production of 123 musk deer aged 3-5 years old collected harmlessly from the Malkang musk deer farm was conducted using the live musk extraction technology. The t.test test function of R4.0 software was used for statistical testing, and the pairwise mean comparison mode was selected to conduct statistical tests on the genotypes of the experimental musk deer and the average musk production of musk over three years. P <0.01 indicates that the difference is extremely significant. The results are shown in Table 2 and Figure 3 As shown, among the tested individuals, there were 17 AA genotypes, 29 AG genotypes, and 77 GG genotypes. The musk yield of the three genotypes was significantly different. The average musk yield of the AA genotype was 19.37g, which was significantly higher than the average musk yield of the AG genotype (13.07g). P < 0.01); the average musk yield of AG genotype was significantly higher than that of GG genotype: 9.92 g ( P< 0.01). The results showed that the Robo2 gene molecular marker was significantly correlated with musk yield in forest musk deer. According to actual breeding goals, individuals with A / A or A / G genotypes can be selected to increase musk yield and improve the uniformity of musk yield.

[0060] genotype Number / head Average musk yield / g Standard deviation CV A / A 17 <![CDATA[19.37 a ]]> 2.427 12.53% A / G 29 <![CDATA[13.07 b ]]> 0.9339 7.14% G / G 77 <![CDATA[9.92 c ]]> 1.587 16.00% .

[0061] Note: The same letters in the same column indicate no significant difference, while different letters in the same column indicate significant difference. P <0.01).

[0062] In addition to the above embodiments, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the scope of protection required by the present invention.

Claims

1. A single nucleotide polymorphism (SNP) primer for the Robo2 gene related to the yield trait of natural musk deer, characterized by: The molecular marker corresponding to the SNP primer is located at base 27263478 on chromosome 1 of the musk deer reference genome, the base mutation is A or G, and the genotype is AA, AG, or GG. The deoxyribonucleotide sequences of the SNP primer are shown in SEQ ID NO: 1 and SEQ ID NO:

2. The musk deer reference genome is published on the website http: / / muskdb.cn / .

2. The use of the single nucleotide polymorphism (SNP) primers of the Robo2 gene related to the yield trait of natural musk deer according to claim 1, characterized in that: The SNP primers are used to detect the musk yield trait of musk deer. The SNP site detected is located at base 27263478 on chromosome 1 of the musk deer reference genome. The musk deer reference genome is published on the website http: / / muskdb.cn / . The detection includes the following steps: The first step is to detect a musk deer DNA sample and perform PCR amplification using the SNP primer to obtain an amplified product, wherein the amplified product comprises base 27263478 on chromosome 1 of the musk deer reference genome, and the sequence is base 216 as shown in SEQ ID NO: 3 or SEQ ID NO: 4; The second step is to perform Sanger sequencing on the amplified product; The third step is to determine the SNP genotype of the target site based on the sequencing results obtained in the second step. The musk yield of individuals with the genotype of the SNP site A / A and A / G at the age of 3-5 years is higher than that of individuals with the genotype of G / G.

3. The use of the single nucleotide polymorphism (SNP) primers of the Robo2 gene related to the yield trait of natural musk deer according to claim 2, characterized in that: In the first step, the final volume of the reaction system is 50 μl. Musk deer DNA 4ng 2 x Accurate Taq Master Mix 25μl 10 μm / L upstream primer 2 μl 10 μm / L downstream primer 2 μl Sterile water is added to make up to 50 μl. The reaction conditions for PCR amplification were as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 58°C for 15 sec, extension at 72°C for 15 sec, for a total of 35 cycles, and extension at 72°C for 5 min; and storage at 4°C.

Images