RNA complexes and nanostructures for treatment of cancer metastasis

Abstract

Disclosed herein are compositions and methods for one step CMC production of RNA therapeutic complexes (nanostructures) containing nucleoside analogs. In some embodiments, nucleoside analogs are incorporated into RNA oligonucleotides that self-assemble into RNA complexes during RNA synthesis in one step production. Thus, no additional conjugation or synthesis process is required.

Description

[0001] Cross - Reference to Related Applications

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 377,390, filed Sep. 28, 2022, and U.S. Provisional Application No. 63 / 511,969, filed Jul. 5, 2023, which are hereby incorporated herein by reference in their entirety.

[0003] Statement Regarding Federally Sponsored Research or Development

[0004] This invention was made with government support under Grant Nos. CA207946 and EB019036 awarded by the National Institutes of Health. The government has certain rights in the invention. BACKGROUND OF THE INVENTION

[0005] Metastasis is the leading outcome resulting in patient death. siRNA has been a long-standing dream for cancer treatment. However, currently, no single siRNA drug has been approved by the FDA for cancer treatment. The major obstacle to treatment ineffectiveness is the lack of an effective procedure for delivering siRNA to cancer cells in vivo and trapping siRNA in endosomes. SUMMARY OF THE INVENTION

[0006] Disclosed herein is a special design for effectively delivering inhibitory RNA molecules (such as siRNA) to cells in vivo, and a novel method for releasing siRNA in an RNA nanocomplex via a special design for cleaving a escort RNA sequence. In particular, disclosed herein is a therapeutic RNA complex that involves a plurality of synthetic double-stranded RNA oligonucleotides, each synthetic double-stranded RNA oligonucleotide comprising a sense strand having a 5'-end and a 3'-end, an antisense strand having a 5'-end and a 3'-end, and a cholesterol molecule conjugated to the 3'-end of the sense strand, wherein the plurality of synthetic double-stranded RNA oligonucleotides form an aggregate with the cholesterol molecule at the center. The sense strand comprises more than 25 nucleotides, wherein the 2'-position of all pyrimidines in the sense strand does not contain oxygen. The antisense strand comprises an siRNA sequence with 18 to 25 normal nucleotides, wherein the sense strand is longer than the antisense strand. At least 95% of the nucleotides in the antisense strand hybridize with the complementary nucleotides of the sense strand.

[0007] In some embodiments, the nucleoside analogs include 2'-difluoro-deoxypyrimidine, floxuridine (5-fluorodeoxyuridine, UB5F) nucleotides, gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF) nucleotides, or combinations thereof. In some embodiments, the 5' end of the sense strand is modified with GalNAc (N-acetylgalactosamine), UAMC-1110 (SP-13786; (S)-N-(2-(2-cyano-4,4-difluoropyrrolidin-1-yl)-2-oxoethyl)quinoline-4-carboxamide), FA (folate), or DCL (N-[N-[(S)-1,3-dicarboxypropyl]carbamoyl]-(S)-lysine).

[0008] Also disclosed herein are RNA nanostructures that can be composed of one or more synthetic RNA oligonucleotides that are designed (or configured) to self-assemble into RNA nanostructures. When assembled, the RNA nanostructures can be composed of double-stranded arms (DAs) that can be arranged around a core domain. Additionally, at least one of the RNA oligonucleotides in the RNA nanostructure contains at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 floxuridine (5-fluorodeoxyuridine, UB5F) nucleotides, gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF) nucleotides, or combinations thereof. In some embodiments, at least 1, 2, 3, or 4 of the synthetic RNA oligonucleotides have an amino acid sequence that is about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 1-448. In some embodiments, synthetic RNA oligonucleotides containing nucleoside analogs are combined with unmodified RNA oligonucleotides to form RNA nanostructures. For example, the at least 1, 2, 3, 4 synthetic RNA oligonucleotides having an amino acid sequence that is about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 1-448 can be combined with at least 1, 2, 3, 4, 5, or 6 synthetic RNA oligonucleotides having an amino acid sequence that is about 80% to 100% identical to any one of SEQ ID NOs: 298-394. Suitable combinations of these oligonucleotides for forming RNA nanoparticles are described herein.

[0009] The present disclosure also provides compositions and methods for one-step CMC production of RNA therapeutic complexes (nanostructures) containing nucleoside analogs. In some embodiments, the nucleoside analogs are incorporated into RNA oligonucleotides that self-assemble into RNA complexes during RNA synthesis in the one-step production. Thus, no additional conjugation or synthesis processes are required. The disclosed compositions and methods enable industrial-scale production of pure RNA therapeutics without the need for complex drug conjugation. In some embodiments, the RNA complex contains at least two nucleoside analogs. In some embodiments, the RNA complex contains at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 nucleoside analogs distributed within the RNA complex. In some embodiments, the RNA complex does not contain uridine or cytidine nucleotides.

[0010] Details of one or more embodiments of the invention are set forth in the accompanying drawings and the following description. Other features, objects, and advantages of the invention are apparent from the specification, drawings, and claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 Illustrative modified nucleotides for the disclosed RNA nanoparticles.

[0012] Figure 2 Shows the results of a cytotoxicity study of RNA-UB5F nanoparticles in breast cancer cell lines.

[0013] Figure 3 Shows the results of a cytotoxicity study of RNA-CR2FF nanoparticles in breast cancer cell lines.

[0014] Figure 4 Shows the results of a cytotoxicity study of RNA-CR2FF-UB5F nanoparticles in breast cancer cell lines.

[0015] Figure 5 Shows the survivin duplex structure: sense strand with 3'-cholesterol and gemcitabine (represented by Y)

[0016] Figure 6 Shows the survivin duplex structure: sense strand with 3'-cholesterol and gemcitabine (represented by Y) and an extended antisense strand attached thereto

[0017] Figure 7 Shows the survivin duplex structure: sense strand with 3'-cholesterol and gemcitabine (represented by Y), and the antisense strand has an adjacent extended RNA structure

[0018] Figure 8Shows the RRM2 double-stranded structure: the sense strand with 3'-cholesterol and gemcitabine (designated as Y)

[0019] Figure 9 Shows the RRM2 double-stranded structure: the sense strand with 3'-cholesterol and gemcitabine (designated as Y) and the extended antisense strand linked thereto

[0020] Figure 10 Shows the RRM2 double-stranded structure: the sense strand with 3'-cholesterol and gemcitabine (designated as Y), and the antisense strand has an adjacent extended RNA structure

[0021] Figure 11 A curve showing the results of the study on the weight change of RNA-CR2FF-cholesterol nanoparticles in an animal model of lung metastasis of human colorectal adenocarcinoma cells.

[0022] Figure 12 A histogram showing the results of the study on the weight change of RNA-CR2FF-cholesterol nanoparticles in an animal model of lung metastasis of human colorectal adenocarcinoma cells.

[0023] Figure 13 Shows the results of the study on the inhibition of in vivo metastasis of RNA-CR2FF-cholesterol nanoparticles in an animal model of lung metastasis of human colorectal adenocarcinoma cells.

[0024] Figure 14 Shows the results of the study on the inhibition of in vitro metastasis of RNA-CR2FF-cholesterol nanoparticles in an animal model of lung metastasis of human colorectal adenocarcinoma cells.

[0025] Figure 15 Shows the design of the formation of RNA / drug / siRNA complexes into RNA micelles. RNA micelles carrying siRNA (survivin or RRM2 siRNA) and multiple copies of gemcitabine.

[0026] Figure 16A and Figure 16B Shows that the lung tropism training of HT29 cells results in two major changes. Figure 16A and Figure 16B Shows the rate of metastatic tumor progression from 5 months to 1 month after injection as imaged by bioluminescence scanning ( Figure 16A ) and the increase in metastatic burden ( Figure 16B ).

[0027] Figures 17A to 17D Shows the in vivo delivery of RNA micelles for the treatment of CRC lung metastasis. Figure 17A Shows the whole-body bioluminescence imaging of mice after RNA micelle delivery, which shows reduced tumor GFP signaling. Figure 17BShows tumor bioluminescence imaging after RNA micelle delivery, which demonstrates a decrease in GFP at the tumor site. Figure 17C Shows Ki-67 staining, which demonstrates the proliferation of the resected tumor after treatment. Figure 17D Shows caspase 3 staining, which demonstrates the apoptotic signaling of the resected tumor after treatment. Detailed implementation

[0028] Before describing the present disclosure in detail, it should be understood that the present disclosure is not limited to the specific embodiments described, and since these embodiments can of course vary. It should also be understood that the terms used herein are for the purpose of describing specific embodiments only and are not intended to be limiting, as the scope of the present disclosure is limited only by the appended claims.

[0029] Where a range of values is provided, it is to be understood that each intermediate value between the upper and lower limits of the range (to one-tenth of the unit of the lower limit, unless otherwise expressly stated) and any other stated or intermediate value within the range is encompassed within the present disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the present disclosure, subject to any specific exclusions stated within the stated range. Where the stated range encompasses one or both of the limits, ranges excluding either or both of the included limits are also included in the present disclosure.

[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice and testing of the present disclosure, the preferred methods and materials are now described.

[0031] All publications and patents cited in this specification are incorporated herein by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference, and are incorporated by reference herein to disclose and describe the methods and / or materials associated with the cited publications. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present disclosure is not entitled to antedate such publication by virtue of prior disclosure. Further, the provided publication dates may differ from the actual publication dates, which may need to be independently confirmed.

[0032] Those skilled in the art will appreciate that each of the individual embodiments described and illustrated herein has discrete components and features that can be readily separated from or combined with the features of any of several other embodiments without departing from the scope or spirit of the present disclosure. Any of the recited methods can be carried out in the order of events recited or in any other order that is logically possible.

[0033] Unless otherwise indicated, embodiments of the present disclosure will employ techniques of chemistry, biology, etc., all of which are within the skill of the art.

[0034] The following examples are put forward to provide a complete disclosure and description to those of ordinary skill in the art on how to implement the methods disclosed and claimed herein and use the probes disclosed and claimed herein. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperatures, etc.), but some errors and deviations should be accounted for. Unless otherwise indicated, parts are parts by weight, temperature is in °C, and pressure is at or near atmospheric pressure. Standard temperature and pressure are defined as 20 °C and 1 atmosphere.

[0035] Before describing the embodiments of the present disclosure in detail, it should be understood that, unless otherwise indicated, the present disclosure is not limited to specific materials, reagents, reaction materials, manufacturing processes, etc., as they can vary. It should also be understood that the terms used herein are for the purpose of describing particular embodiments only and are not intended to be limiting. In the present disclosure, where logically possible, steps can also be carried out in a different order.

[0036] Definitions

[0037] It must be noted that, as used in the specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise.

[0038] "Self-assembly" refers to the ability of nucleic acids (and in some cases, preformed nucleic acid nanostructures (e.g., crystals)) to anneal to each other in a sequence-specific manner, in a predictable manner, and without external control. In some aspects, methods for self-assembling nucleic acid nanostructures include combining nucleic acids (e.g., single-stranded nucleic acids or oligonucleotides) in a single container and allowing the nucleic acids to anneal to each other based on sequence complementarity. In some aspects, such an annealing process involves placing the nucleic acids at an elevated temperature and then gradually lowering the temperature to favor sequence-specific binding. Various nucleic acid nanostructures or self-assembly methods are known and described herein.

[0039] The term "subject" refers to any individual that is the target of administration or treatment. A subject can be a vertebrate, such as a mammal. Thus, a subject can be a human or a veterinary patient. The term "patient" refers to a subject under the treatment of a clinician (e.g., a physician).

[0040] The term "therapeutically effective" means that the amount of the composition used is an amount sufficient to ameliorate one or more causes or symptoms of a disease or disorder. Such amelioration only needs to be a reduction or alteration and does not need to be elimination.

[0041] The term "pharmaceutically acceptable" refers to those compounds, materials, compositions, and / or dosage forms that, within the scope of sound medical judgment, are suitable for use in contact with the tissues of humans and animals without excessive toxicity, irritation, allergic response, or other problems or complications and are commensurate with a reasonable benefit / risk ratio.

[0042] The term "treatment" refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathologic condition, or disorder. This term includes curative treatment, i.e., treatment specifically directed toward the improvement of a disease, pathologic condition, or disorder, and also includes etiological treatment, i.e., treatment directed toward the removal of the cause of the relevant disease, pathologic condition, or disorder. Additionally, this term includes palliative treatment, i.e., treatment designed to relieve symptoms rather than cure the disease, pathologic condition, or disorder; prophylactic treatment, i.e., treatment involving minimizing or partially or completely inhibiting the development of the relevant disease, pathologic condition, or disorder; and supportive treatment, i.e., treatment used to supplement another specific therapy directed toward the improvement of the relevant disease, pathologic condition, or disorder.

[0043] The term "prevention" refers to treatment that prevents or slows the onset of a disease or condition or reduces the severity of a disease or condition. Thus, if a treatment can treat a disease in a subject with symptoms of the disease, it can also prevent the disease in a subject who has not yet suffered some or all of the symptoms.

[0044] For the purposes of this disclosure, the percent sequence identity of a given nucleotide or amino acid sequence C with, identical to, or against a given nucleic acid sequence D (which may alternatively be stated as a given sequence C that has or contains a certain percent sequence identity with, identical to, or against a given sequence D) is calculated as follows:

[0045] 100 times the fraction W / Z,

[0046] where W is the number of nucleotides or amino acids scored as identical matches in the alignment of C and D by a sequence alignment program and where Z is the total number of nucleotides or amino acids in D. It will be understood that where the length of sequence C is not equal to the length of sequence D, the percent sequence identity of C with D will not be equal to the percent sequence identity of D with C.

[0047] As used herein, the term "siRNA" refers to short inhibitory polynucleotides that can post-transcriptionally silence gene expression in cells. siRNAs are typically double-stranded, but only one strand of the siRNA is involved in gene silencing.

[0048] Inhibitory RNA

[0049] Compositions and methods for stabilizing and delivering inhibitory nucleic acids are disclosed herein. As used herein, inhibitory nucleic acid or "Sina" is defined as short interfering nucleic acid. Examples of siNA include, but are not limited to, RNAi, double-stranded RNA, and siRNA. siNA can inhibit the transcription or translation of genes in cells. The length of siNA can be from 16 to 1000 or more nucleotides, and in certain embodiments, the length can be from 18 to 100 nucleotides. In certain embodiments, the length of siNA can be 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. siNA can comprise nucleic acids and / or nucleic acid analogs. Typically, siNA will inhibit the translation of a single gene in a cell; however, in certain embodiments, siNA will inhibit the translation of more than one gene in a cell.

[0050] In siNA, the nucleic acid components need not be of the same type or completely homogeneous (e.g., siNA can comprise nucleotides and nucleic acids or nucleotide analogs). Typically, siNA forms a double-stranded structure; the double-stranded structure can be produced by two separate nucleic acids that are partially or fully complementary. In certain embodiments of the invention, siNA can comprise only a single nucleic acid (polynucleotide) or nucleic acid analog, and forms a double-stranded structure by being complementary to itself (e.g., forming a hairpin loop). The double-stranded structure of siNA can comprise 16, 20, 25, 30, 35, 40, 45, 50, 60, 65, 70, 75, 80, 85, 90 to 100, 150, 200, 250, 300, 350, 400, 450, 500 or more consecutive nucleobases, including all ranges therebetween. siNA can comprise 17 to 35 consecutive nucleobases, more preferably 18 to 30 consecutive nucleobases, more preferably 19 to 25 nucleobases, more preferably 20 to 23 consecutive nucleobases, or 20 to 22 consecutive nucleobases, or 21 consecutive nucleobases, which hybridize with a complementary nucleic acid (which can be another part of the same nucleic acid or a separate complementary nucleic acid) to form a double-stranded structure.

[0051] siNA (e.g., siRNA) is well known in the art. For example, siRNA and double-stranded RNA have been described in U.S. Patent Nos. 6,506,559 and 6,573,099, as well as U.S. Patent Applications 2003 / 6051263, 2003 / 0055020, 2004 / 0265839, 2002 / 0168707, 2003 / 0159161 and 2004 / 0064842, all of which are hereby incorporated by reference in their entirety.

[0052] In some cases, siRNA is capable of (i) binding to the respective mRNA, (ii) interfering with signal transduction, and / or (iii) inhibiting the proliferation of cancer or tumor cells.

[0053] Generally, the introduction of double-stranded RNA (dsRNA) (which may alternatively be referred to herein as small interfering RNA (siRNA)) induces potent and specific gene silencing, a phenomenon known as RNA interference or RNAi. This phenomenon has been extensively documented in the nematode Caenorhabditis elegans (Fire et al., 1998), but is widespread in other organisms ranging from trypanosomes to mice. Depending on the organism in question, RNA interference is referred to as "cosuppression", "post-transcriptional gene silencing", "sense suppression", and "quelling". RNAi is an attractive biotechnological tool because it provides a means for knocking out the activity of specific genes.

[0054] When designing RNAi, several factors need to be considered, such as the nature of the siRNA, the durability of the silencing effect, and the choice of delivery system. To produce an RNAi effect, the siRNA introduced into an organism will typically contain exon sequences. In addition, the RNAi process is homology-dependent, so the sequence must be carefully selected to maximize gene specificity while minimizing the likelihood of cross-interference between homologous sequences (but not gene-specific sequences). Preferably, the siRNA exhibits greater than 80%, 85%, 90%, 95%, 98% or even 100% identity between the sequence of the siRNA and the gene to be inhibited. Sequences with less than about 80% identity to the target gene are generally inefficient. Thus, the higher the homology between the siRNA of FAK, EphA2, and / or β2AR and the FAK, EphA2, and / or β2AR genes whose expression is to be inhibited, the less likely the expression of unrelated genes will be affected.

[0055] The siRNA may also contain one or more nucleotide alterations. Such alterations can include the addition of non-nucleotide materials, such as addition to the ends of a 19- to 25-nucleotide RNA or addition internally (at one or more nucleotides of the RNA). In certain aspects, the RNA molecule contains a 3'-hydroxyl group. The nucleotides in the RNA molecules of the invention may also contain non-standard nucleotides, including non-naturally occurring nucleotides or deoxyribonucleotides. The double-stranded oligonucleotide may contain a modified backbone, for example, phosphorothioate, dithiophosphate or other modified backbones known in the art, or may contain non-natural internucleoside linkages. Additional modifications of siRNA (e.g., 2'-O-methyl ribonucleotides, 2'-deoxy-2'-fluoro ribonucleotides, "universal base" nucleotides, 5-C-methyl nucleotides, incorporation of one or more phosphorothioate internucleotide linkages and inverted deoxyabasic residues) can be found in U.S. Patent Application Publication 20040019001 and U.S. Patent No. 6,673,611 (each of which is incorporated by reference in its entirety). Collectively, all such altered nucleic acids or RNAs described above are referred to as modified siRNA.

[0056] The introduction of siRNA into cells can be achieved by methods known in the art, including, for example, microinjection, electroporation or transfection with a vector that contains a nucleic acid from which the siRNA can be transcribed. Alternatively, the siRNA can be introduced directly into cells in a form that is capable of binding to the target mRNA transcript. To enhance durability and membrane permeability, the siRNA can be combined with or modified with liposomes, poly-L-lysine, lipids, cholesterol, lipofectine or derivatives thereof. In certain aspects, cholesterol-conjugated siRNA can be used (see, Song et al., 2003).

[0057] Therapeutic RNA complex

[0058] Disclosed herein is a therapeutic RNA complex for delivering siRNA to cells of a subject. The therapeutic RNA complex involves a plurality of synthetic double-stranded RNA oligonucleotides, each synthetic double-stranded RNA oligonucleotide comprising a sense strand having a 5' end and a 3' end, an antisense siRNA strand having a 5' end and a 3' end, and a cholesterol molecule conjugated to the 3' end of the sense strand. In some embodiments, the sense strand comprises 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleoside analogs, such as fluorouridine (5-fluorodeoxyuridine, UB5F) nucleotides, gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF) nucleotides or combinations thereof. These nucleoside analogs protect the sense strand from RNase degradation but are also targets for digestion once inside the cell.

[0059] In some embodiments, the antisense strand is an anti-cancer siRNA that affects survival or apoptosis. For example, the antisense strand can be survivin siRNA or RRM2 siRNA. In some embodiments, the survivin siRNA has the nucleic acid sequence SEQ ID NO:1. In some embodiments, the RRM2 siRNA has the nucleic acid sequence SEQ ID NO:2.

[0060] In some embodiments, the length of the sense strand is the same as or longer than the length of the antisense strand. Importantly, at least 85%, 90%, 95% or 100% of the nucleotides in the antisense strand should hybridize with the complementary nucleotides of the sense strand to protect the siRNA from RNase digestion. Once inside the cell, the sense strand is digested, thus releasing the siRNA in the cell.

[0061] In some embodiments, multiple synthetic double-stranded RNA oligonucleotides form aggregates with a cholesterol molecule at the center. This is referred to herein as an "RNA micelle".

[0062] In some embodiments, the RNA complex further comprises GalNAc (N-acetylgalactosamine), UAMC-1110 (SP-13786; (S)-N-(2-(2-cyano-4,4-difluoropyrrolidin-1-yl)-2-oxoethyl)quinoline-4-carboxamide), FA (folate) or DCL (N-[N-[(S)-1,3-dicarboxypropyl]carbamoyl]-(S)-lysine) at the 5'-end of the sense strand.

[0063] Accordingly, there is disclosed herein a synthetic double-stranded RNA oligonucleotide, which relates to a sense strand having a 5'-end and a 3'-end and an antisense siRNA strand having a 5'-end and a 3'-end, wherein the sense strand comprises 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more fluorouridine (5-fluorodeoxyuridine, UB5F) nucleotides, gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF) nucleotides or a combination thereof.

[0064] The present disclosure also provides a method for stabilizing siRNA for therapeutic delivery, the method involving generating a plurality of synthetic single-stranded RNA oligonucleotides complementary to the siRNA sequence, wherein each of the RNA oligonucleotides comprises 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleoside analogs configured to prevent RNase degradation, and wherein each of the RNA oligonucleotides comprises a cholesterol moiety conjugated to its 3'-end. The method can then involve contacting the siRNA with the RNA oligonucleotides under conditions suitable to allow hybridization of the siRNA with the RNA oligonucleotides to produce a double-stranded RNA molecule aggregated around a cholesterol molecule at the center.

[0065] RNA nanostructure

[0066] The present disclosure also provides RNA nanostructures, which can be composed of one or more synthetic RNA oligonucleotides designed (or configured) to self-assemble into RNA nanostructures. When assembled, the RNA nanostructures can be composed of double-stranded arms (DAs) that can be arranged around a core domain.

[0067] In some embodiments, at least one of the RNA oligonucleotides in the RNA nanoparticles contains at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 fluorouridine (5-fluorodeoxyuridine, UB5F) nucleotides, gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF) nucleotides or a combination thereof.

[0068] In some embodiments, the RNA oligonucleotides are modified at the 5'-end with GalNAC (N-acetylgalactosamine), UAMC-1110 (SP-13786; (S)-N-(2-(2-cyano-4,4-difluoropyrrolidin-1-yl)-2-oxoethyl)quinoline-4-carboxamide), FA (folate) or DCL (N-[N-[(S)-1,3-dicarboxypropyl]carbamoyl]-(S)-lysine).

[0069] In some embodiments, the disclosed RNA oligonucleotides have one of the following sequences:

[0070] 3WJ - A with fluorouracil, gemcitabine and derivatives

[0071] 5'-XXGYYAXGXGXAXGXGGG-3';

[0072] 5'-XXGYYAXGXGXAXGXGGGGgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:6) (the targeting aptamer sequence represented by lowercase letters);

[0073] 5'-XXGYYAXGXGXAXGXGGGGGGACCGAAAAAGACCUGACUUCUAUACUAA GUCUACGUUUCCC-3' (SEQ ID NO:7);

[0074] 5'-XXGYYXGXGXAXGXGGGgcgacugguuacccggucg-3' (SEQ ID NO:8) (the targeting aptamer sequence represented by lowercase letters);

[0075] 5'-XXGYYAXGXGXAXGXGGGcagaacguauacuauucug-3' (SEQ ID NO:9) (the targeting aptamer sequence represented by lowercase letters);

[0076] 5'-GalNAc-XXGYYAXGXGXAXGXGGG-3';

[0077] 5'-FA-XXGYYAXGXGXAXGXGGG-3';

[0078] 5'-DCL-XXGYYAXGXGXAXGXGGG-3';

[0079] 5'-UAMC1110-XXGYYAXGXGXAXGXGGG-3';

[0080] 3WJ - B with fluorouracil, gemcitabine and derivatives

[0081] 5'-YYYAYAXAYXXXGXXGAXYY-3';

[0082] 5'-YYYAYAXAYXXXGXXGAXYYgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:10) (the targeting aptamer sequence represented by lowercase letters);

[0083] 5'-YYYAYAXAYXXXGXXGAXYYGGGACCGAAAAAGACCUGACUUCUAUACUA AGUCUACGUUUCCC-3' (SEQ ID NO:11);

[0084] 5'-YYYAYAXAYXXXGXXGAXYYgcgacugguuacccggucg-3' (SEQ ID NO:12) (targeting aptamer sequence represented by lowercase letters);

[0085] 5'-YYYAYAXAYXXXGXXGAXYYcagaacguauacuauucug-3' (SEQ ID NO:13) (targeting aptamer sequence represented by lowercase letters);

[0086] 5'-GalNAc-YYYAYAXAYXXXGXXGAXYY-3';

[0087] 5'-FA-YYYAYAXAYXXXGXXGAXYY-3';

[0088] 5'-DCL-YYYAYAXAYXXXGXXGAXYY-3';

[0089] 5'-UAMC1110-YYYAYAXAYXXXGXXGAXYY-3';

[0090] 3WJ - C with fluorouracil, gemcitabine and derivatives

[0091] 5'-GGAXYAAXYAXGGYAA-3';

[0092] 5'-GGAXYAAXYAXGGYAAgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:14) (targeting aptamer sequence represented by lowercase letters);

[0093] 5'-GGAXYAAXYAXGGYAAGGGACCGAAAAAGACCUGACUUCUAUACUAAGUC UACGUUUCCC-3' (SEQ ID NO:15);

[0094] 5'-GGAXYAAXYAXGGYAAgcgacugguuacccggucg-3' (SEQ ID NO:16) (targeting aptamer sequence represented by lowercase letters);

[0095] 5'-GGAXYAAXYAXGGYAAcagaacguauacuauucug-3' (SEQ ID NO:17) (targeting aptamer sequence represented by lowercase letters);

[0096] 5'-GalNAc-GGAXYAAXYAXGGYAA-3' (SEQ ID NO:18);

[0097] 5'-FA-GGAXYAAXYAXGGYAA-3' (SEQ ID NO:18, 3WJ-c-FA);

[0098] 5'-DCL-GGAXYAAXYAXGGYAA-3' (SEQ ID NO:19);

[0099] 5'-UAMC1110-GGAXYAAXYAXGGYAA-3' (SEQ ID NO:20);

[0100] 4WJ - A with fluorouracil, gemcitabine and derivatives

[0101] 5'-XXAGGXAAAGYYAYYXGYAGGXGYXAYYGAXGXAAXXYAA-3' (SEQ ID NO:21);

[0102] 5'-XXAGGXAAAGYYAYYXGYAGGXGYXAYYGAXGXAAXXYAAgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:22) (targeting aptamer sequence in lowercase letters);

[0103] 5'-XXAGGXAAAGYYAYYXGYAGGXGYXAYYGAXGXAAXXYAAgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:23) (targeting aptamer sequence in lowercase letters);

[0104] 5'-XXAGGXAAAGYYAYYXGYAGGXGYXAYYGAXGXAAXXYAAgcgacugguuaccc ggucg-3' (SEQ ID NO:24) (targeting aptamer sequence in lowercase letters);

[0105] 5'-XXAGGXAAAGYYAYYXGYAGGXGYXAYYGAXGXAAXXYAAcagaacguauacua uucug-3' (SEQ ID NO:25) (targeting aptamer sequence in lowercase letters);

[0106] 5'-GalNAc-XXAGGXAAAGYYAYYXGYAGGXGYXAYYGAXGXAAXXYAA-3' (SE Q ID NO:21);

[0107] 5'-FA-XXAGGXAAAGYYAYYXGYAGGXGYXAYYGAXGXAAXXYAA-3' (SEQ ID NO:21);

[0108] 5'-DCL-XXAGGXAAAGYYAYYXGYAGGXGYXAYYGAXGXAAXXYAA-3' (SEQ ID NO:21);

[0109] 5'-UAMC1110-XXAGGXAAAGYYAYYXGYAGGXGYXAYYGAXGXAAXXYAA-3' (SEQ ID NO:21);

[0110] 4WJ - B with fluorouracil, gemcitabine and derivatives

[0111] 5'-XXGAAXXAYAXYGGXAGYAYGGGYXGXGYGAGGYXGAAYAG-3' (SEQ ID NO:26);

[0112] 5'-XXGAAXXAYAXYGGXAGYAYGGGYXGXGYGAGGYXGAAYAGgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:27) (targeting aptamer sequence in lowercase letters);

[0113] 5'-XXGAAXXAYAXYGGXAGYAYGGGYXGXGYGAGGYXGAAYAGgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:28) (targeting aptamer sequence in lowercase letters);

[0114] 5'-XXGAAXXAYAXYGGXAGYAYGGGYXGXGYGAGGYXGAAYAGgcgacugguuacc cggucg-3' (SEQ ID NO:29) (targeting aptamer sequence in lowercase letters);

[0115] 5'-XXGAAXXAYAXYGGXAGYAYGGGYXGXGYGAGGYXGAAYAGcagaacguauacu auucug-3' (SEQ ID NO:30) (targeting aptamer sequence in lowercase letters);

[0116] 5'-GalNAc-XXGAAXXAYAXYGGXAGYAYGGGYXGXGYGAGGYXGAAYAG-3' (SEQ ID NO:26);

[0117] 5'-FA-XXGAAXXAYAXYGGXAGYAYGGGYXGXGYGAGGYXGAAYAG-3' (SEQ ID NO:26);

[0118] 5'-DCL-XXGAAXXAYAXYGGXAGYAYGGGYXGXGYGAGGYXGAAYAG-3' (SEQ ID NO:26);

[0119] 5'-UAMC1110-XXGAAXXAYAXYGGXAGYAYGGGYXGXGYGAGGYXGAAYAG-3' (SEQ ID NO:26);

[0120] 4WJ - C with fluorouracil, gemcitabine and derivatives

[0121] 5'-YXGXXYAGYYXYGYAYAGYYAGYAYGYAYYXGAAXAGG-3' (SEQ ID NO:31);

[0122] 5'-YXGXXYAGYYXYGYAYAGYYAGYAYGYAYYXGAAXAGGgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:32) (targeting aptamer sequence represented by lowercase letters);

[0123] 5'-YXGXXYAGYYXYGYAYAGYYAGYAYGYAYYXGAAXAGGgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:33) (targeting aptamer sequence represented by lowercase letters);

[0124] 5'-YXGXXYAGYYXYGYAYAGYYAGYAYGYAYYXGAAXAGGgcgacugguuacccgguc g-3' (SEQID NO:34) (targeting aptamer sequence represented by lowercase letters);

[0125] 5'-YXGXXYAGYYXYGYAYAGYYAGYAYGYAYYXGAAXAGGcagaacguauacuauucu g-3' (SEQID NO:35) (targeting aptamer sequence represented by lowercase letters);

[0126] 5'-GalNAc-YXGXXYAGYYXYGYAYAGYYAGYAYGYAYYXGAAXAGG-3' (SEQ ID NO:31);

[0127] 5'-FA-YXGXXYAGYYXYGYAYAGYYAGYAYGYAYYXGAAXAGG-3' (SEQ ID NO:31);

[0128] 5'-DCL-YXGXXYAGYYXYGYAYAGYYAGYAYGYAYYXGAAXAGG-3' (SEQ ID NO:31);

[0129] 5'-UAMC1110-YXGXXYAGYYXYGYAYAGYYAGYAYGYAYYXGAAXAGG-3' (SEQ ID NO:31);

[0130] 4WJ - D with fluorouracil, gemcitabine and derivatives

[0131] 5'-YYXAXXYAGGXGYGXGYXGGGYXGYAGGXGGYXXXAYYXAA-3' (SEQ ID NO:36);

[0132] 5'-YYXAXXYAGGXGYGXGYXGGGYXGYAGGXGGYXXXAYYXAAgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:37) (targeting aptamer sequence represented by lowercase letters);

[0133] 5'-YYXAXXYAGGXGYGXGYXGGGYXGYAGGXGGYXXXAYYXAAgggaccgaaaaa gaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:38) (targeting aptamer sequence represented by lowercase letters);

[0134] 5'-YYXAXXYAGGXGYGXGYXGGGYXGYAGGXGGYXXXAYYXAAgcgacugguuac ccggucg-3' (SEQ ID NO:39) (targeting aptamer sequence represented by lowercase letters);

[0135] 5'-YYXAXXYAGGXGYGXGYXGGGYXGYAGGXGGYXXXAYYXAAcagaacguauac uauucug-3' (SEQ ID NO:40) (Targeting aptamer sequence represented by lowercase letters);

[0136] 5'-GalNAc-YYXAXXYAGGXGYGXGYXGGGYXGYAGGXGGYXXXAYYXAA-3' (SEQ ID NO:36);

[0137] 5'-FA-YYXAXXYAGGXGYGXGYXGGGYXGYAGGXGGYXXXAYYXAA-3' (SEQ ID NO:36);

[0138] 5'-DCL-YYXAXXYAGGXGYGXGYXGGGYXGYAGGXGGYXXXAYYXAA-3' (SEQ ID NO:36);

[0139] 5'-UAMC1110-YYXAXXYAGGXGYGXGYXGGGYXGYAGGXGGYXXXAYYXAA-3' (SEQ ID NO:36);

[0140] 6WJ - A with fluorouracil, gemcitabine and derivatives

[0141] 5'-GAGXAXAXGXXAGGYYXGGGXGAGXYYXXGYGXYXXYXAYYG-3' (SEQ ID NO:41);

[0142] 5'-GAGXAXAXGXXAGGYYXGGGXGAGXYYXXGYGXYXXYXAYYGgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:42) (Targeting aptamer sequence represented by lowercase letters);

[0143] 5'-GAGXAXAXGXXAGGYYXGGGXGAGXYYXXGYGXYXXYXAYYGgggaccgaaa aagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:43) (Targeting aptamer sequence represented by lowercase letters);

[0144] 5'-GAGXAXAXGXXAGGYYXGGGXGAGXYYXXGYGXYXXYXAYYGgcgacugguu acccggucg-3' (SEQ ID NO:44) (Targeting aptamer sequence represented by lowercase letters);

[0145] 5'-GAGXAXAXGXXAGGYYXGGGXGAGXYYXXGYGXYXXYXAYYGcagaacguau acuauucug-3' (SEQ ID NO:45) (Targeting aptamer sequence represented by lowercase letters);

[0146] 5'-GalNAc-GAGXAXAXGXXAGGYYXGGGXGAGXYYXXGYGXYXXYXAYYG-3' (SEQ ID NO:41);

[0147] 5'-FA-GAGXAXAXGXXAGGYYXGGGXGAGXYYXXGYGXYXXYXAYYG-3' (SEQ ID NO:41);

[0148] 5'-DCL-GAGXAXAXGXXAGGYYXGGGXGAGXYYXXGYGXYXXYXAYYG-3' (SE Q ID NO:41);

[0149] 5'-UAMC1110-GAGXAXAXGXXAGGYYXGGGXGAGXYYXXGYGXYXXYXAYY G-3' (SEQ ID NO:41);

[0150] 6WJ - B with fluorouracil, gemcitabine and derivatives

[0151] 5'-YGGXAGAAGAYGYAAGGAYXXGYXAGXXGXGGXAYXGXXYYY-3' (SEQ ID NO:46);

[0152] 5'-YGGXAGAAGAYGYAAGGAYXXGYXAGXXGXGGXAYXGXXYYYgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:47) (Targeting aptamer sequence represented by lowercase letters);

[0153] 5'-YGGXAGAAGAYGYAAGGAYXXGYXAGXXGXGGXAYXGXXYYYgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:48) (targeting aptamer sequence represented by lowercase letters);

[0154] 5'-YGGXAGAAGAYGYAAGGAYXXGYXAGXXGXGGXAYXGXXYYYgcgacugguuacccggucg-3' (SEQ ID NO:49) (targeting aptamer sequence represented by lowercase letters);

[0155] 5'-YGGXAGAAGAYGYAAGGAYXXGYXAGXXGXGGXAYXGXXYYYcagaacguauacuauucug-3' (SEQ ID NO:50) (targeting aptamer sequence represented by lowercase letters);

[0156] 5'-GalNAc-YGGXAGAAGAYGYAAGGAYXXGYXAGXXGXGGXAYXGXXYYY-3' (SEQ ID NO:46);

[0157] 5'-FA-YGGXAGAAGAYGYAAGGAYXXGYXAGXXGXGGXAYXGXXYYY-3' (SEQ ID NO:46);

[0158] 5'-DCL-YGGXAGAAGAYGYAAGGAYXXGYXAGXXGXGGXAYXGXXYYY-3' (SEQ ID NO:46);

[0159] 5'-UAMC1110-YGGXAGAAGAYGYAAGGAYXXGYXAGXXGXGGXAYXGXXYYY-3' (SEQ ID NO:46);

[0160] 6WJ - C with fluorouracil, gemcitabine and derivatives

[0161] 5'-GGGAAYAGXAYYAYAAYXAGXGXYYYGGGAXAGGGAYAXAYA-3' (SEQ ID NO:51);

[0162] 5'-GGGAAYAGXAYYAYAAYXAGXGXYYYGGGAXAGGGAYAXAYAgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:52) (Targeting aptamer sequence represented by lowercase letters);

[0163] 5'-GGGAAYAGXAYYAYAAYXAGXGXYYYGGGAXAGGGAYAXAYAgggaccgaaaaa gaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:53) (Targeting aptamer sequence represented by lowercase letters);

[0164] 5'-GGGAAYAGXAYYAYAAYXAGXGXYYYGGGAXAGGGAYAXAYAgcgacugguuac ccggucg-3' (SEQ ID NO:54) (Targeting aptamer sequence represented by lowercase letters);

[0165] 5'-GGGAAYAGXAYYAYAAYXAGXGXYYYGGGAXAGGGAYAXAYAcagaacguauac uauucug-3' (SEQ ID NO:55) (Targeting aptamer sequence represented by lowercase letters);

[0166] 5'-GalNAc-GGGAAYAGXAYYAYAAYXAGXGXYYYGGGAXAGGGAYAXAYA-3' (SEQ ID NO:51);

[0167] 5'-FA-GGGAAYAGXAYYAYAAYXAGXGXYYYGGGAXAGGGAYAXAYA-3' (SEQ ID NO:51);

[0168] 5'-DCL-GGGAAYAGXAYYAYAAYXAGXGXYYYGGGAXAGGGAYAXAYA-3' (SEQ ID NO:51);

[0169] 5'-UAMC1110-GGGAAYAGXAYYAYAAYXAGXGXYYYGGGAXAGGGAYAXAYA-3' (SEQ ID NO:51);

[0170] 6WJ - D with fluorouracil, gemcitabine and derivatives

[0171] 5'-XGXAXGXYYYXAXYYYGGGAXGYYYAGGYYXAAYAXAXAYXY-3' (SEQ ID NO:56);

[0172] 5'-XGXAXGXYYYXAXYYYGGGAXGYYYAGGYYXAAYAXAXAYXYgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:57) (targeting aptamer sequence represented by lowercase letters);

[0173] 5'-XGXAXGXYYYXAXYYYGGGAXGYYYAGGYYXAAYAXAXAYXYgggaccgaaaa agaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:58) (targeting aptamer sequence represented by lowercase letters);

[0174] 5'-XGXAXGXYYYXAXYYYGGGAXGYYYAGGYYXAAYAXAXAYXYgcgacugguua cccggucg-3' (SEQ ID NO:59) (targeting aptamer sequence represented by lowercase letters);

[0175] 5'-XGXAXGXYYYXAXYYYGGGAXGYYYAGGYYXAAYAXAXAYXYcagaacguaua cuauucug-3' (SEQ ID NO:60) (targeting aptamer sequence represented by lowercase letters);

[0176] 5'-GalNAc-XGXAXGXYYYXAXYYYGGGAXGYYYAGGYYXAAYAXAXAYXY-3' (SEQ ID NO:56);

[0177] 5'-FA-XGXAXGXYYYXAXYYYGGGAXGYYYAGGYYXAAYAXAXAYXY-3' (SEQ ID NO:56);

[0178] 5'-DCL-XGXAXGXYYYXAXYYYGGGAXGYYYAGGYYXAAYAXAXAYXY-3' (SEQ ID NO:56); or

[0179] 5'-UAMC1110-XGXAXGXYYYXAXYYYGGGAXGYYYAGGYYXAAYAXAXAYXY-3' (SEQ ID NO:56), where X is floxuridine (5-fluorodeoxyuridine, UB5F), and where Y is gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF).

[0180] In some embodiments, the disclosed RNA oligonucleotides have one of the following sequences:

[0181] 3WJ - A with only gemcitabine and derivatives

[0182] 5'-UUGYYAUGUGUAUGUGGG-3' (SEQ ID NO:61);

[0183] 5'-UUGYYAUGUGUAUGUGGGGgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:280) (the targeting aptamer sequence represented by lowercase letters);

[0184] 5'-UUGYYAUGUGUAUGUGGGGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO:281);

[0185] 5'-UUGYYAUGUGUAUGUGGGgcgacugguuacccggucg-3' (SEQ ID NO:282) (the targeting aptamer sequence represented by lowercase letters);

[0186] 5'-UUGYYAUGUGUAUGUGGGcagaacguauacuauucug-3' (SEQ ID NO:283) (the targeting aptamer sequence represented by lowercase letters);

[0187] 5'-GalNAc-UUGYYAUGUGUAUGUGGG-3' (SEQ ID NO:61);

[0188] 5'-FA-UUGYYAUGUGUAUGUGGG-3' (SEQ ID NO:61, 3WJ a FA);

[0189] 5'-DCL-UUGYYAUGUGUAUGUGGG-3' (SEQ ID NO:61);

[0190] 5'-UAMC1110-UUGYYAUGUGUAUGUGGG-3' (SEQ ID NO:61);

[0191] 3WJ - B with only gemcitabine and derivatives

[0192] 5'-YYYAYAUAYUUUGUUGAUYY-3' (SEQ ID NO:62);

[0193] 5'-YYYAYAUAYUUUGUUGAUYYgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:63) (targeting aptamer sequence in lowercase letters);

[0194] 5'-YYYAYAUAYUUUGUUGAUYYGGGACCGAAAAAGACCUGACUUCUAUACUA AGUCUACGUUUCCC-3' (SEQ ID NO:64);

[0195] 5'-YYYAYAUAYUUUGUUGAUYYgcgacugguuacccggucg-3' (SEQ ID NO:65, 3WJ-b-EpCAMapt) (targeting aptamer sequence in lowercase letters);

[0196] 5'-YYYAYAUAYUUUGUUGAUYYcagaacguauacuauucug-3' (SEQ ID NO:66) (targeting aptamer sequence in lowercase letters);

[0197] 5'-GalNAc-YYYAYAUAYUUUGUUGAUYY-3' (SEQ ID NO:62);

[0198] 5'-FA-YYYAYAUAYUUUGUUGAUYY-3' (SEQ ID NO:62);

[0199] 5'-DCL-YYYAYAUAYUUUGUUGAUYY-3' (SEQ ID NO:62);

[0200] 5'-UAMC1110-YYYAYAUAYUUUGUUGAUYY-3' (SEQ ID NO:62);

[0201] 3WJ - C with only gemcitabine and derivatives

[0202] 5'-GGAUYAAUYAUGGYAA-3' (SEQ ID NO:67);

[0203] 5'-GGAUYAAUYAUGGYAAgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:68 (Target aptamer sequence represented by lowercase letters));

[0204] 5'-GGAUYAAUYAUGGYAAGGGACCGAAAAAGACCUGACUUCUAUACUAAGUC UACGUUUCCC-3' (SEQ ID NO:69);

[0205] 5'-GGAUYAAUYAUGGYAAgcgacugguuacccggucg-3' (SEQ ID NO:70) (Target aptamer sequence represented by lowercase letters);

[0206] 5'-GGAUYAAUYAUGGYAAcagaacguauacuauucug-3' (SEQ ID NO:71) (Target aptamer sequence represented by lowercase letters);

[0207] 5'-GalNAc-GGAUYAAUYAUGGYAA-3' (SEQ ID NO:67);

[0208] 5'-FA-GGAUYAAUYAUGGYAA-3' (SEQ ID NO:67);

[0209] 5'-DCL-GGAUYAAUYAUGGYAA-3' (SEQ ID NO:67);

[0210] 5'-UAMC1110-GGAUYAAUYAUGGYAA-3' (SEQ ID NO:67);

[0211] 4WJ - A with only gemcitabine and derivatives

[0212] 5'-UUAGGUAAAGYYAYYUGYAGGUGYUAYYGAUGUAAUUYAA-3' (SEQ ID NO:72);

[0213] 5'-UUAGGUAAAGYYAYYUGYAGGUGYUAYYGAUGUAAUUYAAgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:73) (Target aptamer sequence represented by lowercase letters);

[0214] 5'-UUAGGUAAAGYYAYYUGYAGGUGYUAYYGAUGUAAUUYAAgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:74) (Targeting aptamer sequence represented by lowercase letters);

[0215] 5'-UUAGGUAAAGYYAYYUGYAGGUGYUAYYGAUGUAAUUYAAgcgacugguuaccc ggucg-3' (SEQ ID NO:75) (Targeting aptamer sequence represented by lowercase letters);

[0216] 5'-UUAGGUAAAGYYAYYUGYAGGUGYUAYYGAUGUAAUUYAAcagaacguauacua uucug-3' (SEQ ID NO:76) (Targeting aptamer sequence represented by lowercase letters);

[0217] 5'-GalNAc-UUAGGUAAAGYYAYYUGYAGGUGYUAYYGAUGUAAUUYAA-3' (SE Q ID NO:72);

[0218] 5'-FA-UUAGGUAAAGYYAYYUGYAGGUGYUAYYGAUGUAAUUYAA-3' (SEQ ID NO:72);

[0219] 5'-DCL-UUAGGUAAAGYYAYYUGYAGGUGYUAYYGAUGUAAUUYAA-3' (SEQ ID NO:72);

[0220] 5'-UAMC1110-UUAGGUAAAGYYAYYUGYAGGUGYUAYYGAUGUAAUUYAA-3' (SEQ ID NO:72);

[0221] 4WJ - B with only gemcitabine and derivatives

[0222] 5'-UUGAAUUAYAUYGGUAGYAYGGGYUGUGYGAGGYUGAAYAG-3' (SEQ ID NO:77);

[0223] 5'-UUGAAUUAYAUYGGUAGYAYGGGYUGUGYGAGGYUGAAYAGgccuuaguaacgugcuuugaugucgauucgacaggaggc-3'(SEQ ID NO:78)(Targeting aptamer sequence in lowercase letters);

[0224] 5'-UUGAAUUAYAUYGGUAGYAYGGGYUGUGYGAGGYUGAAYAGgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3'(SEQ ID NO:79)(Targeting aptamer sequence in lowercase letters);

[0225] 5'-UUGAAUUAYAUYGGUAGYAYGGGYUGUGYGAGGYUGAAYAGgcgacugguuacc cggucg-3'(SEQ ID NO:80)(Targeting aptamer sequence in lowercase letters);

[0226] 5'-UUGAAUUAYAUYGGUAGYAYGGGYUGUGYGAGGYUGAAYAGcagaacguauacu auucug-3'(SEQ ID NO:81)(Targeting aptamer sequence in lowercase letters);

[0227] 5'-GalNAc-UUGAAUUAYAUYGGUAGYAYGGGYUGUGYGAGGYUGAAYAG-3'(SE Q ID NO:77);

[0228] 5'-FA-UUGAAUUAYAUYGGUAGYAYGGGYUGUGYGAGGYUGAAYAG-3'(SEQ ID NO:77);

[0229] 5'-DCL-UUGAAUUAYAUYGGUAGYAYGGGYUGUGYGAGGYUGAAYAG-3'(SEQ ID NO:77);

[0230] 5'-UAMC1110-UUGAAUUAYAUYGGUAGYAYGGGYUGUGYGAGGYUGAAYAG-3'(SEQ ID NO:77);

[0231] 4WJ - C with only gemcitabine and derivatives

[0232] 5'-YUGUUYAGYYUYGYAYAGYYAGYAYGYAYYUGAAUAGG-3' (SEQ ID NO:82);

[0233] 5'-YUGUUYAGYYUYGYAYAGYYAGYAYGYAYYUGAAUAGGgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:83) (targeting aptamer sequence shown in lowercase letters);

[0234] 5'-YUGUUYAGYYUYGYAYAGYYAGYAYGYAYYUGAAUAGGgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:84) (targeting aptamer sequence shown in lowercase letters);

[0235] 5'-YUGUUYAGYYUYGYAYAGYYAGYAYGYAYYUGAAUAGGgcgacugguuacccgguc g-3' (SEQID NO:85) (targeting aptamer sequence shown in lowercase letters);

[0236] 5'-YUGUUYAGYYUYGYAYAGYYAGYAYGYAYYUGAAUAGGcagaacguauacuauucu g-3' (SEQID NO:86) (targeting aptamer sequence shown in lowercase letters);

[0237] 5'-GalNAc-YUGUUYAGYYUYGYAYAGYYAGYAYGYAYYUGAAUAGG-3' (SEQ ID NO:82);

[0238] 5'-FA-YUGUUYAGYYUYGYAYAGYYAGYAYGYAYYUGAAUAGG-3' (SEQ ID NO:82);

[0239] 5'-DCL-YUGUUYAGYYUYGYAYAGYYAGYAYGYAYYUGAAUAGG-3' (SEQ ID NO:82);

[0240] 5'-UAMC1110-YUGUUYAGYYUYGYAYAGYYAGYAYGYAYYUGAAUAGG-3' (SEQ ID NO:82);

[0241] 4WJ - D with only gemcitabine and derivatives

[0242] 5'-YYUAUUYAGGUGYGUGYUGGGYUGYAGGUGGYUUUAYYUAA-3' (SEQ ID NO:87);

[0243] 5'-YYUAUUYAGGUGYGUGYUGGGYUGYAGGUGGYUUUAYYUAAgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:88) (targeting aptamer sequence in lowercase letters);

[0244] 5'-YYUAUUYAGGUGYGUGYUGGGYUGYAGGUGGYUUUAYYUAAgggaccgaaaaa gaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:89) (targeting aptamer sequence in lowercase letters);

[0245] 5'-YYUAUUYAGGUGYGUGYUGGGYUGYAGGUGGYUUUAYYUAAgcgacugguuac ccggucg-3' (SEQ ID NO:90) (targeting aptamer sequence in lowercase letters);

[0246] 5'-YYUAUUYAGGUGYGUGYUGGGYUGYAGGUGGYUUUAYYUAAcagaacguauac uauucug-3' (SEQ ID NO:91) (targeting aptamer sequence in lowercase letters);

[0247] 5'-GalNAc-YYUAUUYAGGUGYGUGYUGGGYUGYAGGUGGYUUUAYYUAA-3' (S EQ ID NO:87);

[0248] 5'-FA-YYUAUUYAGGUGYGUGYUGGGYUGYAGGUGGYUUUAYYUAA-3' (SEQ ID NO:87);

[0249] 5'-DCL-YYUAUUYAGGUGYGUGYUGGGYUGYAGGUGGYUUUAYYUAA-3' (SEQ ID NO:87);

[0250] 5'-UAMC1110-YYUAUUYAGGUGYGUGYUGGGYUGYAGGUGGYUUUAYYUAA-3' (SEQ ID NO:87);

[0251] 6WJ - A with only gemcitabine and derivatives

[0252] 5'-GAGUAUAUGUUAGGYYUGGGUGAGUYYUUGYGUYUUYUAYYG-3'(SEQ ID NO:92);

[0253] 5'-GAGUAUAUGUUAGGYYUGGGUGAGUYYUUGYGUYUUYUAYYGgccuuaguaacgugcuuugaugucgauucgacaggaggc-3'(SEQ ID NO:93)(Targeting aptamer sequence in lowercase letters);

[0254] 5'-GAGUAUAUGUUAGGYYUGGGUGAGUYYUUGYGUYUUYUAYYGgggaccgaaa aagaccugacuucuauacuaagucuacguuuccc-3'(SEQ ID NO:94)(Targeting aptamer sequence in lowercase letters);

[0255] 5'-GAGUAUAUGUUAGGYYUGGGUGAGUYYUUGYGUYUUYUAYYGgcgacugguu acccggucg-3'(SEQ ID NO:95)(Targeting aptamer sequence in lowercase letters);

[0256] 5'-GAGUAUAUGUUAGGYYUGGGUGAGUYYUUGYGUYUUYUAYYGcagaacguau acuauucug-3'(SEQ ID NO:96)(Targeting aptamer sequence in lowercase letters);

[0257] 5'-GalNAc-GAGUAUAUGUUAGGYYUGGGUGAGUYYUUGYGUYUUYUAYYG-3'(SEQ ID NO:92);

[0258] 5'-FA-GAGUAUAUGUUAGGYYUGGGUGAGUYYUUGYGUYUUYUAYYG-3'(SEQ ID NO:92);

[0259] 5'-DCL-GAGUAUAUGUUAGGYYUGGGUGAGUYYUUGYGUYUUYUAYYG-3'(SE Q ID NO:92);

[0260] 5'-UAMC1110-GAGUAUAUGUUAGGYYUGGGUGAGUYYUUGYGUYUUYUAYY G-3'(SEQ ID NO:92);

[0261] 6WJ - B with only gemcitabine and derivatives

[0262] 5'-YGGUAGAAGAYGYAAGGAYUUGYUAGUUGUGGUAYUGUUYYY-3'(SEQ ID NO:97);

[0263] 5'-YGGUAGAAGAYGYAAGGAYUUGYUAGUUGUGGUAYUGUUYYYgccuuaguaacgugcuuugaugucgauucgacaggaggc-3'(SEQ ID NO:98)(Targeting aptamer sequence in lowercase letters);

[0264] 5'-YGGUAGAAGAYGYAAGGAYUUGYUAGUUGUGGUAYUGUUYYYgggaccgaaaa agaccugacuucuauacuaagucuacguuuccc-3'(SEQ ID NO:99)(Targeting aptamer sequence in lowercase letters);

[0265] 5'-YGGUAGAAGAYGYAAGGAYUUGYUAGUUGUGGUAYUGUUYYYgcgacugguua cccggucg-3'(SEQ ID NO:100)(Targeting aptamer sequence in lowercase letters);

[0266] 5'-YGGUAGAAGAYGYAAGGAYUUGYUAGUUGUGGUAYUGUUYYYcagaacguaua cuauucug-3'(SEQ ID NO:101)(Targeting aptamer sequence in lowercase letters);

[0267] 5'-GalNAc-YGGUAGAAGAYGYAAGGAYUUGYUAGUUGUGGUAYUGUUYYY-3(SEQ ID NO:97);

[0268] 5'-FA-YGGUAGAAGAYGYAAGGAYUUGYUAGUUGUGGUAYUGUUYYY-3'(SEQ ID NO:97);

[0269] 5'-DCL-YGGUAGAAGAYGYAAGGAYUUGYUAGUUGUGGUAYUGUUYYY-3'(SEQ ID NO:97);

[0270] 5'-UAMC1110-YGGUAGAAGAYGYAAGGAYUUGYUAGUUGUGGUAYUGUUYYY-3'(SEQ ID NO:97);

[0271] 6WJ - C with only gemcitabine and derivatives

[0272] 5'-GGGAAYAGUAYYAYAAYUAGUGUYYYGGGAUAGGGAYAUAYA-3'(SEQ ID NO:102);

[0273] 5'-GGGAAYAGUAYYAYAAYUAGUGUYYYGGGAUAGGGAYAUAYAgccuuaguaacgugcuuugaugucgauucgacaggaggc-3'(SEQ ID NO:103)(Targeting aptamer sequence in lowercase letters);

[0274] 5'-GGGAAYAGUAYYAYAAYUAGUGUYYYGGGAUAGGGAYAUAYAgggaccgaaaaa gaccugacuucuauacuaagucuacguuuccc-3'(SEQ ID NO:104)(Targeting aptamer sequence in lowercase letters);

[0275] 5'-GGGAAYAGUAYYAYAAYUAGUGUYYYGGGAUAGGGAYAUAYAgcgacugguuac ccggucg-3'(SEQ ID NO:105)(Targeting aptamer sequence in lowercase letters);

[0276] 5'-GGGAAYAGUAYYAYAAYUAGUGUYYYGGGAUAGGGAYAUAYAcagaacguauac uauucug-3'(SEQ ID NO:106)(Targeting aptamer sequence in lowercase letters);

[0277] 5'-GalNAc-GGGAAYAGUAYYAYAAYUAGUGUYYYGGGAUAGGGAYAUAYA-3'(SEQ ID NO:102);

[0278] 5'-FA-GGGAAYAGUAYYAYAAYUAGUGUYYYGGGAUAGGGAYAUAYA-3' (SEQ ID NO:102);

[0279] 5'-DCL-GGGAAYAGUAYYAYAAYUAGUGUYYYGGGAUAGGGAYAUAYA-3' (SEQ ID NO:102);

[0280] 5'-UAMC1110-GGGAAYAGUAYYAYAAYUAGUGUYYYGGGAUAGGGAYAUAYA-3' (SEQ ID NO:102);

[0281] 6WJ - D with only gemcitabine and derivatives

[0282] 5'-UGUAUGUYYYUAUYYYGGGAUGYYYAGGYYUAAYAUAUAYUY-3' (SEQ ID NO:107);

[0283] 5'-UGUAUGUYYYUAUYYYGGGAUGYYYAGGYYUAAYAUAUAYUYgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:108) (targeting aptamer sequence in lowercase letters);

[0284] 5'-UGUAUGUYYYUAUYYYGGGAUGYYYAGGYYUAAYAUAUAYUYgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:109) (targeting aptamer sequence in lowercase letters);

[0285] 5'-UGUAUGUYYYUAUYYYGGGAUGYYYAGGYYUAAYAUAUAYUYgcgacugguuacccggucg-3' (SEQ ID NO:110) (targeting aptamer sequence in lowercase letters);

[0286] 5'-UGUAUGUYYYUAUYYYGGGAUGYYYAGGYYUAAYAUAUAYUYcagaacguauacuauucug-3' (SEQ ID NO:111) (targeting aptamer sequence in lowercase letters);

[0287] 5'-GalNAc-UGUAUGUYYYUAUYYYGGGAUGYYYAGGYYUAAYAUAUAYUY-3' (SEQ ID NO:107);

[0288] 5'-FA-UGUAUGUYYYUAUYYYGGGAUGYYYAGGYYUAAYAUAUAYUY-3' (SEQ ID NO:107);

[0289] 5'-DCL-UGUAUGUYYYUAUYYYGGGAUGYYYAGGYYUAAYAUAUAYUY-3' (SEQ ID NO:107); or

[0290] 5'-UAMC1110-UGUAUGUYYYUAUYYYGGGAUGYYYAGGYYUAAYAUAUAYUY-3' (SEQ ID NO:107), where Y is gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF).

[0291] In some embodiments, the disclosed RNA oligonucleotides have one of the following sequences:

[0292] 3WJ - A with only fluorouracil and derivatives

[0293] 5'-XXGCCAXGXGXAXGXGGG-3' (SEQ ID NO:112);

[0294] 5'-XXGCCAXGXGXAXGXGGGGgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:113) (targeting aptamer sequence shown in lowercase letters);

[0295] 5'-XXGCCAXGXGXAXGXGGGgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:114) (targeting aptamer sequence shown in lowercase letters);

[0296] 5'-XXGCCAXGXGXAXGXGGGgcgacugguuacccggucg-3' (SEQ ID NO:115) (targeting aptamer sequence shown in lowercase letters);

[0297] 5'-XXGCCAXGXGXAXGXGGGcagaacguauacuauucug-3' (SEQ ID NO:116, 3WJ-a-CD133apt) (targeting aptamer sequence represented by lowercase letters);

[0298] 5'-GalNAc-XXGCCAXGXGXAXGXGGG-3' (SEQ ID NO:112);

[0299] 5'-FA-XXGCCAXGXGXAXGXGGG-3' (SEQ ID NO:112);

[0300] 5'-DCL-XXGCCAXGXGXAXGXGGG-3' (SEQ ID NO:112);

[0301] 5'-UAMC1110-XXGCCAXGXGXAXGXGGG-3' (SEQ ID NO:112);

[0302] 3WJ - B with only fluorouracil and derivatives

[0303] 5'-CCCACAXACXXXGXXGAXCC-3' (SEQ ID NO:117, 3WJ-b);

[0304] 5'-CCCACAXACXXXGXXGAXCCgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:118) (targeting aptamer sequence represented by lowercase letters);

[0305] 5'-CCCACAXACXXXGXXGAXCCgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:119) (targeting aptamer sequence represented by lowercase letters);

[0306] 5'-CCCACAXACXXXGXXGAXCCgcgacugguuacccggucg-3' (SEQ ID NO:120) (targeting aptamer sequence represented by lowercase letters);

[0307] 5'-CCCACAXACXXXGXXGAXCCcagaacguauacuauucug-3' (SEQ ID NO:121) (targeting aptamer sequence represented by lowercase letters);

[0308] 5'-GalNAc-CCCACAXACXXXGXXGAXCC-3' (SEQ ID NO:117);

[0309] 5'-FA-CCCACAXACXXXGXXGAXCC-3' (SEQ ID NO:117);

[0310] 5'-DCL-CCCACAXACXXXGXXGAXCC-3' (SEQ ID NO:117);

[0311] 5'-UAMC1110-CCCACAXACXXXGXXGAXCC-3' SEQ ID NO:117);

[0312] 3WJ - C with only fluorouracil and derivatives

[0313] 5'-GGAXCAAXCAXGGCAA-3' (SEQ ID NO:122);

[0314] 5'-GGAXCAAXCAXGGCAAgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ IDNO:123) (targeting aptamer sequence in lowercase letters);

[0315] 5'-GGAXCAAXCAXGGCAAgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:124) (targeting aptamer sequence in lowercase letters);

[0316] 5'-GGAXCAAXCAXGGCAAgcgacugguuacccggucg-3' (SEQ ID NO:125) (targeting aptamer sequence in lowercase letters);

[0317] 5'-GGAXCAAXCAXGGCAAcagaacguauacuauucug-3' (SEQ ID NO:126) (targeting aptamer sequence in lowercase letters);

[0318] 5'-GalNAc-GGAXCAAXCAXGGCAA-3' (SEQ ID NO:122);

[0319] 5'-FA-GGAXCAAXCAXGGCAA-3' (SEQ ID NO:122);

[0320] 5'-DCL-GGAXCAAXCAXGGCAA-3' (SEQ ID NO:122);

[0321] 5'-UAMC1110-GGAXCAAXCAXGGCAA-3' (SEQ ID NO:122);

[0322] 4WJ - A with only fluorouracil and derivatives

[0323] 5'-XXAGGXAAAGCCACCXGCAGGXGCXACCGAXGXAAXXCAA-3' (SEQ ID NO:127);

[0324] 5'-XXAGGXAAAGCCACCXGCAGGXGCXACCGAXGXAAXXCAAgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:128) (targeting aptamer sequence in lowercase letters);

[0325] 5'-XXAGGXAAAGCCACCXGCAGGXGCXACCGAXGXAAXXCAAgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:129) (targeting aptamer sequence in lowercase letters);

[0326] 5'-XXAGGXAAAGCCACCXGCAGGXGCXACCGAXGXAAXXCAAgcgacugguuaccc ggucg-3' (SEQ ID NO:130) (targeting aptamer sequence in lowercase letters);

[0327] 5'-XXAGGXAAAGCCACCXGCAGGXGCXACCGAXGXAAXXCAAcagaacguauacua uucug-3' (SEQ ID NO:131) (targeting aptamer sequence in lowercase letters);

[0328] 5'-GalNAc-XXAGGXAAAGCCACCXGCAGGXGCXACCGAXGXAAXXCAA-3' (SE Q ID NO:127);

[0329] 5'-FA-XXAGGXAAAGCCACCXGCAGGXGCXACCGAXGXAAXXCAA-3' (SEQ ID NO:127);

[0330] 5'-DCL-XXAGGXAAAGCCACCXGCAGGXGCXACCGAXGXAAXXCAA-3' (SEQ ID NO:127);

[0331] 5'-UAMC1110-XXAGGXAAAGCCACCXGCAGGXGCXACCGAXGXAAXXCAA-3' (SEQ ID NO:127);

[0332] 4WJ - B with only fluorouracil and derivatives

[0333] 5'-XXGAAXXACAXCGGXAGCACGGGCXGXGCGAGGCXGAACAG-3' (SEQ ID NO:132);

[0334] 5'-XXGAAXXACAXCGGXAGCACGGGCXGXGCGAGGCXGAACAGgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:133) (targeting aptamer sequence in lowercase letters);

[0335] 5'-XXGAAXXACAXCGGXAGCACGGGCXGXGCGAGGCXGAACAGgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:134) (targeting aptamer sequence in lowercase letters);

[0336] 5'-XXGAAXXACAXCGGXAGCACGGGCXGXGCGAGGCXGAACAGgcgacugguuac ccggucg-3' (SEQ ID NO:135) (targeting aptamer sequence in lowercase letters);

[0337] 5'-XXGAAXXACAXCGGXAGCACGGGCXGXGCGAGGCXGAACAGcagaacguauacu auucug-3' (SEQ ID NO:136) (targeting aptamer sequence in lowercase letters);

[0338] 5'-GalNAc-XXGAAXXACAXCGGXAGCACGGGCXGXGCGAGGCXGAACAG-3' (S EQ ID NO:132);

[0339] 5'-FA-XXGAAXXACAXCGGXAGCACGGGCXGXGCGAGGCXGAACAG-3' (SEQ ID NO:132);

[0340] 5'-DCL-XXGAAXXACAXCGGXAGCACGGGCXGXGCGAGGCXGAACAG-3' (SEQ ID NO:132);

[0341] 5'-UAMC1110-XXGAAXXACAXCGGXAGCACGGGCXGXGCGAGGCXGAACAG-3' (SEQ ID NO:132);

[0342] 4WJ - C with only fluorouracil and derivatives

[0343] 5'-CXGXXCAGCCXCGCACAGCCAGCACGCACCXGAAXAGG-3' (SEQ ID NO:137);

[0344] 5'-CXGXXCAGCCXCGCACAGCCAGCACGCACCXGAAXAGGgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:138) (targeting aptamer sequence in lowercase letters);

[0345] 5'-CXGXXCAGCCXCGCACAGCCAGCACGCACCXGAAXAGGgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:139) (targeting aptamer sequence in lowercase letters);

[0346] 5'-CXGXXCAGCCXCGCACAGCCAGCACGCACCXGAAXAGGgcgacugguuacccggu cg-3' (SEQID NO:140) (targeting aptamer sequence in lowercase letters);

[0347] 5'-CXGXXCAGCCXCGCACAGCCAGCACGCACCXGAAXAGGcagaacguauacuauucu g-3' (SEQID NO:141) (targeting aptamer sequence in lowercase letters);

[0348] 5'-GalNAc-CXGXXCAGCCXCGCACAGCCAGCACGCACCXGAAXAGG-3' (SEQ ID NO:137);

[0349] 5'-FA-CXGXXCAGCCXCGCACAGCCAGCACGCACCXGAAXAGG-3' (SEQ ID NO:137);

[0350] 5'-DCL-CXGXXCAGCCXCGCACAGCCAGCACGCACCXGAAXAGG-3' (SEQ ID NO:137);

[0351] 5'-UAMC1110-CXGXXCAGCCXCGCACAGCCAGCACGCACCXGAAXAGG-3' (SEQ ID NO:137);

[0352] 4WJ - D with only fluorouracil and derivatives

[0353] 5'-CCXAXXCAGGXGCGXGCXGGGCXGCAGGXGGCXXXACCXAA-3' (SEQ ID NO:142);

[0354] 5'-CCXAXXCAGGXGCGXGCXGGGCXGCAGGXGGCXXXACCXAAgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:143) (targeting aptamer sequence in lowercase letters);

[0355] 5'-CCXAXXCAGGXGCGXGCXGGGCXGCAGGXGGCXXXACCXAAgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:144) (targeting aptamer sequence in lowercase letters);

[0356] 5'-CCXAXXCAGGXGCGXGCXGGGCXGCAGGXGGCXXXACCXAAgcgacugguuacc cggucg-3' (SEQ ID NO:145) (targeting aptamer sequence in lowercase letters);

[0357] 5'-CCXAXXCAGGXGCGXGCXGGGCXGCAGGXGGCXXXACCXAAcagaacguauacu auucug-3' (SEQ ID NO:146) (Targeting aptamer sequence represented by lowercase letters);

[0358] 5'-GalNAc-CCXAXXCAGGXGCGXGCXGGGCXGCAGGXGGCXXXACCXAA-3' (SE Q ID NO:142);

[0359] 5'-FA-CCXAXXCAGGXGCGXGCXGGGCXGCAGGXGGCXXXACCXAA-3' (SEQ ID NO:142);

[0360] 5'-DCL-CCXAXXCAGGXGCGXGCXGGGCXGCAGGXGGCXXXACCXAA-3' (SEQ ID NO:142);

[0361] 5'-UAMC1110-CCXAXXCAGGXGCGXGCXGGGCXGCAGGXGGCXXXACCXAA-3' (SEQ ID NO:142);

[0362] 6WJ - A with only fluorouracil and derivatives

[0363] 5'-GAGXAXAXGXXAGGCCXGGGXGAGXCCXXGCGXCXXCXACCG-3' (SEQ ID NO:147);

[0364] 5'-GAGXAXAXGXXAGGCCXGGGXGAGXCCXXGCGXCXXCXACCGgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:148) (Targeting aptamer sequence represented by lowercase letters);

[0365] 5'-GAGXAXAXGXXAGGCCXGGGXGAGXCCXXGCGXCXXCXACCGgggaccgaaaa agaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:149) (Targeting aptamer sequence represented by lowercase letters);

[0366] 5'-GAGXAXAXGXXAGGCCXGGGXGAGXCCXXGCGXCXXCXACCGgcgacugguua cccggucg-3' (SEQ ID NO:150) (Targeting aptamer sequence represented by lowercase letters);

[0367] 5'-GAGXAXAXGXXAGGCCXGGGXGAGXCCXXGCGXCXXCXACCGcagaacguaua cuauucug-3' (SEQ ID NO:151) (Targeting aptamer sequence represented by lowercase letters);

[0368] 5'-GalNAc-GAGXAXAXGXXAGGCCXGGGXGAGXCCXXGCGXCXXCXACCG-3' (SEQ ID NO:147);

[0369] 5'-FA-GAGXAXAXGXXAGGCCXGGGXGAGXCCXXGCGXCXXCXACCG-3' (SEQ ID NO:147);

[0370] 5'-DCL-GAGXAXAXGXXAGGCCXGGGXGAGXCCXXGCGXCXXCXACCG-3' (SE Q ID NO:147);

[0371] 5'-UAMC1110-GAGXAXAXGXXAGGCCXGGGXGAGXCCXXGCGXCXXCXACCG-3' (SEQ ID NO:147);

[0372] 6WJ - B with only fluorouracil and derivatives

[0373] 5'-CGGXAGAAGACGCAAGGACXXGCXAGXXGXGGXACXGXXCCC-3' (SEQ ID NO:152);

[0374] 5'-CGGXAGAAGACGCAAGGACXXGCXAGXXGXGGXACXGXXCCCgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:153) (Targeting aptamer sequence represented by lowercase letters);

[0375] 5'-CGGXAGAAGACGCAAGGACXXGCXAGXXGXGGXACXGXXCCCgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:154) (Targeting aptamer sequence represented by lowercase letters);

[0376] 5'-CGGXAGAAGACGCAAGGACXXGCXAGXXGXGGXACXGXXCCCgcgacugguuacccggucg-3' (SEQ ID NO:155) (Targeting aptamer sequence represented by lowercase letters);

[0377] 5'-CGGXAGAAGACGCAAGGACXXGCXAGXXGXGGXACXGXXCCCcagaacguauacuauucug-3' (SEQ ID NO:156) (Targeting aptamer sequence represented by lowercase letters);

[0378] 5'-GalNAc-CGGXAGAAGACGCAAGGACXXGCXAGXXGXGGXACXGXXCCC-3' (SEQ ID NO:152);

[0379] 5'-FA-CGGXAGAAGACGCAAGGACXXGCXAGXXGXGGXACXGXXCCC-3' (SEQ ID NO:152);

[0380] 5'-DCL-CGGXAGAAGACGCAAGGACXXGCXAGXXGXGGXACXGXXCCC-3' (SEQ ID NO:152);

[0381] 5'-UAMC1110-CGGXAGAAGACGCAAGGACXXGCXAGXXGXGGXACXGXXCCC-3' (SEQ ID NO:152);

[0382] 6WJ - C with only fluorouracil and derivatives

[0383] 5'-GGGAACAGXACCACAACXAGXGXCCCGGGAXAGGGACAXACA-3' (SEQ ID NO:157);

[0384] 5'-GGGAACAGXACCACAACXAGXGXCCCGGGAXAGGGACAXACAgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:158) (Targeting aptamer sequence represented by lowercase letters);

[0385] 5'-GGGAACAGXACCACAACXAGXGXCCCGGGAXAGGGACAXACAgggaccgaaaa agaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:159) (Targeting aptamer sequence represented by lowercase letters);

[0386] 5'-GGGAACAGXACCACAACXAGXGXCCCGGGAXAGGGACAXACAgcgacugguua cccggucg-3' (SEQ ID NO:160) (Targeting aptamer sequence represented by lowercase letters);

[0387] 5'-GGGAACAGXACCACAACXAGXGXCCCGGGAXAGGGACAXACAcagaacguaua cuauucug-3' (SEQ ID NO:161) (Targeting aptamer sequence represented by lowercase letters);

[0388] 5'-GalNAc-GGGAACAGXACCACAACXAGXGXCCCGGGAXAGGGACAXACA-3' (SEQ ID NO:157);

[0389] 5'-FA-GGGAACAGXACCACAACXAGXGXCCCGGGAXAGGGACAXACA-3' (SEQ ID NO:157);

[0390] 5'-DCL-GGGAACAGXACCACAACXAGXGXCCCGGGAXAGGGACAXACA-3' (SE Q ID NO:157);

[0391] 5'-UAMC1110-GGGAACAGXACCACAACXAGXGXCCCGGGAXAGGGACAXACA-3' (SEQ ID NO:157);

[0392] 6WJ - D with only fluorouracil and derivatives

[0393] 5'-XGXAXGXCCCXAXCCCGGGAXGCCCAGGCCXAACAXAXACXC-3' (SEQ ID NO:162);

[0394] 5'-XGXAXGXCCCXAXCCCGGGAXGCCCAGGCCXAACAXAXACXCgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO:163) (targeting aptamer sequence represented by lowercase letters)

[0395] 5'-XGXAXGXCCCXAXCCCGGGAXGCCCAGGCCXAACAXAXACXCgggaccgaaaaa gaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO:164) (targeting aptamer sequence represented by lowercase letters);

[0396] 5'-XGXAXGXCCCXAXCCCGGGAXGCCCAGGCCXAACAXAXACXCgcgacugguua cccggucg-3' (SEQ ID NO:165) (targeting aptamer sequence represented by lowercase letters);

[0397] 5'-XGXAXGXCCCXAXCCCGGGAXGCCCAGGCCXAACAXAXACXCcagaacguauac uauucug-3' (SEQ ID NO:166) (targeting aptamer sequence represented by lowercase letters);

[0398] 5'-GalNAc-XGXAXGXCCCXAXCCCGGGAXGCCCAGGCCXAACAXAXACXC-3' (SEQ ID NO:162);

[0399] 5'-FA-XGXAXGXCCCXAXCCCGGGAXGCCCAGGCCXAACAXAXACXC-3' (SEQ ID NO:162);

[0400] 5'-DCL-XGXAXGXCCCXAXCCCGGGAXGCCCAGGCCXAACAXAXACXC-3' (SEQ ID NO:162); or

[0401] 5'-UAMC1110-XGXAXGXCCCXAXCCCGGGAXGCCCAGGCCXAACAXAXACXC-3' (SEQ ID NO:162), where X is fluorouridine (5-fluorodeoxyuridine, UB5F).

[0402] In some embodiments, the disclosed RNA oligonucleotides have one of the following unmodified sequences:

[0403] 3WJ - A

[0404] 5'-UUGCCAUGUGUAUGUGGG-3' (SEQ ID NO:167);

[0405] 5'-UUGCCAUGUGUAUGUGGGGGCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3' (SEQID NO:168);

[0406] 5'-UUGCCAUGUGUAUGUGGGGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO:169);

[0407] 5'-UUGCCUGUGUAUGUGGGGCGACUGGUUACCCGGUCG-3' (SEQ ID NO:170);

[0408] 5'-UUGCCAUGUGUAUGUGGGCAGAACGUAUACUAUUCUG-3' (SEQ ID NO:171);

[0409] 5'-GalNAc-UUGCCAUGUGUAUGUGGG-3' (SEQ ID NO:167);

[0410] 5'-FA-UUGCCAUGUGUAUGUGGG-3' (SEQ ID NO:167);

[0411] 5'-DCL-UUGCCAUGUGUAUGUGGG-3' (SEQ ID NO:167);

[0412] 5'-UAMC1110-UUGCCAUGUGUAUGUGGG-3' (SEQ ID NO:167);

[0413] 3WJ - B

[0414] 5'-CCCACAUACUUUGUUGAUCC-3' (SEQ ID NO:172);

[0415] 5'-CCCACAUACUUUGUUGAUCCGCCUUAGUAACGUGCUUUGAUGUCGAUUC GACAGGAGGC-3' (SEQ ID NO:173);

[0416] 5'-CCCACAUACUUUGUUGAUCCGGGACCGAAAAAGACCUGACUUCUAUACUA AGUCUACGUUUCCC-3' (SEQ ID NO:174);

[0417] 5'-CCCACAUACUUUGUUGAUCCGCGACUGGUUACCCGGUCG-3' (SEQ ID NO:175);

[0418] 5'-CCCACAUACUUUGUUGAUCCCAGAACGUAUACUAUUCUG-3' (SEQ ID NO:176);

[0419] 5'-GalNAc-CCCACAUACUUUGUUGAUCC-3' (SEQ ID NO:173);

[0420] 5'-FA-CCCACAUACUUUGUUGAUCC-3' (SEQ ID NO:173);

[0421] 5'-DCL-CCCACAUACUUUGUUGAUCC-3' (SEQ ID NO:173);

[0422] 5'-UAMC1110-CCCACAUACUUUGUUGAUCC-3' (SEQ ID NO:173);

[0423] 3WJ - C

[0424] 5'-GGAUCAAUCAUGGCAA-3' (SEQ ID NO:177);

[0425] 5'-GGAUCAAUCAUGGCAAGCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3' (SEQ IDNO:178);

[0426] 5'-GGAUCAAUCAUGGCAAGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO:179);

[0427] 5'-GGAUCAAUCAUGGCAAGCGACUGGUUACCCGGUCG-3' (SEQ ID NO:180);

[0428] 5'-GGAUCAAUCAUGGCAACAGAACGUAUACUAUUCUG-3' (SEQ ID NO:181);

[0429] 5'-GalNAc-GGAUCAAUCAUGGCAA-3' (SEQ ID NO:177);

[0430] 5'-FA-GGAUCAAUCAUGGCAA-3' (SEQ ID NO:177);

[0431] 5'-DCL-GGAUCAAUCAUGGCAA-3' (SEQ ID NO:177);

[0432] 5'-UAMC1110-GGAUCAAUCAUGGCAA-3' (SEQ ID NO:177);

[0433] 4WJ - A

[0434] 5'-UUAGGUAAAGCCACCUGCAGGUGCUACCGAUGUAAUUCAA-3' (SEQ ID NO:182);

[0435] 5'-UUAGGUAAAGCCACCUGCAGGUGCUACCGAUGUAAUUCAAGCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3' (SEQ ID NO:183);

[0436] 5'-UUAGGUAAAGCCACCUGCAGGUGCUACCGAUGUAAUUCAAGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO:184);

[0437] 5'-UUAGGUAAAGCCACCUGCAGGUGCUACCGAUGUAAUUCAAGCGACUGGUUACCCGGUCG-3' (SEQ ID NO:185);

[0438] 5'-UUAGGUAAAGCCACCUGCAGGUGCUACCGAUGUAAUUCAACAGAACGUAUACUAUUCUG-3' (SEQ ID NO:186);

[0439] 5'-GalNAc-UUAGGUAAAGCCACCUGCAGGUGCUACCGAUGUAAUUCAA-3' (SEQ ID NO:182);

[0440] 5'-FA-UUAGGUAAAGCCACCUGCAGGUGCUACCGAUGUAAUUCAA-3' (SEQ ID NO:182);

[0441] 5'-DCL-UUAGGUAAAGCCACCUGCAGGUGCUACCGAUGUAAUUCAA-3' (SEQ ID NO:182);

[0442] 5'-UAMC1110

[0443] UUAGGUAAAGCCACCUGCAGGUGCUACCGAUGUAAUUCAA-3' (SEQ ID NO:182);

[0444] 4WJ - B

[0445] 5'-UUGAAUUACAUCGGUAGCACGGGCUGUGCGAGGCUGAACAG-3' (SEQ ID NO:187);

[0446] 5'-UUGAAUUACAUCGGUAGCACGGGCUGUGCGAGGCUGAACAGGCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3' (SEQ ID NO:188);

[0447] 5'-UUGAAUUACAUCGGUAGCACGGGCUGUGCGAGGCUGAACAGGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO:189);

[0448] 5'-UUGAAUUACAUCGGUAGCACGGGCUGUGCGAGGCUGAACAGGCGACUGGUUACCCGGUCG-3' (SEQ ID NO:190);

[0449] 5'-UUGAAUUACAUCGGUAGCACGGGCUGUGCGAGGCUGAACAGCAGAACGUAUACUAUUCUG-3' (SEQ ID NO:191);

[0450] 5'-GalNAc-UUGAAUUACAUCGGUAGCACGGGCUGUGCGAGGCUGAACAG-3' (SEQ ID NO:187);

[0451] 5'-FA-UUGAAUUACAUCGGUAGCACGGGCUGUGCGAGGCUGAACAG-3' (SEQ ID NO:187);

[0452] 5'-DCL-UUGAAUUACAUCGGUAGCACGGGCUGUGCGAGGCUGAACAG-3' (SEQ ID NO:187);

[0453] 5'-UAMC1110-UUGAAUUACAUCGGUAGCACGGGCUGUGCGAGGCUGAACAG-3' (SEQ ID NO:187);

[0454] 4WJ - C

[0455] 5'-CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGG-3' (SEQ ID NO:192);

[0456] 5'-CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGGGCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3' (SEQ ID NO:193);

[0457] 5'-CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGGGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO:194);

[0458] 5'-CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGGGCGACUGGUUACCCGGUCG-3' (SEQ ID NO:195);

[0459] 5'-CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGGCAGAACGUAUACUAUUCUG-3' (SEQ ID NO:196);

[0460] 5'-GalNAc-CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGG-3' (SEQ ID NO:192);

[0461] 5'-FA-CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGG-3' (SEQ ID NO:192);

[0462] 5'-DCL-CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGG-3' (SEQ ID NO:192);

[0463] 5'-UAMC1110-CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGG-3' (SEQ ID NO:192);

[0464] 4WJ - D

[0465] 5'-CCUAUUCAGGUGCGUGCUGGGCUGCAGGUGGCUUUACCUAA-3' (SEQ ID NO:197);

[0466] 5'-CCUAUUCAGGUGCGUGCUGGGCUGCAGGUGGCUUUACCUAAGCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3' (SEQ ID NO:198);

[0467] 5'-CCUAUUCAGGUGCGUGCUGGGCUGCAGGUGGCUUUACCUAAGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO:199);

[0468] 5'-CCUAUUCAGGUGCGUGCUGGGCUGCAGGUGGCUUUACCUAAGCGACUGGUUACCCGGUCG-3' (SEQ ID NO:200);

[0469] 5'-CCUAUUCAGGUGCGUGCUGGGCUGCAGGUGGCUUUACCUAACAGAACGUAUACUAUUCUG-3' (SEQ ID NO:201);

[0470] 5'-GalNAc-CCUAUUCAGGUGCGUGCUGGGCUGCAGGUGGCUUUACCUAA-3' (SEQ ID NO:197);

[0471] 5'-FA-CCUAUUCAGGUGCGUGCUGGGCUGCAGGUGGCUUUACCUAA-3' (SEQ ID NO:197);

[0472] 5'-DCL-CCUAUUCAGGUGCGUGCUGGGCUGCAGGUGGCUUUACCUAA-3' (SEQ ID NO:197);

[0473] 5'-UAMC1110-CCUAUUCAGGUGCGUGCUGGGCUGCAGGUGGCUUUACCUAA-3' (SEQ ID NO:197);

[0474] 6WJ - A

[0475] 5'-GAGUAUAUGUUAGGCCUGGGUGAGUCCUUGCGUCUUCUACCG-3' (SEQ ID NO:202);

[0476] 5'-GAGUAUAUGUUAGGCCUGGGUGAGUCCUUGCGUCUUCUACCGGCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3' (SEQ ID NO:203);

[0477] 5'-GAGUAUAUGUUAGGCCUGGGUGAGUCCUUGCGUCUUCUACCGGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO:204);

[0478] 5'-GAGUAUAUGUUAGGCCUGGGUGAGUCCUUGCGUCUUCUACCGGCGACUGGUUACCCGGUCG-3' (SEQ ID NO:205);

[0479] 5'-GAGUAUAUGUUAGGCCUGGGUGAGUCCUUGCGUCUUCUACCGCAGAACGUAUACUAUUCUG-3' (SEQ ID NO:206);

[0480] 5'-GalNAc-GAGUAUAUGUUAGGCCUGGGUGAGUCCUUGCGUCUUCUACCG-3' (SEQ ID NO:202);

[0481] 5'-FA-GAGUAUAUGUUAGGCCUGGGUGAGUCCUUGCGUCUUCUACCG-3' (SEQ ID NO:202);

[0482] 5'-DCL-GAGUAUAUGUUAGGCCUGGGUGAGUCCUUGCGUCUUCUACCG-3' (SEQ ID NO:202);

[0483] 5'-UAMC1110-GAGUAUAUGUUAGGCCUGGGUGAGUCCUUGCGUCUUCUACCG-3' (SEQ ID NO:202);

[0484] 6WJ - B

[0485] 5'-CGGUAGAAGACGCAAGGACUUGCUAGUUGUGGUACUGUUCCC-3' (SEQ ID NO:207);

[0486] 5'-CGGUAGAAGACGCAAGGACUUGCUAGUUGUGGUACUGUUCCCGCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3' (SEQ ID NO:208);

[0487] 5'-CGGUAGAAGACGCAAGGACUUGCUAGUUGUGGUACUGUUCCCGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO:209);

[0488] 5'-CGGUAGAAGACGCAAGGACUUGCUAGUUGUGGUACUGUUCCCGCGACUGGUUACCCGGUCG-3' (SEQ ID NO:210);

[0489] 5'-CGGUAGAAGACGCAAGGACUUGCUAGUUGUGGUACUGUUCCCCAGAACGUAUACUAUUCUG-3' (SEQ ID NO:211);

[0490] 5'-GalNAc-CGGUAGAAGACGCAAGGACUUGCUAGUUGUGGUACUGUUCCC-3' (SEQ ID NO:207);

[0491] 5'-FA CGGUAGAAGACGCAAGGACUUGCUAGUUGUGGUACUGUUCCC-3' (SEQ ID NO:207);

[0492] 5'-DCL

[0493] CGGUAGAAGACGCAAGGACUUGCUAGUUGUGGUACUGUUCCC-3' (SEQ ID NO:207);

[0494] 5'-UAMC1110-CGGUAGAAGACGCAAGGACUUGCUAGUUGUGGUACUGUUCCC-3' (SEQ ID NO:207);

[0495] 6WJ - C

[0496] 5'-GGGAACAGUACCACAACUAGUGUCCCGGGAUAGGGACAUACA-3' (SEQ ID NO:212);

[0497] 5'-GGGAACAGUACCACAACUAGUGUCCCGGGAUAGGGACAUACAGCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3' (SEQ ID NO:213);

[0498] 5'-GGGAACAGUACCACAACUAGUGUCCCGGGAUAGGGACAUACAGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO:214);

[0499] 5'-GGGAACAGUACCACAACUAGUGUCCCGGGAUAGGGACAUACAGCGACUGGUUACCCGGUCG-3' (SEQ ID NO:215);

[0500] 5'-GGGAACAGUACCACAACUAGUGUCCCGGGAUAGGGACAUACACAGAACGUAUACUAUUCUG 3' (SEQ ID NO:216);

[0501] 5'-GalNAc-GGGAACAGUACCACAACUAGUGUCCCGGGAUAGGGACAUACA-3' (SEQ ID NO:212);

[0502] 5'-FA GGGAACAGUACCACAACUAGUGUCCCGGGAUAGGGACAUACA-3' (SEQ ID NO:212);

[0503] 5'-DCL-GGGAACAGUACCACAACUAGUGUCCCGGGAUAGGGACAUACA-3' (SEQ ID NO:212);

[0504] 5'-UAMC1110-GGGAACAGUACCACAACUAGUGUCCCGGGAUAGGGACAUACA-3' (SEQ ID NO:212);

[0505] 6WJ - D

[0506] 5'-UGUAUGUCCCUAUCCCGGGAUGCCCAGGCCUAACAUAUACUC-3' (SEQ ID NO:217);

[0507] 5'-UGUAUGUCCCUAUCCCGGGAUGCCCAGGCCUAACAUAUACUCGCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3' (SEQ ID NO:218);

[0508] 5'-UGUAUGUCCCUAUCCCGGGAUGCCCAGGCCUAACAUAUACUCGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO:219);

[0509] 5'-UGUAUGUCCCUAUCCCGGGAUGCCCAGGCCUAACAUAUACUCGCGACUGGUUACCCGGUCG-3' (SEQ ID NO:220);

[0510] 5'-UGUAUGUCCCUAUCCCGGGAUGCCCAGGCCUAACAUAUACUCCAGAACGUAUACUAUUCUG-3' (SEQ ID NO:221);

[0511] 5'-GalNAc-UGUAUGUCCCUAUCCCGGGAUGCCCAGGCCUAACAUAUACUC-3' (SEQ ID NO:217);

[0512] 5'-FA-UGUAUGUCCCUAUCCCGGGAUGCCCAGGCCUAACAUAUACUC-3' (SEQ ID NO:217);

[0513] 5'-DCL-UGUAUGUCCCUAUCCCGGGAUGCCCAGGCCUAACAUAUACUC-3' (SEQ ID NO:217); or

[0514] 5'-UAMC1110-UGUAUGUCCCUAUCCCGGGAUGCCCAGGCCUAACAUAUACUC-3' (SEQ ID NO:217).

[0515] 5'XXGYYAXGXGXAXGXGGG cholesterol-3' (SEQ ID NO:222);

[0516] 5'YYYAYAXAYXXXGXXGAXYY cholesterol-3' (SEQ ID NO:223);

[0517] 5'GGAXYAAXYAXGGYAA-cholesterol-3' (SEQ ID NO:224);

[0518] 5'XXAGGXAAAGYYAYYXGYAGGXGYXAYYGAXGXAAXXYAA-cholesterol-3' (SEQ ID NO:225);

[0519] 5'XXGAAXXAYAXYGGXAGYAYGGGYXGXGYGAGGYXGAAYAG-cholesterol-3' (SEQ ID NO:226);

[0520] 5'YXGXXYAGYYXYGYAYAGYYAGYAYGYAYYXGAAXAGG-cholesterol-3' (SEQ ID NO:227);

[0521] 5'YYXAXXYAGGXGYGXGYXGGGYXGYAGGXGGYXXXAYYXAA-cholesterol-3' (SEQ ID NO:228);

[0522] 5'GAGXAXAXGXXAGGYYXGGGXGAGXYYXXGYGXYXXYXAYYG-cholesterol-3' (SEQ ID NO:229);

[0523] 5'YGGXAGAAGAYGYAAGGAYXXGYXAGXXGXGGXAYXGXXYYY-cholesterol-3' (SEQ ID NO:230);

[0524] 5'GGGAAYAGXAYYAYAAYXAGXGXYYYGGGAXAGGGAYAXAYA-cholesterol-3' (SEQ ID NO:231);

[0525] 5'XGXAXGXYYYXAXYYYGGGAXGYYYAGGYYXAAYAXAXAYXY-cholesterol-3' (SEQ ID NO:232), where X is floxuridine (5-fluorodeoxyuridine, UB5F), and where Y is gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF).

[0526] In some embodiments, the disclosed RNA oligonucleotides have one of the following sequences:

[0527] 5'UUGYYAUGUGUAUGUGGG cholesterol-3' (SEQ ID NO:233);

[0528] 5'YYYAYAUAYUUUGUUGAUYY cholesterol-3' (SEQ ID NO:234);

[0529] 5'GGAUYAAUYAUGGYAA cholesterol-3' (SEQ ID NO:235);

[0530] 5'UUAGGUAAAGYYAYYUGYAGGUGYUAYYGAUGUAAUUYAA cholesterol-3' (SEQ ID NO:236);

[0531] 5'UUGAAUUAYAUYGGUAGYAYGGGYUGUGYGAGGYUGAAYAG Cholesterol-3' (SEQ ID NO:237);

[0532] 5'YUGUUYAGYYUYGYAYAGYYAGYAYGYAYYUGAAUAGG Cholesterol-3' (SEQ ID NO:238);

[0533] 5'YYUAUUYAGGUGYGUGYUGGGYUGYAGGUGGYUUUAYYUAA Cholesterol-3' (SEQ ID NO:239);

[0534] 5'GAGUAUAUGUUAGGYYUGGGUGAGUYYUUGYGUYUUYUAYYG Cholesterol-3' (SEQ ID NO:240);

[0535] 5'YGGUAGAAGAYGYAAGGAYUUGYUAGUUGUGGUAYUGUUYYY Cholesterol-3' (SEQ ID NO:241);

[0536] 5'GGGAAYAGUAYYAYAAYUAGUGUYYYGGGAUAGGGAYAUAYA Cholesterol-3' (SEQ ID NO:242);

[0537] 5'UGUAUGUYYYUAUYYYGGGAUGYYYAGGYYUAAYAUAUAYUY Cholesterol-3' (SEQ ID NO:243), where Y is gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF).

[0538] 5'XXGCCAXGXGXAXGXGGG - Cholesterol-3' (SEQ ID NO:244);

[0539] 5'CCCACAXACXXXGXXGAXCC - Cholesterol-3' (SEQ ID NO:245);

[0540] 5'GGAXCAAXCAXGGCAA - Cholesterol-3' (SEQ ID NO:246);

[0541] 5'XXAGGXAAAGCCACCXGCAGGXGCXACCGAXGXAAXXCAA - Cholesterol-3' (SEQ ID NO:247);

[0542] 5'XXGAAXXACAXCGGXAGCACGGGCXGXGCGAGGCXGAACAG-cholesterol-3' (SEQ ID NO:248);

[0543] 5'CXGXXCAGCCXCGCACAGCCAGCACGCACCXGAAXAGG-cholesterol-3' (SEQ ID NO:249);

[0544] 5'CCXAXXCAGGXGCGXGCXGGGCXGCAGGXGGCXXXACCXAA-cholesterol-3' (SEQ ID NO:250);

[0545] 5'GAGXAXAXGXXAGGCCXGGGXGAGXCCXXGCGXCXXCXACCG-cholesterol-3' (SEQ ID NO:251);

[0546] 5'CGGXAGAAGACGCAAGGACXXGCXAGXXGXGGXACXGXXCCC-cholesterol-3' (SEQ ID NO:252);

[0547] 5'GGGAACAGXACCACAACXAGXGXCCCGGGAXAGGGACAXACA-cholesterol-3' (SEQ ID NO:253);

[0548] 5'XGXAXGXCCCXAXCCCGGGAXGCCCAGGCCXAACAXAXACXC-cholesterol-3' (SEQ ID NO:254), where X is fluorouridine (5-fluorodeoxyuridine, UB5F).

[0549] 5'UUGCCAUGUGUAUGUGGG-cholesterol-3' (SEQ ID NO:255);

[0550] 5'CCCACAUACUUUGUUGAUCC-cholesterol-3' (SEQ ID NO:256);

[0551] 5'GGAUCAAUCAUGGCAA-cholesterol-3' (SEQ ID NO:257);

[0552] 5'UUAGGUAAAGCCACCUGCAGGUGCUACCGAUGUAAUUCAA-cholesterol-3' (SEQ ID NO:258);

[0553] 5'UUGAAUUACAUCGGUAGCACGGGCUGUGCGAGGCUGAACAG-cholesterol-3'(SEQ ID NO:259);

[0554] 5'CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGG-cholesterol-3'(SEQ ID NO:260);

[0555] 5'CCUAUUCAGGUGCGUGCUGGGCUGCAGGUGGCUUUACCUAA-cholesterol-3'(SEQ ID NO:261);

[0556] 5'GAGUAUAUGUUAGGCCUGGGUGAGUCCUUGCGUCUUCUACCG-cholesterol-3'(SEQ ID NO:262);

[0557] 5'CGGUAGAAGACGCAAGGACUUGCUAGUUGUGGUACUGUUCCC-cholesterol-3'(SEQ ID NO:263);

[0558] 5'GGGAACAGUACCACAACUAGUGUCCCGGGAUAGGGACAUACA-cholesterol-3'(SEQ ID NO:264);

[0559] 5'UGUAUGUCCCUAUCCCGGGAUGCCCAGGCCUAACAUAUACUC-cholesterol-3'(SEQ ID NO:265);

[0560] With extended survivin sense strand

[0561] 5'XXGYAGGXXYYXXAXYXGXYAXXAYAXAYAYYYX-cholesterol-3'(SEQ ID NO:266);

[0562] 5'UUGYAGGUUYYUUAUYUGUYAUUAYAUAYAYYYU-cholesterol-3'(SEQ ID NO:267);

[0563] 5'XXGCAGGXXCCXXAXCXGXCAXXACAXACACCCX-cholesterol-3'(SEQ ID NO:268);

[0564] 5'UUGCAGGUUCCUUAUCUGUCAUUACAUACACCCU-cholesterol-3'(SEQ ID NO:269).

[0565] With extended RRM2 sense strand

[0566] 5'XXGYGAXXXAGYYAAGAAGXXYAXXAYAXAYAYYYX-cholesterol-3' (SEQ ID NO:270);

[0567] 5'UUGYGAUUUAGYYAAGAAGUUYAUUAYAUAYAYYYU-cholesterol-3' (SEQ ID NO:271);

[0568] 5'XXGCGAXXXAGCCAAGAAGXXCAXXACAXACACCCX-cholesterol-3' (SEQ ID NO:272);

[0569] 5'UUGCGAUUUAGCCAAGAAGUUCAUUACAUACACCCU-cholesterol-3' (SEQ ID NO:273);

[0570] where X is floxuridine (5-fluorodeoxyuridine, UB5F), where Y is gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF), where C, U are 2F'-modified C, U, and where A, G are unmodified.

[0571] Survivin antisense strand

[0572] 5'UGACAGAUAAGGAACCUGC 3' (SEQ ID NO:1).

[0573] RRM2 antisense strand

[0574] 5'UGAACUUCUUGGCUAAAUCGC 3' (SEQ ID NO:3).

[0575] Survivin antisense strand extension

[0576] 5'GGGUGUAUGUAAUGACAGAUAAGGAACCUGC 3' (SEQ ID NO:4).

[0577] RRM2 antisense strand

[0578] 5'GGGUGUAUGUAAUGAACUUCUUGGCUAAAUCGC 3' (SEQ ID NO:2);

[0579] Extension

[0580] 5'GGGUGUAUGUAA 3' (SEQ ID NO:5), where A, C, G, and U are unmodified.

[0581] Modular RNA nanostructures can be composed of 3, 4, 5, 6, 7, 8, 9, or more synthetic single-stranded RNA oligonucleotides, which can self-assemble into RNA nanostructures via hybridization. The length of each synthetic single-stranded RNA oligonucleotide can be from about 16 to about 120 bases. The exact sequence of each synthetic single-stranded RNA oligonucleotide in each modular RNA nanostructure can be designed such that when they assemble with two or more other synthetic single-stranded RNA oligonucleotides, they achieve specific physical characteristics. RNA nanostructures can be composed of 3, 4, 5, 6, 7, 8, 9, or more synthetic RNA oligonucleotides. The synthetic RNA oligonucleotides can be designed such that when they self-assemble, they form highly ordered 2-D and / or 3-D structures. RNA nanostructures can have 3, 4, 5, 6, 7, 8, 9, or more double-stranded arms (DAs) derived from a core domain. The DAs can be arranged symmetrically or asymmetrically around the core domain.

[0582] The core domain can have 0 to 4 symmetric or asymmetric bulged nucleotides that separate individual DAs, which can allow for optimizing thermodynamic stability, spatial constraints, and / or the structural arrangement of individual loops. Alterations in both the duplex sequence (DA) and the number of unpaired core nucleotides can affect the thermodynamic stability of the RNA nanostructure. Thus, the physical properties and functional characteristics can be optimized by changing the sequences of the synthetic RNA oligonucleotides that form the RNA nanostructure.

[0583] The melting temperature (Tm) of the RNA nanostructure can be about 65°C or higher. In some aspects, the melting temperature of the RNA nanostructure can be greater than 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100°C. In some aspects, the Tm of the RNA nanostructure can be 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100°C.

[0584] Synthetic RNA oligonucleotides can be single-stranded. Each individual synthetic RNA oligonucleotide can consist of 16 - 120 nucleotides. The nucleotides can be native ribonucleotides or can be modified. In some aspects, the synthetic RNA oligonucleotides can be 2'-modified. The 2'- or other modification can be 2'-fluoro-, 2'-O-methyl-, LNA-, or any other backbone, sugar, or base-modified ribonucleotide, or any combination of native, backbone, sugar, and base-modified ribonucleotides. Modifications are further discussed elsewhere herein. Each synthetic RNA oligonucleotide can consist of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, or 120 nucleotides or any range therebetween. Each synthetic RNA oligonucleotide can be designed and configured such that it can be assembled with 2, 3, 4, 5, 6, 7, 8 or more other synthetic RNA oligonucleotides into an RNA nanostructure as described herein.

[0585] In addition to the nucleoside analogs described herein, the remaining nucleotides can be unmodified or modified nucleotides. The modifications can be 5'-end modifications and / or 3'-end modifications and / or 2'-internal sugar modifications and / or internal base modifications. Typical 5'-end modifications include amino, carboxyl, phosphate ester, thiol, maleimide, alkyne, cholesterol, aldehyde, carbon spacer, Peg spacer, diploid, triploid, photocleavable amino, photocleavable spacer, fluorophore (such as cyanine 3, 3.5, 5, 5.5, 7, fluorescein, etc.), biotin, desthiobiotin, digoxigenin, quencher (dabcyl, dabsyl, BlackHole, BBQ650, etc.) or other 5'-modifications known to a skilled user in the art. Typical 3'-end modifications include amino, carboxyl, phosphate ester, thiol, alkyne, cholesterol, carbon spacer, Peg spacer, fluorophore (such as cyanine 3, 3.5, 5, 5.5, 7, fluorescein, etc.), biotin, desthiobiotin, digoxigenin, quencher (dabcyl, dabsyl, BlackHole, BBQ650, etc.) or other 3'-modifications known to a skilled user in the art. Typical internal modifications include amino dA, amino dC, amino dT, carboxyl dT, 2'-O-propynyl, 2'-amino, 2'-fluoro, 2'-methoxy, 5-ethynyl-dU, C8-alkynyl-dC, C8-alkynyl-dT, carbon spacer, Peg spacer, fluorophore (such as cyanine 3, 3.5, 5, 5.5, 7, fluorescein, etc.), biotin, desthiobiotin, digoxigenin, quencher (dabcyl, dabsyl, BlackHole, BBQ650, etc.) or other 5'-modifications known to a skilled user in the art. The modification can be an alkyne group attached to the nucleotide. The modification can be a functional group attached to the nucleotide. One or more of the terminal (e.g., 5' and / or 3'-end) nucleotides in the synthetic RNA oligonucleotide can be modified.

[0586] When measured along the longest or maximum dimension of the RNA nanostructure, the RNA nanostructure can have dimensions up to microns. When measured along the longest or maximum dimension of the RNA nanostructure, the dimensions of the RNA nanostructure can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, or about 900 nm. In some aspects, when measured along the longest or maximum dimension of the RNA nanostructure, the dimensions of the RNA nanostructure can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 nm or any range of values therebetween. In some aspects, when measured along the longest or maximum dimension of the RNA nanostructure, the dimensions of the RNA nanostructure can be about 1 to 30, 1 to 40, 1 to 50, 10 to 50, 10 to 40, 10 to 30, 30 to 50, 30 to 40, or 40 to 50 nm. In some aspects, the RNA nanostructure can be substantially spherical. In other aspects, the RNA nanostructure can be triangular planar, triangular pyramidal, T-shaped, tetrahedral, square planar, seesaw-shaped, trigonal bipyramidal, square pyramidal, pentagonal planar, octahedral, triangular prism, pentagonal pyramidal, pentagonal bipyramidal, square antiprismatic, tricapped trigonal prism, capped square antiprismatic, arrow-shaped, arrow-tail-shaped, X-shaped, or a deformed version of any of these shapes.

[0587] The principle for designing self-assembling nucleic acid nanostructures is that sequence complementarity in nucleic acid strands is encoded such that by pairing complementary segments, the nucleic acid strands self-organize into predefined nanostructures under appropriate physical conditions. Based on this fundamental principle (see, e.g., Seeman N.C. J. Theor. Biol. 99:237, 1982, which is incorporated herein by reference), researchers have created a number of synthetic nucleic acid nanostructures (see, e.g., Seeman N.C. Nature 421:427, 2003; Shih W.M. et al. Curr. Opin. Struct. Biol. 20:276, 2010, each of which is incorporated herein by reference).Examples of nucleic acid (e.g., DNA) nanostructures that can be used in accordance with the present disclosure and methods for generating such structures are known and include, but are not limited to, lattice structures (see, e.g., Winfree E. et al. Nature 394:539, 1998; Yan H. et al. Science 301:1882, 2003; Yan H. et al. Proc. Natl. Acad. of Sci. USA 100; 8103, 2003; Liu D. et al. J. Am. Chem. Soc. 126:2324, 2004; Rothemund P.W.K. et al. PLoS Biology 2:2041, 2004, each of which is incorporated herein by reference), ribbon structures (see, e.g., Park S.H. et al. Nano Lett. 5:729, 2005; Yin P. et al. Science 321:824, 2008, each of which is incorporated herein by reference), tubular structures (see, e.g., Yan H. Science, 2003; P. Yin, 2008, each of which is incorporated herein by reference), finite two- and three-dimensional objects having defined shapes (see, e.g., Chen J. et al. Nature 350:631, 1991; Rothemund P.W.K., Nature, 2006; He Y. et al. Nature 452:198, 2008; Ke Y. et al. Nano. Lett. 9:2445, 2009; Douglas S.M. et al. Nature 459:414, 2009; Dietz H. et al. Science 325:725, 2009; Andersen E.S. et al. Nature 459:73, 2009; Liedl T. et al. Nature Nanotech. 5:520, 2010; Han D. et al. Science 332:342, 2011, each of which is incorporated herein by reference), and macroscopic crystals (see, e.g., Meng J.P. et al. Nature 461:74, 2009, which is incorporated herein by reference). The synthetic RNA oligonucleotides can be single-stranded nucleic acids, double-stranded nucleic acids, or a combination of single-stranded and double-stranded nucleic acids.

[0588] RNA nanostructure components (synthetic RNA oligonucleotides and modular RNA motifs) can be designed using the computer-aided design methods described herein. Although a particular RNA nanostructure is used to illustrate the computer design, it will be understood that the principles taught therein will be capable of being extrapolated by one of ordinary skill in the art to any desired RNA nanostructure.

[0589] Each synthetic RNA oligonucleotide can be designed such that when it is combined with two or more additional synthetic RNA oligonucleotides, base pairing occurs to produce a highly ordered 2-D and 3-D structure that has three or more DAs around a core domain that may or may not contain base pairing between strands and that can include from 0 to 4 nucleotides that form symmetric or asymmetric bulges between the DAs. Each synthetic RNA oligonucleotide can be designed to include from 16 to 120 nucleotides. Each synthetic RNA oligonucleotide can be designed to include one or more modified nucleotides.

[0590] The rational design of the synthetic RNA oligonucleotides and / or RNA nanostructures described herein can be performed in a computing environment. The computing environment can include one or more computing devices, which can include at least one processor circuit, e.g., a computing device that can have a processor and a memory. Various applications and / or other functions can be performed in the computing environment in accordance with various aspects of the present disclosure. Additionally, various data can be stored in one or more data stores that can be accessed by the computing environment.

[0591] For example, the components executed on the computing environment can include a rational RNA design system, as well as other applications, services, processes, systems, engines, or functions not discussed in detail herein. The rational RNA design system can be executed to facilitate the design of the synthetic RNA oligonucleotides and / or RNA nanostructures as described herein. The rational RNA design system can also perform various backend functions that can be associated with the design of RNA oligonucleotides, such as those synthetic RNA oligonucleotides and / or RNA nanostructures described herein.

[0592] The synthetic RNA oligonucleotides can be synthesized using standard molecular biology techniques and biochemical techniques. In other words, the various nucleic acids that can form RNA nanoparticles can be synthesized de novo as needed. Such synthetic techniques will be known to those of skill in the art.

[0593] Drug formulations

[0594] Drug formulations are also provided herein that can include an amount of the RNA complexes or nanostructures described herein and a pharmaceutical carrier suitable for administration to an individual in need thereof. The individual in need thereof may have or may be suspected of having cancer or other disease or disorder that requires treatment or prevention. In some embodiments, the subject in need thereof requires a diagnostic procedure, such as an imaging procedure. The drug formulation can include an amount of the RNA complexes or nanostructures described herein that can effectively treat or prevent cancer.

[0595] The formulation can be administered via any suitable route of administration. For example, the formulation (and / or composition) can be administered orally, intravenously, ophthalmically, intravitreally, intramuscularly, vaginally, intraperitoneally, rectally, parenterally, topically, intranasally, or subcutaneously to a subject in need thereof. Other suitable routes are described herein. In some embodiments, the RNA complex or nanostructure contains an effective amount of the cargo molecule.

[0596] The RNA complex or nanostructure can be formulated in the form of a solution or suspension for parenteral delivery such as by injection or infusion. The formulation can be administered via any route, such as the bloodstream or direct administration to the organ or tissue to be treated.

[0597] Parenteral formulations can be prepared as aqueous compositions using techniques known in the art. Generally, such compositions can be prepared as injectable formulations, for example, solutions or suspensions; solid forms suitable for reconstitution with a reconstitution medium to form a solution or suspension prior to injection; emulsions, such as water-in-oil (w / o) emulsions, oil-in-water (o / w) emulsions and their microemulsions, liposomes, or lipid particles.

[0598] The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, one or more polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), oils (such as vegetable oils (e.g., peanut oil, corn oil, sesame oil, etc.)), and combinations thereof. Appropriate fluidity can be maintained, for example, by using coatings such as lecithin, by maintaining the desired particle size in the case of a dispersion, and / or by using surfactants. In many cases, it is preferred to include isotonic agents, such as sugars or sodium chloride.

[0599] Solutions and dispersions of the RNA nanostructures as described herein can be prepared in water or another solvent or dispersion medium suitably admixed with one or more pharmaceutically acceptable excipients, which include, but are not limited to, surfactants, dispersants, emulsifiers, pH modifiers, and combinations thereof.

[0600] Suitable surfactants can be anionic, cationic, amphoteric or non-ionic surfactants. Suitable anionic surfactants include, but are not limited to, those containing carboxylate, sulfonate and sulfate ions. Suitable anionic surfactants include the sodium, potassium, ammonium salts of long-chain alkylsulfonic acids and alkylarylsulfonic acids, such as sodium dodecylbenzenesulfonate; dialkyl sulfosuccinates, such as bis-(2-ethylhexyl)-sulfosuccinate; and alkyl sulfates, such as sodium lauryl sulfate. Suitable cationic surfactants include, but are not limited to, quaternary ammonium compounds, such as benzalkonium chloride, benzethonium chloride, cetrimide, stearyl dimethyl benzyl ammonium chloride, polyoxyethylene and coconut amine. Suitable non-ionic surfactants include ethylene glycol monostearate, propylene glycol myristate, glycerol monostearate, glyceryl stearate, polyglyceryl-4 oleate, sorbitan acylates, sucrose acylates, PEG-150 laurate, PEG-400 monolaurate, polyoxyethylene monolaurate, polysorbates, polyoxyethylene octylphenylether, PEG-1000 cetyl ether, polyoxyethylene tridecyl ether, polypropylene glycol butyl ether, 401, stearoyl monoisopropanolamide and polyoxyethylene hydrogenated tallowamide. Examples of amphoteric surfactants include sodium N-dodecyl-β-alaninate, sodium N-lauryl-β-imino dipropionate, myristoamphoacetate, lauryl betaine and lauryl sulfobetaine.

[0601] The formulation can contain preservatives to prevent the growth of microorganisms. Suitable preservatives include, but are not limited to, parabens, chlorobutanol, phenol, sorbic acid and thimerosal. The formulation can also contain antioxidants to prevent the degradation of the RNA complex or nanostructure.

[0602] The formulation can be buffered to a pH of 3 to 8 for parenteral administration after reconstitution. Suitable buffers include, but are not limited to, phosphate buffer, acetate buffer and citrate buffer.

[0603] Water-soluble polymers can be used in formulations for parenteral administration. Suitable water-soluble polymers include, but are not limited to, polyvinylpyrrolidone, dextran, carboxymethylcellulose, and polyethylene glycol. Sterile injectable solutions can be prepared by incorporating the required amount of the RNA complex or nanostructure in a suitable solvent or dispersion medium, followed by filtration sterilization, the solvent or dispersion medium optionally carrying one or more of the excipients listed above. Dispersions can be prepared by incorporating the various sterilized RNA complexes or nanostructures into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those listed above. Sterile powders for the preparation of sterile injectable solutions can be prepared by vacuum drying and lyophilization techniques that yield a powder of the RNA complex or nanostructure plus any additional desired ingredients from its previously sterile filtered solution. The powder can be prepared in such a way that the particles are porous in nature, which can increase the dissolution of the particles. Methods for making porous particles are well known in the art.

[0604] Pharmaceutical formulations for parenteral administration can be in the form of a sterile aqueous solution or suspension of particles formed from one or more RNA complexes or nanostructures. Acceptable solvents include, for example, water, Ringer's solution, phosphate-buffered saline (PBS), and isotonic sodium chloride solution. The formulation can also be a sterile solution, suspension, or emulsion in a non-toxic, parenterally acceptable diluent or solvent such as 1,3-butanediol.

[0605] In some cases, the formulation can be dispensed or packaged in liquid form. In other respects, formulations for parenteral administration can be packaged as solids, for example, obtained by lyophilizing a suitable liquid formulation. The solid can be reconstituted with a suitable vehicle or diluent prior to administration.

[0606] In some cases, solutions, suspensions, or emulsions for parenteral administration can be buffered with an effective amount of a buffer to maintain a pH suitable for ophthalmic administration. Suitable buffers include, but are not limited to, acetate, borate, carbonate, citrate, and phosphate buffers.

[0607] Solutions, suspensions, or emulsions for parenteral administration can also contain one or more tonicity agents to adjust the isotonic range of the formulation. Suitable tonicity agents include, but are not limited to, glycerol, mannitol, sorbitol, sodium chloride, and other electrolytes.

[0608] Solutions, suspensions, or emulsions for parenteral administration can also contain one or more preservatives to prevent bacterial contamination of the ophthalmic formulation. Suitable preservatives include, but are not limited to, polyhexamethylene biguanide (PHMB), benzalkonium chloride (BAK), stabilized oxychloros complex (also known as )、Phenylmercuric acetate, chlorobutanol, sorbic acid, chlorhexidine, benzyl alcohol, parabens, thimerosal and mixtures thereof.

[0609] Solutions, suspensions or emulsions for nanotechnology, including nanoformulations for parenteral administration, may also contain one or more excipients such as dispersants, wetting agents and suspending agents.

[0610] RNA complexes or nanostructures as described herein can be formulated for topical administration. Suitable dosage forms for topical administration include creams, ointments, pastes, sprays, gels, lotions, emulsions, liquids and transdermal patches. The formulation can be formulated for transmucosal, trans-epithelial, trans-endothelial or transdermal administration. Topical formulations may contain one or more chemical penetration enhancers, membrane permeants, membrane transporters, emollients, surfactants, stabilizers and combinations thereof.

[0611] In some aspects, the RNA complex or nanostructure can be administered in the form of a liquid formulation (such as a solution or suspension), a semi-solid formulation (such as a lotion or ointment) or a solid formulation. In some aspects, the RNA nanostructure can be administered in the form of a liquid (including solutions and suspensions, such as eye drops) or a semi-solid formulation (such as an ointment or lotion for topical application to the skin, mucosa (such as the eye), vagina or rectum).

[0612] The formulation may contain one or more excipients such as emollients, surfactants, emulsifiers, penetration enhancers, etc.

[0613] Suitable emollients include but are not limited to almond oil, castor oil, carob extract, cetearyl alcohol, cetyl alcohol, cetyl esters wax, cholesterol, cottonseed oil, cyclomethicone, cetearyl ethylhexanoate, glycerol, glyceryl monostearate, glyceryl monooleate, isopropyl myristate, isopropyl palmitate, lanolin, lecithin, light mineral oil, medium chain triglycerides, mineral oil and lanolin alcohol, petrolatum, petrolatum and lanolin alcohol, soybean oil, starch, stearyl alcohol, sunflower oil, xylitol and combinations thereof. In some aspects, the emollient can be ethylhexyl stearate and ethylhexyl palmitate.

[0614] Suitable surfactants include but are not limited to emulsifying wax, glyceryl monooleate, polyoxyethylene alkyl ethers, polyoxyethylene ether castor oil derivatives, polysorbates, sorbitan esters, benzyl alcohol, benzyl benzoate, cyclodextrin, glyceryl monostearate, poloxamers, povidone and combinations thereof. In some aspects, the surfactant can be stearyl alcohol.

[0615] Suitable emulsifiers include, but are not limited to, gum arabic, metallic soaps, certain animal and vegetable oils and various polar compounds, anionic emulsifying waxes, calcium stearate, carbomer, cetearyl alcohol, cetyl alcohol, cholesterol, diethanolamine, ethylene glycol monopalmitostearate, glycerol monostearate, glycerol monooleate, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lanolin, lanolin alcohol, lecithin, medium-chain triglycerides, methylcellulose, mineral oil and lanolin alcohol, sodium dihydrogen phosphate, monoethanolamine, nonionic emulsifying waxes, oleic acid, poloxamer, various poloxamers, polyoxyethylene alkyl ethers, polyoxyethylene castor oil derivatives, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene stearate, propylene glycol alginate, self-emulsifying glycerol monostearate, sodium citrate dehydrate, sodium lauryl sulfate, sorbitan esters, stearic acid, sunflower oil, tragacanth, triethanolamine, xanthan gum, and combinations thereof. In some aspects, the emulsifier can be glyceryl stearate.

[0616] Suitable classes of permeation enhancers include, but are not limited to, fatty alcohols, fatty acid esters, fatty acids, fatty alcohol ethers, amino acids, phospholipids, lecithin, bile salts, enzymes, amines and amides, complexing agents (liposomes, cyclodextrins, modified celluloses and imides), macrocyclic compounds such as macrolides, ketones and anhydrides, and cyclic ureas, surfactants, N-methylpyrrolidone and its derivatives, DMSO and related compounds, ionic compounds, azone and related compounds, and solvents such as alcohols, ketones, amides, polyols (e.g., diols).

[0617] Suitable emulsions include, but are not limited to, water-in-oil and oil-in-water emulsions. Either or both phases of the emulsion can include a surfactant, an emulsifier, and / or a liquid non-volatile non-aqueous material. In some aspects, the surfactant can be a nonionic surfactant. In other aspects, the emulsifier is an emulsifying wax. In further aspects, the liquid non-volatile non-aqueous material is a diol. In some aspects, the diol is propylene glycol. The oil phase can contain other suitable oil-based pharmaceutically acceptable excipients. Suitable oil-based pharmaceutically acceptable excipients include, but are not limited to, hydroxylated castor oil or sesame oil, which can be used as a surfactant or emulsifier in the oil phase.

[0618] Also provided are lotions containing the RNA nanostructures described herein. In some aspects, the lotion can be in the form of an emulsion having a viscosity between 100 centistokes and 1000 centistokes. The flowability of the lotion can allow for rapid and uniform application over a wide surface area. The lotion can be formulated to dry on the skin, leaving a thin layer of the pharmaceutical component on the surface of the skin.

[0619] Also provided is an ointment containing RNA complexes or nanostructures as described herein. The ointment may contain an emulsifier and / or other stabilizers. In some aspects, the ointment is in the form of an ointment having a viscosity greater than 1000 centistokes (generally in the range of 20,000 to 50,000 centistokes). Compared with an ointment, the ointment is more easily diffused and more easily removed.

[0620] One difference between creams and lotions is the viscosity, which depends on the amount / use of various oils and the percentage of water used to prepare the formulation. Creams can be thicker than lotions, can have a variety of uses, and can have more different oils / butter depending on the desired effect on the skin. In some aspects of cream formulations, the water base percentage can be about 60% to about 75%, and the oil base percentage can be about 20% to about 30% of the total, while the other percentages are emulsifiers, preservatives, and additives, totaling 100%.

[0621] Also provided is an ointment containing RNA complexes or nanostructures as described herein and a suitable ointment base. Suitable ointment bases include hydrocarbon bases (e.g., petrolatum, white vaseline, yellow ointment, and mineral oil); Absorbent bases (hydrophilic petrolatum, dehydrated lanolin, lanolin, and cold cream); Water-removable bases (e.g., hydrophilic ointments) and water-soluble bases (e.g., polyethylene glycol ointments). Pastes are generally different from ointments because they contain a larger proportion of solids. Compared with ointments prepared with the same components, pastes are generally more absorbent and less greasy.

[0622] Also described herein are gels containing RNA complexes or nanostructures as described herein, gelling agents, and liquid carriers. Suitable gelling agents include, but are not limited to, modified celluloses such as hydroxypropyl cellulose and hydroxyethyl cellulose; carbomer homopolymers and copolymers; thermoreversible gels and combinations thereof. Suitable solvents in the liquid carrier include, but are not limited to, diethylene glycol monoethyl ether; alkylene glycols such as propylene glycol; dimethyl isosorbide; alcohols such as isopropanol and ethanol. The solvent may be selected for its ability to dissolve the drug. Other additives that may improve the skin feel and / or emollient properties of the formulation may also be incorporated. Such additives include, but are not limited to, isopropyl myristate, ethyl acetate, C 12 -C 15 Alkyl benzoates, mineral oil, squalane, cyclomethicone, capric / caprylic triglyceride, and combinations thereof.

[0623] The present disclosure also describes a foaming agent that can comprise an RNA complex or nanostructure as described herein. The foaming agent can be an emulsion combined with a gaseous propellant. The gaseous propellant can comprise hydrofluoroalkane (HFA). Suitable propellants include HFAs such as 1,1,1,2-tetrafluoroethane (HFA 134a) and 1,1,1,2,3,3,3-heptafluoropropane (HFA 227), but mixtures and blends of these HFAs with other HFAs that are currently approved or may be approved for medical use are suitable. The propellant can be free of hydrocarbon propellant gases, which may produce flammable or explosive vapors during spraying. Additionally, the foaming agent can be free of volatile alcohols, which may produce flammable or explosive vapors during use.

[0624] A buffer can be used to control the pH of the composition. The buffer can buffer the composition from a pH of about 4 to a pH of about 7.5, from a pH of about 4 to a pH of about 7, or from a pH of about 5 to a pH of about 7. In some aspects, the buffer can be triethanolamine.

[0625] A preservative can be included to prevent the growth of fungi and microorganisms. Suitable preservatives include, but are not limited to, benzoic acid, butylparaben, ethylparaben, methylparaben, propylparaben, sodium benzoate, sodium propionate, benzalkonium chloride, benzethonium chloride, benzyl alcohol, cetylpyridinium chloride, chlorobutanol, phenol, phenethyl alcohol, and thimerosal.

[0626] In certain aspects, a formulation can be provided by continuously delivering one or more formulations to a patient in need thereof. For topical application, repeated applications can be made, or a patch can be used to provide continuous administration of noscapine over an extended period of time.

[0627] An RNA complex or nanostructure as described herein can be formulated into an enteral formulation, such as for oral administration. Suitable oral dosage forms include tablets, capsules, solutions, suspensions, syrups, and lozenges. Tablets can be manufactured using compression or molding techniques well known in the art. Using techniques well known in the art, gelatin or non-gelatin capsules can be prepared as hard or soft capsule shells, which can encapsulate liquid, solid, and semi-solid fill materials.

[0628] Pharmaceutical acceptable carriers can be used to prepare formulations containing RNA complexes or nanostructures. As commonly used herein, "carrier" includes, but is not limited to, diluents, preservatives, binders, lubricants, disintegrants, swelling agents, fillers, stabilizers, and combinations thereof. Polymers used in dosage forms include, but are not limited to, suitable hydrophobic or hydrophilic polymers and suitable pH-dependent or independent polymers. Suitable hydrophobic and hydrophilic polymers include, but are not limited to, hydroxypropyl methylcellulose, hydroxypropyl cellulose, hydroxyethyl cellulose, carboxymethyl cellulose, polyethylene glycol, ethyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, polyvinyl alcohol, polyvinyl acetate, and ion exchange resins. "Carrier" also includes all components of the coating composition, which may include plasticizers, pigments, colorants, stabilizers, and glidants.

[0629] Formulations containing RNA complexes or nanostructures as described herein can be prepared using one or more pharmaceutical acceptable excipients, which include diluents, preservatives, binders, lubricants, disintegrants, swelling agents, fillers, stabilizers, and combinations thereof.

[0630] Sustained release dosage formulations containing RNA complexes or nanostructures as described herein can be prepared as described in standard references such as: "Pharmaceutical dosage form tablets", edited by Liberman et al. (New York, Marcel Dekker, Inc., 1989); "Remington – The science and practice of pharmacy", 20th edition, Lippincott Williams & Wilkins, Baltimore, MD, 2000; and "Pharmaceutical dosage forms and drug delivery systems", 6th edition, Ansel et al., (Media, PA: Williams and Wilkins, 1995). These references provide information on excipients, materials, equipment, and processes for preparing sustained release dosage forms of tablets and capsules, as well as tablets, capsules, and granules. These references provide information on carriers, materials, equipment, and processes for preparing sustained release dosage forms of tablets and capsules, as well as tablets, capsules, and granules.

[0631] Formulations containing the RNA complexes or nanostructures described herein can be coated with suitable coating materials, e.g., for delayed release once the particles have traversed the acidic environment of the stomach. Suitable coating materials include, but are not limited to, cellulose polymers such as cellulose acetate phthalate, hydroxypropyl cellulose, hydroxypropyl methylcellulose, hydroxypropyl methylcellulose phthalate, and hydroxypropyl methylcellulose acetate succinate; polyvinyl acetate phthalate, acrylic polymers and copolymers, methacrylic resins commercially available under the trade name (Roth Pharma, Westerstadt, Germany), zein, shellac, and polysaccharides.

[0632] With or without water-insoluble / water-soluble nonpolymeric excipients, the coating can be formed with different ratios of water-soluble polymers, water-insoluble polymers, and / or pH-dependent polymers to produce the desired release properties. The coating can be applied to dosage forms (matrix dosage forms or simple dosage forms), including but not limited to tablets (compressed with or without coating beads), capsules (with or without coating beads), beads, particulate compositions, "as is ingredients" formulated as but not limited to suspension form or spray dosage forms.

[0633] In addition, the coating material can contain conventional carriers such as plasticizers, pigments, colorants, glidants, stabilizers, pore formers, and surfactants. Optional pharmaceutically acceptable excipients include, but are not limited to, diluents, binders, lubricants, disintegrants, colorants, stabilizers, and surfactants.

[0634] Diluents, also known as "fillers", can be used to increase the bulk of solid dosage forms such that practical sizes are provided for the compression of tablets or the formation of beads and granules. Suitable diluents include, but are not limited to, dicalcium phosphate dihydrate, calcium sulfate, lactose, sucrose, mannitol, sorbitol, cellulose, microcrystalline cellulose, kaolin, sodium chloride, dried starch, hydrolyzed starch, pregelatinized starch, silica, titanium oxide, magnesium aluminum silicate, and powdered sugar. Commonly used diluents include inert powdery substances such as starch, powdered cellulose (especially crystalline and microcrystalline cellulose), sugars (such as fructose, mannitol, and sucrose), cereal flours, and similar edible powders. Typical diluents include, for example, various types of starch, lactose, mannitol, kaolin, calcium phosphate or calcium sulfate, inorganic salts (such as sodium chloride), and powdered sugar. Powdered cellulose derivatives are also useful.

[0635] Binders can impart cohesiveness to solid dosage formulations and can thus ensure that tablets or beads or granules remain intact after formation of the dosage form. Suitable binder materials include, but are not limited to, starches, pregelatinized starches, gelatin, sugars (including sucrose, glucose, dextrose, lactose, and sorbitol), polyethylene glycols, waxes, natural and synthetic gums such as gum arabic, tragacanth, sodium alginate, celluloses (including hydroxypropylmethylcellulose, hydroxypropylcellulose, ethylcellulose), and magnesium aluminum silicate salts, as well as synthetic polymers such as acrylic and methacrylic acid copolymers, methacrylic acid copolymers, methyl methacrylate copolymers, aminoalkyl methacrylate copolymers, polyacrylic acid / polymethacrylic acid, and polyvinylpyrrolidone. Typical tablet binders include substances such as starches, gelatin, and sugars (such as lactose, fructose, and glucose). Natural and synthetic gums, including gum arabic, alginates, methylcellulose, and polyvinylpyrrolidone, can also be used. Polyethylene glycols, hydrophilic polymers, ethylcellulose, and waxes can also be used as binders.

[0636] Lubricants can be included to facilitate tablet manufacture. Suitable lubricants include, but are not limited to, magnesium stearate, calcium stearate, stearic acid, glyceryl behenate, polyethylene glycol, talc, and mineral oil. Lubricants can be included in tablet formulations to prevent the tablet and punch from sticking in the die. Lubricants can be selected from smooth solids (such as talc, magnesium stearate, and calcium stearate), stearic acid, and hydrogenated vegetable oils.

[0637] Disintegrants can be used to facilitate disintegration or "breakup" of the dosage form after administration and generally include, but are not limited to, starches, sodium starch glycolate, sodium carboxymethyl starch, sodium carboxymethylcellulose, hydroxypropylcellulose, pregelatinized starch, clays, celluloses, alginine, gums, or crosslinked polymers such as crosslinked PVP (XL from GAF Chemical Corp). XL

[0638] Stabilizers can be used to inhibit or slow down drug decomposition reactions, which include, for example, oxidation reactions. Suitable stabilizers include, but are not limited to, antioxidants, butylated hydroxytoluene (BHT); ascorbic acid, its salts and esters; vitamin E, tocopherols, and their salts; sulfites such as sodium metabisulfite; cysteine and its derivatives; citric acid; propyl gallate, and butylated hydroxyanisole (BHA).

[0639] In some aspects, the amount of one or more additional active agents is included in a pharmaceutical formulation containing an RNA complex or nanostructure. Suitable additional active agents include, but are not limited to, DNA, RNA, modified ribonucleotides, amino acids, peptides, polypeptides, antibodies, aptamers, ribozymes, guide sequences of ribozymes that inhibit translation or transcription of essential tumor proteins and genes, hormones, immunomodulators, antipyretics, sedatives, antipsychotics, analgesics, antispasmodics, anti-inflammatory agents, antihistamines, anti-infective agents, and chemotherapeutic agents (anticancer drugs). Other suitable additional active agents include sensitizers (such as radiosensitizers). The RNA nanostructure can be used as a monotherapy or in combination with other active agents for the treatment or prevention of diseases or disorders.

[0640] Suitable hormones include, but are not limited to, amino acid-derived hormones (such as melatonin and thyroxine), small peptide hormones, and protein hormones (such as thyrotropin-releasing hormone, vasopressin, insulin, growth hormone, luteinizing hormone, follicle-stimulating hormone, and thyroid-stimulating hormone), eicosanoids (such as arachidonic acid, lipoxins, and prostaglandins), and steroid hormones (such as estradiol, testosterone, tetrahydrotestosterone, and cortisol).

[0641] Suitable immunomodulators include, but are not limited to, prednisone, azathioprine, 6-MP, cyclosporine, tacrolimus, methotrexate, interleukins (such as IL-2, IL-7, and IL-12), cytokines (such as interferons (such as IFN-α, IFN-β, IFN-ε, IFN-κ, IFN-ω, and IFN-γ), granulocyte colony-stimulating factor, and imiquimod), chemokines (such as CCL3, CCL26, and CXCL7), cytosine phosphate guanosine, oligodeoxynucleotides, dextran, antibodies, and aptamers).

[0642] Suitable analgesics include, but are not limited to, paracetamol / acetaminophen, non-steroidal anti-inflammatory agents (such as ibuprofen, naproxen, ketoprofen, and nimesulide), COX-2 inhibitors (such as rofecoxib, celecoxib, and etoricoxib), opioids (such as morphine, codeine, oxycodone, hydrocodone, dihydromorphine, pethidine, buprenorphine), tramadol, norepinephrine, flupiretine, nefopam, orphenadrine, pregabalin, gabapentin, cyclobenzaprine, scopolamine, methadone, ketobemidone, pipradol, and aspirin and related salicylates (such as choline salicylate, magnesium salicylate, and sodium salicylate).

[0643] Suitable antispasmodics include, but are not limited to, mebeverine, papaverine, cyclobenzaprine, carisoprodol, orphenadrine, tizanidine, metaxalone, methocarbamol, chlorzoxazone, baclofen, dantrolene, baclofen, tizanidine, and dantrolene.

[0644] Suitable anti-inflammatory agents include, but are not limited to, prednisone, non-steroidal anti-inflammatory agents (such as ibuprofen, naproxen, ketoprofen and nimesulide), COX-2 inhibitors (such as rofecoxib, celecoxib and etoricoxib), and immunoselective anti-inflammatory derivative agents (such as submandibular gland peptide-T and its derivatives).

[0645] Suitable antihistamines include, but are not limited to, H1-receptor antagonists (such as acrivastine, azelastine, bilastine, brompheniramine, buclizine, dimenhydrinate, carbinoxamine, cetirizine, chlorpromazine, cyclizine, chlorpheniramine, clemastine, cyproheptadine, desloratadine, dexbrompheniramine, dechlorpheniramine, dimenhydrinate, diminden, diphenhydramine, doxylamine, ebastine, enbucrilate, fexofenadine, hydroxyzine, levocetirizine, loratadine, meclizine, mirtazapine, olopatadine, olotaradine, orphenadrine, phenindamine, pheniramine, phenyltoloxamine, promethazine, pyrilamine, quetiapine, rupatadine, tripelennamine and triprolidine), H2-receptor antagonists (such as cimetidine, famotidine, lafutidine, nizatidine, ranitidine and roxatidine), tritoqualine, catechins, cromoglycates, nedocromil and β2-adrenergic agonists.

[0646] Suitable anti-infective agents include, but are not limited to, antiamebic drugs (such as nitazoxanide, paromomycin, metronidazole, tinidazole, chloroquine, and diiodohydroxyquinoline), aminoglycoside antibiotics (such as paromomycin, tobramycin, gentamicin, amikacin, kanamycin, and neomycin), antihelminthics (such as pyrantel, mebendazole, ivermectin, praziquantel, albendazole, miltefosine, thiabendazole, oxamniquine), antifungal agents (such as azole antifungal agents (such as itraconazole, fluconazole, posaconazole, ketoconazole, clotrimazole, miconazole, and voriconazole), echinocandins (such as caspofungin, anidulafungin, and micafungin), griseofulvin, terbinafine, flucytosine, and polyenes (such as nystatin and amphotericin B), antimalarial agents (such as pyrimethamine / sulfadoxine, artemether / lumefantrine, atovaquone / proguanil, quinine, hydroxychloroquine, mefloquine, chloroquine, doxycycline, pyrimethamine, and clofazimine), antituberculosis agents (such as aminosalicylates (such as aminosalicylic acid), isoniazid / rifampicin, isoniazid / pyrazinamide / rifampicin, bedaquiline, isoniazid, ethambutol, rifampicin, rifabutin, rifapentine, capreomycin, and cycloserine), antiviral agents (such as amantadine, rimantadine, abacavir / lamivudine, emtricitabine / tenofovir, cobicistat / elvitegravir / emtricitabine / tenofovir, efavirenz / emtricitabine / tenofovir, abacavir / lamivudine / zidovudine, lamivudine / zidovudine, emtricitabine / tenofovir, emtricitabine / lopinavir / ritonavir / tenofovir, interferon α-2v / ribavirin, peginterferon α-2b, maraviroc, raltegravir, dolutegravir, enfuvirtide, foscarnet, fomivirsen, oseltamivir, zanamivir, nevirapine, efavirenz, etravirine, rilpivirine, delavirdine, nevirapine, entecavir, lamivudine, adefovir, sofosbuvir, didanosine, tenofovir, avacavir, zidovudine, stavudine, emtricitabine, zalcitabine, telbivudine, simeprevir, boceprevir, telaprevir, lopinavir / ritonavir, fosamprenavir, darunavir, ritonavir, tipranavir, atazanavir, nelfinavir, amprenavir, indinavir, saquinavir, ribavirin, valacyclovir, acyclovir, famciclovir,Ganciclovir and valganciclovir), carbapenem antibiotics (e.g., doripenem, meropenem, ertapenem, and cilastatin / imipenem), cephalosporins (e.g., cephalexin, cefradine, cefazolin, cefalexin, cefepime, ceflaroline, loracarbef, cefotetan, cefuroxime, cefprozil, loracarbef, cefoxitin, cefaclor, cefibuten, ceftriaxone, cefotaxime, cefpodoxime, cefdinir, cefixime, cefditoren, ceftizoxime, and ceftazidime), glycopeptide antibiotics (e.g., vancomycin, dalbavancin, oritavancin, and telvancin), glycylcyclines (e.g., tigecycline), antileprosy drugs (e.g., clofazimine and thalidomide), lincomycin and its derivatives (e.g., clindamycin and lincomycin), macrolides and their derivatives (e.g., telithromycin, fidaxomicin, erythromycin, azithromycin, clarithromycin, dirithromycin, and oleandomycin), linezolid, sulfamethoxazole / trimethoprim, rifaximin, chloramphenicol, fosfomycin, metronidazole, aztreonam, bacitracin, β-lactam antibiotics (benzathine penicillin G (benzathine penicillin and penicillin G), phenoxymethylpenicillin, cloxacillin, flucloxacillin, methicillin, temocillin, mecillinam, azlocillin, mezlocillin, piperacillin, amoxicillin, ampicillin, bacampicillin, carbenicillin, piperacillin, ticarcillin, amoxicillin / clavulanic acid, ampicillin / sulbactam, piperacillin / tazobactam, clavulanic acid / ticarcillin, penicillin G, procaine penicillin, oxacillin, dicloxacillin, nafcillin, cefazolin, cefalexin, cephalosporin C, cephalothin, cefaclor, cefamandole, cefuroxime, cefotetan, cefoxitin, cefixime, cefotaxime, cefpodoxime, ceftazidime, ceftriaxone, cefepime, cefpirome, ceftobiprole, biapenem, doripenem, ertapenem, faropenem, imipenem, meropenem, panipenem, asukamycin, tebipenem, thienamycin, aztreonam, tigemonam, nocardicin A, taboxinine, and β-lactam), quinolones (e.g., lomefloxacin, norfloxacin, ofloxacin, qatifloxacin, moxifloxacin, ciprofloxacin, levofloxacin, gemifloxacin, moxifloxacin, cinoxacin, nalidixic acid, enoxacin, grepafloxacin, gatifloxacin, trovafloxacin, and sparfloxacin), sulfonamides (e.g., sulfamethoxazole / trimethoprim, sulfasalazine, and sulfisoxazole), tetracyclines (e.g., doxycycline, demeclocycline, minocycline, doxycycline / salicylic acid, doxycycline / ω-3 polyunsaturated fatty acids, and tetracycline), and urinary anti-infectives (e.g., nitrofurantoin, methenamine, fosfomycin, cinoxacin, nalidixic acid, trimethoprim, and methylene blue).

[0647] Suitable chemotherapeutic agents include, but are not limited to, paclitaxel, brentuximab vedotin, doxorubicin, 5-FU (fluorouracil), everolimus, pemetrexed, melphalan, pamidronate, anastrozole, exemestane, nelarabine, ofatumumab, bevacizumab, belinostat, tositumomab, carmustine, bleomycin, bosutinib, busulfan, alemtuzumab, irinotecan, vandetanib, bicalutamide, lomustine, daunorubicin, clofarabine, cabozantinib, dactinomycin, ramucirumab, cytarabine, cyclophosphamide, dacarbazine, cyclophosphamide, decitabine, dexamethasone, docetaxel, hydroxyurea, dacarbazine, leuprolide, epirubicin, oxaliplatin, asparaginase, estramustine, cetuximab, vismodegib, asparaginase, amifostine, etoposide, flutamide, toremifene, fulvestrant, letrozole, degarelix, pralatrexate, methotrexate, floxuridine, atezolizumab, gemcitabine, afatinib, imatinib mesylate, carmustine, eribulin, trastuzumab, altretamine, topotecan, ponatinib, idarubicin, ifosfamide, ibrutinib, axitinib, interferon α-2a, gefitinib, romidepsin, ixabepilone, ruxolitinib, cabazitaxel, trastuzumab antibody-drug conjugate, carfilzomib, chlorambucil, sargramostim, cladribine, mitotane, vincristine, procarbazine, megestrol acetate, trametinib, mesna, strontium chloride-89, mechlorethamine, mitomycin, busulfan, gemtuzumab ozogamicin, vinorelbine, filgrastine, pegfilgrastine, sorafenib, nilutamide, pentostatin, tamoxifen, mitoxantrone, pegaspargase, denileukin diftitox, alitretinoin, carboplatin, pertuzumab, cisplatin, pomalidomide, prednisone, aldesleukin, mercaptopuridine, zoledronic acid, lenalidomide, rituximab, octreotide, dasatinib, regorafenib, histrelin, sunitinib, siltuximab, omacetaxine, thioguanine (thioguanine) (tioguanine), dabrafenib, erlotinib, bexarotene, temozolomide, thiotepa, thalidomide, BCG, temsirolimus, bendamustine hydrochloride, triptorelin, arsenic trioxide, lapatinib, valrubicin, panitumumab, vinblastine, bortezomide, tretinoin, azacitidine, pazopanib, teniposide, leucovorin, crizotinib, capecitabine, enzalutamide, ipilimumab, goserelin, vorinostat, idelalisib, ceritinib, abiraterone, epothilone, talampicillin, azathioprine, doxifluridine, vindesine, all-trans retinoic acid, and other anti-cancer agents listed elsewhere in this document.

[0648] Methods of using RNA complexes and nanostructures and their formulations

[0649] An RNA complex or nanostructure as provided herein can be administered to a subject, cell, or population thereof in need thereof. The subject in need thereof may have cancer or any other disease or disorder that would benefit from a nucleoside analogue. The amount delivered can be an effective amount of the RNA complex or nanostructure provided herein. The subject in need thereof may be symptomatic or asymptomatic. In some aspects, the RNA complex or nanostructure provided herein can be co-administered with another active agent. It will be understood that co-administration can refer to an additional compound included in the formulation or provided in a dosage form separate from the RNA complex or nanostructure or its formulation. An effective amount of the RNA complex or nanostructure or its formulation (such as those described herein) can be in the range of about 0.1 mg / kg to about 500 mg / kg. In some aspects, the effective amount is in the range of about 0.1 mg / kg to 10 mg / kg. In additional aspects, the effective amount is in the range of about 0.1 mg / kg to 100 mg / kg. In further aspects, the effective amount is in the range of about 0.1 mg to about 1000 mg. In some aspects, the effective amount can be about 500 mg to about 1000 mg.

[0650] Administration of the RNA complex or nanostructure and its formulation can be systemic or local. The compounds and formulations described herein can be administered to a subject in need thereof once or more times per day. In one aspect, the compound and / or its formulation can be administered once per day. In some aspects, the compound and / or its formulation can be administered once per day. In another aspect, the compound and / or its formulation can be administered twice per day. In some aspects, when administered, an effective amount of the compound and / or formulation is administered to a subject in need thereof. The compound and / or its formulation can be administered once or more times per week. In some aspects, the compound and / or its formulation can be administered 1 day per week. In other aspects, the compound and / or its formulation can be administered 2 to 7 days per week.

[0651] In some aspects, the RNA complex or nanostructure and / or its formulation can be administered in dosage form. The amount or effective amount of the compound and / or its formulation can be divided into two dosage forms. For example, the effective amount can be divided into two dosage forms, and for example, the first dosage form can be administered in the morning and the second dosage form can be administered in the evening. Although the effective amount is given in two doses, the subject receives the effective amount within a day. In some aspects, the effective amount is about 0.1 to about 1000 mg per day. The effective amount in the dosage form can be in the range of about 0.1 mg / kg to about 1000 mg / kg. The dosage form can be formulated for oral, vaginal, intravenous, transdermal, subcutaneous, intraperitoneal, or intramuscular administration. Preparation of dosage forms for various routes of administration is described elsewhere herein.

[0652] The modular RNA patterns described herein and the RNA complexes or nanostructures described herein can be used to prepare drugs for treating diseases or cancers.

[0653] Multiple embodiments of the present invention have been described. However, it should be understood that various modifications can be made without departing from the spirit and scope of the present invention. Therefore, other embodiments are within the scope of the following claims.

[0654] Examples

[0655] Example 1:

[0656] Figure 2 Shows the results of a cytotoxicity study of RNA-UB5F nanoparticles in a breast cancer cell line.

[0657] Figure 3 Shows the results of a cytotoxicity study of RNA-CR2FF nanoparticles in a breast cancer cell line.

[0658] Figure 4 Shows the results of a cytotoxicity study of RNA-CR2FF-UB5F nanoparticles in a breast cancer cell line

[0659] Figure 5 Shows the survivin duplex structure: sense strand with 3'-cholesterol and gemcitabine (represented by Y)

[0660] Figure 6 Shows the survivin duplex structure: sense strand with 3'-cholesterol and gemcitabine (represented by Y) and an extended antisense strand linked thereto

[0661] Figure 7 Shows the survivin duplex structure: sense strand with 3'-cholesterol and gemcitabine (represented by Y), and the antisense strand has an adjacent extended RNA structure

[0662] Figure 8 Shows the RRM2 duplex structure: sense strand with 3'-cholesterol and gemcitabine (represented by Y)

[0663] Figure 9 Shows the RRM2 duplex structure: sense strand with 3'-cholesterol and gemcitabine (represented by Y) and an extended antisense strand linked thereto

[0664] Figure 10 Shows the RRM2 duplex structure: sense strand with 3'-cholesterol and gemcitabine (represented by Y), and the antisense strand has an adjacent extended RNA structure

[0665] Figure 11A curve showing the results of a study on the weight change of RNA-CR2FF-cholesterol nanoparticles in an animal model of lung metastasis of human colorectal adenocarcinoma cells.

[0666] Figure 12 A histogram showing the results of a study on the weight change of RNA-CR2FF-cholesterol nanoparticles in an animal model of lung metastasis of human colorectal adenocarcinoma cells.

[0667] Figure 13 The results of the in vivo metastasis inhibition study of RNA-CR2FF-cholesterol nanoparticles in an animal model of lung metastasis of human colorectal adenocarcinoma cells are shown.

[0668] Figure 14 The results of the in vitro metastasis inhibition study of RNA-CR2FF-cholesterol nanoparticles in an animal model of lung metastasis of human colorectal adenocarcinoma cells are shown.

[0669] Example 2: Effective inhibition of lung CRC metastasis by non-toxic RNA micelles carrying both siRNA and gemcitabine

[0670] Materials and Methods

[0671] Synthesis of RNA micelles

[0672] One-pot single-step assembly was used to construct RNA micelles containing gemcitabine and survivin or RRM2 siRNA. Each micelle consists of two component strands: 1) cholesterol-gemcitabine-sense siRNA and 2) antisense siRNA. Solid-phase synthesis was used and commercially available phosphoramidites of 2'-TBDMS adenosine (n-bz)CED, 2'-TBDMS Guanosine (n-ibu)CED, N4-benzoyl-2'-deoxy-5'-O-DMT-2',2'-difluorocytidine, 3'-CE phosphoramidite (gemcitabine amidite) and 2'-fluoro Uridine CED phosphoramidites Monomerto synthesize the RNA strand, followed by deprotection according to the protocol provided by the manufacturer (Azco Biotech). According to the manufacturer's instructions, cholesterol was attached to the 3'-end of the sense siRNA strand by using 3'-cholesteryl-Teg CPG support (Glen Research Corp.). The Alexa-Fluor 647 label was incorporated into the micelles on the cholesterol-gemcitabine-sense siRNA strand. The conjugation reaction was carried out by mixing a 1:10 molar ratio of primary amine-labeled RNA:NHS ester fluorophore in 0.1 M sodium bicarbonate buffer at pH = 8.5. As previously described, the conjugation reaction was incubated at room temperature for 16 h while protecting from light (Ghimire, C. et al. ACS Nano 2020, 14:13180-13191). The synthesized RNA was purified from the terminated strand using an ion-pair reverse-phase column that was typically fully labeled with cholesterol during solid-phase synthesis.

[0673] Sequence:

[0674] Cholesterol - gemcitabine - survivin sense strand

[0675] 5′-XXGYAGGXXYYXXAXYXGXYAXXAYAXAYAYYYX-3′-cholesterol (SEQ ID NO:274), where Y is gemcitabine and X is 2′-F uridine (fluorouridine).

[0676] Survivin antisense strand

[0677] 5′-UGACAGAUAAGGAACCUGC-3′ (SEQ ID NO:1)

[0678] Survivin antisense strand extension

[0679] 5′-GGGXGXAXGXAAUGACAGAUAAGGAACCUGC-3′ (SEQ ID NO:275), where X is 2′-F uridine (fluorouridine).

[0680] Cholesterol - gemcitabine - RRM2 sense strand

[0681] 5′-XXG C GAXXXAG CC AAGAAGXX C AXXA C AXA CACCC X-3′ (SEQ ID NO:276), where Y is gemcitabine and X is 2′-F uridine (fluorouridine).

[0682] RRM2 antisense strand

[0683] 5′-UGAACUUCUUGGCUAAAUCGC-3′(SEQ ID NO:2)

[0684] Cholesterol - gemcitabine - survivin sense strand - Alexa647

[0685] 5′Alexa647-XXGYAGGXXYYXXAXYXGXYAXXAYAXAYAYYYX-3′ cholesterol (SEQ ID NO:277), where Y is gemcitabine and X is 2′-F uridine (fluorouridine).

[0686] Gemcitabine - survivin sense strand

[0687] 5′-XXGYAGGXXYYXXAXYXGXYAXXACAXAYAYYYX-3′(SEQ ID NO:278), where Y is gemcitabine and X is 2′-F uridine (fluorouridine).

[0688] Survivin sense strand

[0689] 5′-GCAGGXXCCXXAXCXGXCAXX-3′(SEQ ID NO:279), where Y is gemcitabine and X is 2′-F uridine (fluorouridine).

[0690] As previously described, the two-component micelle chains are assembled into micelles by mixing the two-component micelle chains at equal molar concentrations in TMS buffer (50 mM Tris pH = 8.0, 100 mM NaCl, 10 mM MgCl2) or PBS buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 2 mM KH2PO4, pH 7.4), followed by heating to 95 °C for 5 minutes and slowly cooling to 4 °C over a period of 45 minutes (Shu, Y. et al. J. Control. Release 2018, 276:17-29; Yin, H. et al. ACS Nano 2019, 13:706-717; Guo, S. et al. Nat. Commun. 2020, 11:972-982; Li, H. et al. Adv. Mater. 2016, 28:7501-7507; Khisamutdinov, E.F. et al. Nucleic Acids Res. 2014, 42:9996-10004).

[0691] Characterization of RNA micelles

[0692] On a TAE running buffer, RNA micelle formation was determined by agarose gel electrophoresis using a 1% agarose gel run at 4 °C and 100 V for 30 minutes.

[0693] The apparent hydrodynamic size and zeta potential of the pre-assembled RNA micelles were measured. All RNA samples were measured in diethyl pyrocarbonate H2O and PBS buffer (137 mmol / l NaCl, 2.7 mmol / l KCl, 100 mmol / l Na2HPO4, 2 mmol / l KH2PO4, pH 7.4) at 25 °C.

[0694] Cell culture

[0695] Human CRC cell lines HT29, HT29 G-L lung M3 were grown and cultured in a medium containing 10% fetal bovine serum and penicillin / streptomycin in an incubator at 37 °C under 5% CO2 and a humidified atmosphere.

[0696] In vitro proliferation assay of NRA micelles

[0697] According to the manufacturer's instructions, the CellTiter 96 Non-Radioactive Cell Proliferation Assay (Promega) was used to study cytotoxicity. Briefly, 5×10 3 HT29 cells were seeded in 96-well plates overnight. RNA micelles, free gemcitabine, and siRNA were added to each well in triplicate at gemcitabine concentrations of 5, 25, 100, and 250 nM. After incubation at 37 °C in a humidified 5% CO2 environment for 48 hours, 15 μL of MTT dye solution was added to each well, and the plate was incubated at 37 °C in the dark for 4 hours. Next, 50 μL of solubilization solution / stop mixture was added to each well to dissolve the crystals in the dark. The plate was incubated at room temperature for 2 hours. Finally, the crystals in each well were completely dissolved into a uniformly colored solution, and its absorbance at 570 nm was measured using a Synergy 4 microplate reader (Bio-Tek). Data were collected by Gen5 and normalized data were plotted using Origin.

[0698] In vivo tumor development

[0699] Female and male NOD.Cg-Prkdcscid Il2rgtm1Wjl / SzJNCr nude (8-week-old) mice were obtained from The Jackson Laboratory and placed in a clean, pathogen-free room in an environment with controlled temperature (27 °C), humidity, and a 12-hour light / dark cycle. Mice were fed standard chow and tap water ad libitum and allowed to acclimate to the new environment for 1 week. All animal experiments were approved by the Institutional Animal Care and Use Committee at the University of Kentucky and were conducted in accordance with guidelines promulgated by the National Institutes of Health for the care of laboratory animals. HT29 cells were conditioned to be lung-tropic by initial intravenous injection. Lung metastases were harvested and reinjected into mice; the in vivo selection process was repeated three times to develop the HT29 G-L lung M3 cell line. HT29 G-L lung M3 tumor cells were injected intravenously into mice for lung metastasis development. Isoflurane (2% in oxygen, flow rate 0.6 L / minute) was used to anesthetize the mice, and 100 μl of PBS containing 1 × 10 6 cells was injected.

[0700] In Vivo Tumor Regression of CRC Metastatic Tumors

[0701] NOD.Cg-Prkdcscid Il2rgtm1Wjl / SzJNCr nude mice diagnosed with HT29 G-L lung M3 tumors were treated with samples (including PBS, micelle extended / siSurv, micelle / siSurv, and micelle / siRRM2, twice a week, dose 1 mg / kg, 300 μL tail vein injection). Mice were treated a total of 6 times. On day 26, the mice were euthanized and imaged for bioluminescence and GFP signals using LagoSII (Spectral Instruments Imaging, Tucson, AZ). Tumors from the mice were collected and fixed in 10% formaldehyde and embedded in paraffin blocks. Tumor sections were stained with primary antibodies to KI-67 (Cell Signaling #9027) or IHC cleaved caspase 3 (Cell Signaling #9579) followed by fluorescent dye-conjugated secondary antibodies. The tumor sections were then imaged microscopically.

[0702] Chemokine Induction by RNA Micelles in ELISA

[0703] RAW 264.7 cells were seeded at 2.5 × 10 5Cells were plated at a density of [number of cells] in 24-well plates and cultured overnight. Then, the RNA micelles were diluted in Opti-Mem medium (Life Technologies Corporation, Carlsbad, CA, USA) and added to the cells. The cells were continuously cultured at 37 °C in humidified air containing 5% CO2 for 8 hours, and the cell culture supernatant was collected and stored at -80 °C until use. According to the protocol provided by the manufacturer, Mouse ELISA MAX TM Deluxe sets (BioLegend, Inc., San Diego, CA) were used to determine the concentrations of TNF-α and IL-6 in the supernatant by enzyme-linked immunosorbent assay.

[0704] Results

[0705] RNA micelles contain a large number of copies of a chemical drug and siRNA by forming a homogeneous micelle structure.

[0706] Previously, RNA micelles were developed using a three-way junction of pRNA (pRNA-3WJ) from the Phi29 DNA packaging motor by including a cholesterol tag on the 3'-end of one of the component strands (Shu, Y. et al. J. Control. Release 2018, 276: 17 - 29; Yin, H. et al. ACS Nano 2019, 13: 706 - 717). These micelles were conjugated with paclitaxel or anti-miRNA sequences for delivery to in vivo tumor models in mice. Here, the RNA micelles were redesigned into a simpler structure that self-assembled from cholesterol-siRNA chimeras, as Figure 15 shown. Additionally, gemcitabine was included in the micelle design by substituting cytosine ribonucleotide with a nucleotide. Each RNA chimera was designed to include twelve copies of gemcitabine on the sense strand of survivin and RRM2 siRNA. Thus, during gemcitabine release, the antisense siRNA was also released into RISC without Dicer processing. The RNA micelle components were synthesized via solid-phase synthesis using phosphoramidite technology; cholesterol was placed on the sense strand of siRNA via 3'-cholesteryl-Teg CpG and gemcitabine via gemcitabine imide. When the two RNA strands were purified, they folded through an annealing step, where the siRNA would fold and the cholesterol tags would self-assemble into a hydrophobic core to form micelles.

[0707] Then, the formation and physical characteristics of the RNA micelles were characterized. Compared with the single-stranded components, the formation of the first micelles was confirmed by 1% agarose gel. From the assembled gel, the cholesterol sense strand self-assembled into a micelle structure as indicated by the relatively slow migration rate, and this micelle structure was maintained when annealing the antisense siRNA strand with the sense strand micelles. As shown in the agarose gel, the RNA micelles formed as a single band indicating the formation of a homogeneous product. In addition, dynamic light scattering (DLS) was performed on the obtained RNA micelles. Although these RNA micelles were larger than most of the produced RNA nanoparticles (Ghimire, C. et al. ACS Nano 2020, 14:13180-13191; Guo, S. et al. Nat. Commun. 2020, 11:972-982; Li, H. et al. Adv. Mater. 2016, 28:7501-7507; Khisamutdinov, E.F. et al. Nucleic Acids Res. 2014, 42:9996-10004), they still fell within the nanometer range and retained the inherent properties of their RNA nanoparticles.

[0708] The RNA micelles were treated with DNase II to specifically release gemcitabine and, in turn, release the siRNA antisense strand.

[0709] Gemcitabine has previously been incorporated into nucleic acid sequences for improved therapeutic delivery to tumor cells (Zhu, L. et al. J Am Chem Soc 2022, 144:1493-1497; Ma, Y. et al. Chem Commun (Camb) 2019, 55:6603-6606; Pan, G. et al. ACS Appl Mater Interfaces 2019, 11:41082-41090). These nucleic acid constructs, including drug aptamers and nanogels, have demonstrated the ability to cleave gemcitabine upon incubation with DNAzymes. Specifically, DNAzyme II is able to release gemcitabine and is present at high concentrations in lysosomes (Zhu, L. et al. J Am Chem Soc 2022, 144:1493-1497). To demonstrate the stability and controlled release of gemcitabine and survivin or RRM2 siRNA from RNA micelles, the nanoparticles were incubated with fetal bovine serum (FBS) containing a series of nucleases or DNAzyme II. After time-course incubation, the RNA micelle structure was determined by native PAGE. Interestingly, the RNA micelles showed stability against FBS degradation while showing degradation and thus release of gemcitabine and the antisense siRNA strand. As shown in the gel, the RNA micelles were degraded by DNAzyme II, resulting in short RNA fragments at the bottom of the gel and a single band at approximately 20 nt, indicating release of the antisense survivin and RRM2 strands while remaining stable. The results indicate that RNA micelles are able to remain stable during in vivo circulation, without premature release of gemcitabine or siRNA, but are processed intracellularly to control the release of therapeutic agents within the cell.

[0710] RNA micelles spontaneously target CRC cells and internalize into CRC cells.

[0711] Although gemcitabine effectively penetrates cell membranes using nucleoside transporters, tumor cells rapidly develop resistance by downregulating such nucleoside transporters (such as SLC29A1, SLC28A1, and SLC28A3). Cells lacking nucleoside transporters do not allow gemcitabine influx and are also not vulnerable to the cytotoxicity of gemcitabine. Additionally, nanoparticles rely on endocytosis as an internalization mechanism, which typically results in endosomal entrapment, thus limiting therapeutic efficacy. To test the internalization of RNA micelles for intracellular delivery of gemcitabine and siRNA, an Alexa-Fluor 647 fluorescent tag was included in the RNA micelle design. The RNA micelle / Alexa647 was then incubated with HT29 and HCT116 CRC cell lines and imaged by live-cell confocal microscopy. During time-course imaging, confocal microscopy showed an increase in fluorescent signal transduction within CRC cells, indicating that the RNA micelles were able to bind to and internalize into the cells. Since the RNA micelles do not contain CRC-targeting ligands, this binding is spontaneous and does not rely on receptor-mediated endocytosis. The present inventors hypothesized that the high cholesterol content of the RNA micelles allows interaction with cholesterol-rich lipid rafts on the cell membrane, leading to raft-dependent endocytosis (El-Sayed, A. et al. Mol Ther 2013, 21:1118-1130). This endocytic pathway is cholesterol-dependent and may or may not involve caveolae (Lajoie, P. et al. Int Rev Cell Mol Biol 2010, 282:135-163; Lajoie, P. et al. J Cell Mol Med 2007, 11:644-653). To test whether the RNA micelles were endocytosed, confocal microscopy studies were repeated while staining the cells (Zheng, Z. et al. J.Control.Release 2019, 311-312:43-49). The results are shown below. Although endosomal entrapment can inhibit drug delivery, high levels of DNase II were found in lysosomes, so the release of gemcitabine and siRNA without Dicer treatment allows the therapeutic agents to remain effective (see below) (Zhu, L. et al. J Am Chem Soc 2022, 144:1493-1497).

[0712] RNA micelles do not result in an immune response.

[0713] Cancer therapeutics, including chemotherapy and nanoparticle platforms, often show toxicity not only through interactions with healthy tissues but are also known to trigger immune responses through cytokine induction (Lee, C. S. et al. World J Gastroenterol 2014, 20:3751 - 3761; Driscoll, J. et al. Curr Protoc 2021, 1:e249; Hong, E. et al. Nano Lett. 2018, 18:4309 - 4321). It has been previously shown that RNA nanoparticles can control immune responses through the size, shape, and sequence of the nanoparticles (Khisamutdinov, E. F. et al. Nucleic Acids Res. 2014, 42:9996 - 10004; Guo, S. et al. Mol. Ther. Nucleic Acids 2017, 9:399 - 408). Thus, RNA nanoparticles can be designed to induce or avoid immune responses. Additionally, the conjugation of paclitaxel with RNA nanoparticles results in a significant reduction in cytokine induction (Guo, S. et al. Nat. Commun. 2020, 11:972 - 982). RNA micelles were incubated with RAW 264.7 macrophages, and cytokine responses were measured by ELISA. The results showed that neither control RNA micelles nor RNA micelles containing gemcitabine and survivin or RRM2 siRNA led to a significant increase in cytokine induction compared to cell samples alone. These results show that RNA micelles are safe for activating large immune responses and allow for in vivo compatibility.

[0714] RNA micelles specifically inhibit CRC lung metastasis without negative effects on the body

[0715] RNA micelles demonstrated effective CRC inhibition and the ability to deliver high levels of gemcitabine and survivin or RRM2 siRNA. The ability of the developed RNA micelles to inhibit the growth of CRC lung metastases was tested in a mouse model. HT29G-L lung M3 cells (a derivative of HT29 CRC cells that have been "trained" to be lung tropic (Reichel, D. et al. Pharm Res 2017, 34:2385 - 2402; Rychahou, P. et al. J Control Release 2018, 275:85 - 91)) were intravenously injected into nude mice to generate tumors on the lungs of the mice. HT29 G-L lung M3 cells express GFP to allow monitoring of tumor growth and regression ( Figure 16A and Figure 16B)。Once a tumor has developed, the RNA micelles are delivered to the mice twice a week for 6 treatments. At the end of the nanoparticle course, the mice are imaged by IVIS, and the lungs are excised and imaged. The results show that GFP signaling is significantly reduced in both image sets, demonstrating the regression of lung tumors ( Figure 17A and 17B ). Interestingly, the RNA micelles containing gemcitabine and survivin siRNA particles almost led to the complete elimination of GFP signaling, suggesting complete treatment of the tumor. To further examine the treatment of the mice, the lung cryosections are stained for Ki-67 and caspase 3 signaling ( Figure 17C and Figure 17D ). The KI-67 signaling in the treatment group shows some signaling throughout the lung, indicating that microtumors still remain. In addition, the lungs show low levels of caspase signaling, indicating that tumor death is not the result of the caspase pathway. Overall, the dose of the RNA micelles can be further optimized, or the tumors can be treated with a longer course to result in complete tumor regression. However, the data presented indicate that RNA micelles are very effective in treating CRC lung metastases. During the in vivo experiments, the weights of the mice are monitored. The results indicate that no significant weight loss is seen in the RNA micelle samples carrying survivin or RRM2 siRNA compared to the PBS group, indicating no obvious signs of toxicity to the mice. These data combined with the lack of cytokine induction indicate that RNA micelles are generally safe and compatible for in vivo studies. However, further safety studies on RNA micelles are needed before moving to the clinic.

[0716] Discussion

[0717] Nanoparticles are generally complex structures that require several synthetic or chemical steps to form complete particles with conjugated drugs. As a result, the product yield decreases, the cost of production and labor increases, and the nanoparticle quality may lack homogeneity. The developed RNA micelles presented here use a one-step one-pot production method to overcome these problems, resulting in the production of homogeneous and stable micelles. During the solid-phase synthesis of the component RNA, gemcitabine is directly incorporated by using phosphoramidite with an incorporation rate of 98.5%; thus further chemical conjugation steps are blocked. In addition, RRM2 and survivin siRNA are simply incorporated by sequence extension from the RNA micelles and simple hybridization with the antisense strand. Therefore, the presented RNA micelles are very simple in design and can be easily synthesized and self-assembled through nucleic acid folding and cholesterol interaction. The results demonstrate that the RNA micelles are stable against nucleases and form a homogeneous product with a small size distribution.

[0718] As previously shown, RNA is a known elastomer that can change size and shape under external forces (Bao, L. et al. Biophys. J. 2017, 112: 1094 - 1104; Kriegel, F. et al. J. Struct. Biol. 2017, 197: 26 - 36; Lipfert, J. et al. Proc. Natl. Acad. Sci. U.S.A. 2014, 111: 15408 - 15413; Chou, F.C. et al. PLoS Comput. Biol. 2014, 10: e1003756). Additionally, the present inventors have shown that the inventors' 10 nm RNA nanoparticles can be stretched into a rectangular structure under force and return to their original shape and size upon force relaxation (Ghimire, C. et al. ACS Nano 2020, 14: 13180 - 13191). Combining these results with the fact that RNA is inherently dynamic and constantly remodelling (Binzel, D.W. et al. Chem Rev 2021, 121: 7398 - 7467; Li, X. et al. Adv Drug Deliv Rev 2022, 186: 114316; Yu, A.M. et al. Mol Cell 2021, 81: 870 - 883e810; Hurst, T. et al. RNA Biol 2021, 1 - 11; Jing, Z. et al. J. Chem. Theory Comput. 2019, 15: 6422 - 6432; Larsen, K.P. et al. Cold Spring Harb Perspect Biol 2019, 11), RNA nanoparticles are deformable and dynamic, which allows for spontaneous tumour accumulation due to penetration of leaky tumour vascular systems. The above results of the present inventors demonstrate that high levels of spontaneous therapeutic delivery to lung metastatic tumours can be achieved without tumour targeting ligands. It is believed that RNA micelles can deform in size to penetrate leaky vascular systems under blood pressure and act like a ratchet once in the tumour microenvironment where they cannot return to the blood circulation. Thus, a very effective therapeutic delivery platform is formed. Additionally, motile and deformable RNA micelles allow non - tumour - accumulating RNA micelles to be rapidly cleared into urine by renal glomerular filtration, resulting in low accumulation in vital organs and rapid clearance from the body. The inventors' 10 - nm RNA nanoparticles have shown that they can undergo renal excretion through glomeruli with a 5.5 - nm cut - off size within 30 minutes to 1 hour after intravenous injection, and without detectable toxicity (Ghimire, C. et al. ACS Nano 2020, 14: 13180 - 13191; Guo, S. et al. Nat. Commun. 2020, 11: 972 - 982).Thus, a low-toxicity delivery platform was generated, as demonstrated by the lack of change in mouse body weight.

[0719] Once accumulated in CRC lung metastases by spontaneous targeting, the RNA micelles demonstrated the ability to internalize into CRC cells. This internalization allowed for the delivery of gemcitabine and siRNA with a high level of efficacy. Although the exact method of RNA micelle internalization has not been understood, since the micelles do not contain targeting ligands for receptor-mediated endocytosis, it is hypothesized that cholesterol, which is abundant in the lipid rafts of cells, may lead to interaction with the high level of cholesterol in the core of the RNA micelles (El-Sayed, A. et al. Mol Ther 2013, 21:1118-1130; Cho, Y.Y. et al. Molecules 2020, 25; Tian, N. et al. J Biol Chem 2012, 287:44447-44463; Nabi, I.R. et al. J Cell Biol 2003, 161:673-677). Thus, this interaction between micelle cholesterol and lipid raft cholesterol may allow for the endocytosis of RNA micelles. Once the RNA micelles or individual RNA nanoparticles of the micelles are internalized, twelve copies of gemcitabine are released by the autocatalytic processing of DNase II (Zhu, L. et al. J Am Chem Soc 2022, 144:1493-1497; Ma, Y. et al. Chem Commun (Camb) 2019, 55:6603-6606). Then, this elaborate design of the RNA micelles incorporating gemcitabine as part of the RNA sequence allows for the release of the antisense siRNA strand without Dicer processing. Gemcitabine is placed on the sense strand of the siRNA, and the sense strand is degraded by its release, resulting in the release of the antisense siRNA to be incorporated into RISC. This simple design of the micelles leads to efficient cell internalization, drug release, and high efficacy.

[0720] In combination with the presented data, RNA micelles containing multiple copies of gemcitabine and siRNA showed great promise for treating CRC metastases, as well as the ability to treat other tumor and metastasis types in turn. RNA micelles have shown no significant toxicity or immune response when circulating throughout the body. This is likely due to the rapid renal excretion of RNA micelles that do not accumulate in tumors. In addition, cellular internalization of RNA micelles leads to the automatic processing of siRNA and gemcitabine. Therefore, the mechanism of action of gemcitabine does not depend on nucleoside transporters, which can be used to generate chemical resistance as commonly seen when delivering gemcitabine. Additionally, the combination of survivin or RRM2 siRNA with gemcitabine delivery not only creates a potent combination therapy but also further diversifies the therapy to prevent the development of chemical resistance. RNA micelles have shown their unique ability in treating CRC lung metastases, a disease that currently poses challenges clinically. Based on this, future research needs to continue to advance these RNA-based nanoparticles into the clinic through in-depth preclinical studies.

[0721] Conclusion

[0722] Since its inception, RNA nanotechnology has evolved into a versatile field that continuously demonstrates its ability in delivering therapeutic agents, including siRNA, miRNA, and small molecule chemical drugs. Here, the present inventors developed novel RNA micelles by incorporating hydrophobic cholesterol onto double-stranded RNA sequences, which include multiple copies of gemcitabine and copies of survivin or RRM2 siRNA. These novel RNA micelles allow for automatic intracellular processing to release both gemcitabine and the antisense siRNA strand in a single step. Thus, when spontaneously targeting CRC lung metastases, RNA micelles are able to deliver a high payload of therapeutic agents, resulting in an almost complete regression of tumor signals. This work demonstrates a powerful therapeutic tool, despite being a simple one-step synthesis and being easy to construct and use.

[0723] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosed invention belongs. Publications cited herein and the materials to which they are cited are specifically incorporated herein by reference.

[0724] Those skilled in the art will recognize or be able to ascertain, using only routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

1. A therapeutic RNA complex comprising a plurality of synthetic double-stranded RNA oligonucleotides, each synthetic double-stranded RNA oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand has a 5' end and a 3' end with more than 25 nucleotides and a cholesterol molecule conjugated to the 3' end of the sense strand, and the 2'-position of all pyrimidines in the sense strand does not contain oxygen, wherein the antisense strand has a 5' end and a 3' end with 18 to 25 normal nucleotides, wherein the sense strand is more than 18 nucleotides, and the 2'-position of all pyrimidines in the sense strand contains two fluorines and does not contain oxygen, wherein the antisense strand comprises an siRNA sequence with unmodified nucleotides, wherein the length of the sense strand is the same as or longer than the length of the antisense strand, wherein at least 95% of the nucleotides in the antisense strand hybridize with complementary nucleotides of the sense strand, and wherein the plurality of synthetic double-stranded RNA oligonucleotides form an aggregate with a cholesterol molecule at the center.

2. The therapeutic RNA complex according to claim 1, wherein the sense strand contains 2'-difluoro-deoxypyrimidine, fluorouridine (5-fluorodeoxyuridine, UB5F) nucleotides, gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF) nucleotides or a combination thereof.

3. The therapeutic RNA complex according to claim 1 or 2, which further comprises GalNAc (N-acetylgalactosamine), UAMC-1110 (SP-13786; (S)-N-(2-(2-cyano-4,4-difluoropyrrolidin-1-yl)-2-oxoethyl)quinoline-4-carboxamide), FA (folate) or DCL (N-[N-[(S)-1,3-dicarboxypropyl]carbamoyl]-(S)-lysine) at the 5' end of the sense strand.

4. The therapeutic RNA complex according to claim 1, wherein the antisense strand is an anti-cancer siRNA that affects survival or apoptosis.

5. The therapeutic RNA complex according to claim 4, wherein the antisense strand is survivin siRNA or RRM2 siRNA.

6. The therapeutic RNA complex according to claim 5, wherein the survivin siRNA comprises the nucleic acid sequence SEQ ID NO:

1.

7. The therapeutic RNA complex according to claim 6, wherein the RRM2 siRNA comprises the nucleic acid sequence SEQ ID NO:

2.

8. A synthetic double-stranded RNA oligonucleotide comprising a sense strand having a 5' end and a 3' end, an antisense siRNA strand having a 5' end and a 3' end, wherein the sense strand comprises 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more fluorouridine (5-fluorodeoxyuridine, UB5F) nucleotides, gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF) nucleotides or a combination thereof.

9. An RNA nanoparticle comprising at least three synthetic RNA nucleotides coupled to each other, wherein the at least three synthetic RNA oligonucleotides form a central core domain and at least three double-stranded arms, the at least three double-stranded arms being arranged around the core domain and extending away from the central core domain, and wherein at least one of the synthetic RNA oligonucleotides comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1-273 or a variant thereof having at least 90% sequence identity with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1-273.

10. The RNA nanoparticle according to claim 9, wherein at least one of the synthetic RNA oligonucleotides comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 167-221 or a variant thereof having at least 90% sequence identity with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 167-221.

11. The RNA nanoparticle according to claim 9, comprising a first synthetic RNA oligonucleotide having a nucleic acid sequence of SEQ ID NO: 6-9, 61, 280-283, 112-116 or 167-171, a second synthetic RNA oligonucleotide having a nucleic acid sequence of SEQ ID NO: 10-13, 62-66, 117-121 or 172-176, and a third synthetic RNA oligonucleotide having a nucleic acid sequence of SEQ ID NO: 14-18, 67-71, 122-126 or 177-181.

12. The RNA nanoparticle according to claim 9, comprising a first synthetic RNA oligonucleotide having a nucleic acid sequence of SEQ ID NO: 21-25, 41-45, 72-76, 92-96, 127-131, 147-151, 182-186 or 202-206, a second synthetic RNA oligonucleotide having a nucleic acid sequence of SEQ ID NO: 26-30, 46-50, 77-81, 97-101, 132-136, 152-156, 187-191 or 207-211, a third synthetic RNA oligonucleotide having a nucleic acid sequence of SEQ ID NO: 31-35, 51-57, 82-86, 102-106, 137-141, 157-161, 192-196 or 212-216, and a fourth synthetic RNA oligonucleotide having a nucleic acid sequence of SEQ ID NO: 36-40, 56-60, 87-91, 107-111, 142-146, 162-166, 197-201 or 217-221.

13. A method for stabilizing siRNA for therapeutic delivery, the method comprising (a) Generate a plurality of synthetic single-stranded RNA oligonucleotides complementary to the siRNA sequence, wherein each of the RNA oligonucleotides comprises 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleoside analogs configured to prevent RNase degradation, and wherein each of the RNA oligonucleotides comprises a cholesterol moiety conjugated to its 3'-end; and (b) Contact the siRNA with the RNA oligonucleotides under conditions suitable to allow hybridization of the siRNA with the RNA oligonucleotides to produce a double-stranded RNA molecule aggregated with cholesterol molecules at the center.

14. The method according to claim 13, wherein the nucleoside analog comprises a fluorouridine (5-fluorodeoxyuridine, UB5F) nucleotide, a gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF) nucleotide, or a combination thereof.

Images