Small interfering RNA targeting C3 and application thereof

Abstract

The present disclosure relates to isolated oligonucleotides comprising duplex regions targeting human complement C3mRNA, and delivery systems, kits, and compositions comprising the same, and methods of using the same for inhibiting or down-regulating C3 gene expression.

Description

[0001] Related Applications

[0002] This application claims the benefit and priority of U.S. Provisional Application No. 63 / 416,070, filed on Oct. 14, 2022, the content of which is incorporated herein by reference in its entirety.

[0003] Incorporation by Reference of Electronic Sequence Listing

[0004] The content of the electronic sequence listing (SANB_016_001WO_SeqList_ST26.xml; size: 592,264 bytes; and creation date: Oct. 14, 2023) is incorporated herein by reference in its entirety.

[0005] Background

[0006] The complement system is part of the innate immune system and consists of more than one soluble protein present as inactive precursors in serum. When activated, these complement components form an amplifying cascade that leads to the production of bioactive effector compounds. This cascade plays a central role in maintaining cellular integrity and tissue homeostasis by removing damaged or dead cells, immune complexes, and cellular debris. It also plays a role in immune regulation, metabolism, inflammation, and host defense against pathogens. The complement system has three activation pathways, all of which converge around the proteolytic cleavage of C3, a central component that serves as the convergence point for downstream effector functions. The central role of C3 in the complement cascade makes it an ideal target for complement regulation.

[0007] Defects or loss-of-function mutations in common complement components can lead to dysregulation of normal complement system function and potentially overproduction of complement components. Excessive production and / or dysregulation are associated with an increasing number of diseases, such as but not limited to neurological, hematological, ocular, renal, and autoimmune diseases and / or disorders and infections. Accordingly, there is a need for therapies for subjects suffering from diseases, disorders, and symptoms associated with elevated levels of complement C3 expression. The present disclosure provides compositions that target C3 and methods of reducing C3 expression for treating subjects suffering from complement-related diseases, disorders, or symptoms.

[0008] Overview

[0009] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein: the sense strand comprises a nucleotide sequence substantially identical to a region of 19 - 25 nucleotides between any one of the following nucleotide positions starting from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.

[0010] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95% or at least 99% identical to a region of 19 - 25 nucleotides between any one of the following nucleotide positions starting from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625.

[0011] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region of 19 - 25 nucleotides between any one of the following nucleotide positions starting from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625.

[0012] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence substantially identical to a region between any one of the following nucleotide positions starting from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 1281 to 1301; b) 1797 to 1817; c) 2862 to 2882; d) 4402 to 4424; and e) 4520 to 4540.

[0013] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 1281 to 1301; b) 1797 to 1817; c) 2862 to 2882; d) 4402 to 4424; and e) 4520 to 4540.

[0014] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is identical to a region between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 1281 to 1301; b) 1797 to 1817; c) 2862 to 2882; d) 4402 to 4424; and e) 4520 to 4540.

[0015] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is substantially identical to a region comprising a sequence between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 772 to 801; b) 2424 to 2444; c) 3784 to 3805; d) 4123 to 4169; e) 4438 to 4509; and f) 4558 to 4621.

[0016] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising a sequence between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 772 to 801; b) 2424 to 2444; c) 3784 to 3805; d) 4123 to 4169; e) 4438 to 4509; and f) 4558 to 4621.

[0017] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is identical to a region comprising a sequence between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 772 to 801; b) 2424 to 2444; c) 3784 to 3805; d) 4123 to 4169; e) 4438 to 4509; and f) 4558 to 4621.

[0018] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence that is substantially identical to a region comprising a sequence between any one of the following nucleotide positions starting from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 588 to 608; b) 773 to 800; c) 2533 to 2585; d) 3778 to 3836; e) 4492 to 4512; and f) 4600 to 4625.

[0019] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95% or at least 99% identical to a region comprising a sequence between any one of the following nucleotide positions starting from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 588 to 608; b) 773 to 800; c) 2533 to 2585; d) 3778 to 3836; e) 4492 to 4512; and f) 4600 to 4625.

[0020] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence that is identical to a region comprising a sequence between any one of the following nucleotide positions starting from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 588 to 608; b) 773 to 800; c) 2533 to 2585; d) 3778 to 3836; e) 4492 to 4512; and f) 4600 to 4625.

[0021] In some embodiments of the isolated oligonucleotides of the present disclosure, the isolated oligonucleotide is capable of inducing the degradation of C3 mRNA.

[0022] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of the present disclosure, both the sense strand and the antisense strand are single-stranded RNA molecules.

[0023] In some embodiments of the isolated oligonucleotides of the present disclosure, the single-stranded RNA molecule of the sense strand comprises a 3' overhang. In some embodiments, in the single-stranded RNA molecule of the sense strand, the 3' overhang comprises at least one nucleotide. In some embodiments, in the single-stranded RNA molecule of the sense strand, the 3' overhang comprises two nucleotides.

[0024] In some embodiments of the isolated oligonucleotides of the present disclosure, the single-stranded RNA molecule of the antisense strand comprises a 3' overhang. In some embodiments, in the single-stranded RNA molecule of the antisense strand, the 3' overhang comprises at least one nucleotide. In some embodiments, in the single-stranded RNA molecule of the antisense strand, the 3' overhang comprises two nucleotides.

[0025] In some embodiments of the isolated oligonucleotides of the present disclosure, the 3' overhang comprises any one of thymidine-thymidine (dTdT), adenine-adenine (AA), cytosine-cytosine (CC), guanine-guanine (GG), or uracil-uracil (UU).

[0026] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises an RNA sequence having a length of at least 20 nucleotides. In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises an RNA sequence having a length of 20 nucleotides.

[0027] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises an RNA sequence having a length of at least 22 nucleotides. In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises an RNA sequence having a length of 22 nucleotides.

[0028] In some embodiments of the isolated oligonucleotides of the present disclosure, the length of the double-stranded region is between 19 and 21 nucleotides. In some embodiments of the present disclosure, the length of the double-stranded region is 20 nucleotides.

[0029] In some embodiments of the isolated oligonucleotides of the present disclosure, the double-stranded region comprises the antisense strand and the sense strand according to any one of the antisense strand and sense strand sequence pairs in Table 1, as described herein.

[0030] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of the following: SEQ ID NO:2-31.

[0031] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence according to any one of the following: SEQ ID NO:32-61.

[0032] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of the following: SEQ ID NO:2-31; and the sense strand comprises a nucleotide sequence according to any one of the following: SEQ ID NO:32-61, wherein the antisense strand sequence and the sense strand sequence have sufficient complementarity to allow the formation of a double-stranded region between the antisense strand and the sense strand.

[0033] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 1281 to 1301; b) 1797 to 1817; c) 2862 to 2882; d) 4402 to 4424; and e) 4520 to 4540, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide reduces the expression of C3 mRNA by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95% or 95% to 99%, 99% to 100%) at a dose of 0.1 nM.

[0034] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 1281 to 1301; b) 1797 to 1817; c) 2862 to 2882; d) 4402 to 4424; and e) 4520 to 4540, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide reduces the expression of C3 mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45% or 45% to 50%) at a dose of 0.01 nM.

[0035] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 1281 to 1301; b) 1797 to 1817; c) 2862 to 2882; d) 4402 to 4424; and e) 4520 to 4540, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide reduces the expression of C3 mRNA by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95% or 95% to 99%, 99% to 100%) at a dose of 0.01 nM.

[0036] The present disclosure also provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region of 19 - 25 nucleotides between any of the following nucleotide positions starting from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1: a) 33 to 53; b) 237 to 260; c) 444 to 480; d) 583 to 879; e) 1118 to 1328; f) 1409 to 1542; g) 1619 to 1648; h) 1754 to 1816; i) 2232 to 2256; j) 2300 to 2368; k) 2423 to 2452; l) 2518 to 2726; m) 2860 to 2883; n) 2981 to 3043; o) 3125 to 3239; p) 3298 to 3437; q) 3567 to 3638; r) 3767 to 3913; s) 3985 to 4430; and t) 4490 to 5054, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.

[0037] In some embodiments of the isolated oligonucleotides comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19 - 25 nucleotides between any of the following nucleotide positions starting from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1: a) 33 to 53; b) 237 to 260; c) 444 to 480; d) 583 to 879; e) 1118 to 1328; f) 1409 to 1542; g) 1619 to 1648; h) 1754 to 1816; i) 2232 to 2256; j) 2300 to 2368; k) 2423 to 2452; l) 2518 to 2726; m) 2860 to 2883; n) 2981 to 3043; o) 3125 to 3239; p) 3298 to 3437; q) 3567 to 3638; r) 3767 to 3913; s) 3985 to 4430; and t) 4490 to 5054, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide reduces the expression of C3 mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45% or 45% to 50%) at a dose of 0.1 nM.

[0038] In some embodiments of the isolated oligonucleotides comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19 - 25 nucleotides between any of the following nucleotide positions starting from the 5' end of the C3 mRNA sequence according to SEQ ID NO:1: a) 33 to 53; b) 237 to 260; c) 444 to 480; d) 583 to 879; e) 1118 to 1328; f) 1409 to 1542; g) 1619 to 1648; h) 1754 to 1816; i) 2232 to 2256; j) 2300 to 2368; k) 2423 to 2452; l) 2518 to 2726; m) 2860 to 2883; n) 2981 to 3043; o) 3125 to 3239; p) 3298 to 3437; q) 3567 to 3638; r) 3767 to 3913; s) 3985 to 4430; and t) 4490 to 5054, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide reduces the expression of C3 mRNA by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95% or 95% to 100%) at a dose of 0.1 nM.

[0039] In some embodiments of the isolated oligonucleotides comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19 - 25 nucleotides between any of the following nucleotide positions starting from the 5' end of the C3 mRNA sequence according to SEQ ID NO:1: a) 33 to 53; b) 237 to 260; c) 444 to 480; d) 583 to 879; e) 1118 to 1328; f) 1409 to 1542; g) 1619 to 1648; h) 1754 to 1816; i) 2232 to 2256; j) 2300 to 2368; k) 2423 to 2452; l) 2518 to 2726; m) 2860 to 2883; n) 2981 to 3043; o) 3125 to 3239; p) 3298 to 3437; q) 3567 to 3638; r) 3767 to 3913; s) 3985 to 4430; and t) 4490 to 5054, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide reduces the expression of C3 mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45% or 45% to 50%) at a dose of 0.01 nM.

[0040] In some embodiments of the isolated oligonucleotides comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19 - 25 nucleotides between any of the following nucleotide positions starting from the 5'-end of the C3 mRNA sequence according to SEQ ID NO:1: a) 33 to 53; b) 237 to 260; c) 444 to 480; d) 583 to 879; e) 1118 to 1328; f) 1409 to 1542; g) 1619 to 1648; h) 1754 to 1816; i) 2232 to 2256; j) 2300 to 2368; k) 2423 to 2452; l) 2518 to 2726; m) 2860 to 2883; n) 2981 to 3043; o) 3125 to 3239; p) 3298 to 3437; q) 3567 to 3638; r) 3767 to 3913; s) 3985 to 4430; and t) 4490 to 5054, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide reduces the expression of C3 mRNA by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95% or 95% to 100%) at a dose of 0.01 nM.

[0041] The present disclosure also provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand or the antisense strand or both comprise one or more modified nucleotides.

[0042] In some embodiments of the isolated oligonucleotides comprising a sense strand and an antisense strand, the antisense strand comprises a monomethyl-protected phosphorothioate (5'-MeEP).

[0043] In some embodiments of the isolated oligonucleotides comprising a sense strand and an antisense strand, a sense strand or an antisense strand or both, a terminal or internal nucleotide is linked to a targeting ligand. In some embodiments, the targeting ligand comprises at least one GalNAc G1b moiety.

[0044] In some embodiments of the isolated oligonucleotides comprising a sense strand and an antisense strand, the antisense strand comprises nucleotides modified with 2'-F modification and nucleotides modified with 2'-O-methyl modification according to the formula: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5'.

[0045] In some embodiments of the isolated oligonucleotides comprising a sense strand and an antisense strand, the sense strand comprises nucleotides modified with 2'-F modification and nucleotides modified with 2'-O-methyl modification according to the formula: 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3'.

[0046] In some embodiments of the isolated oligonucleotides comprising a sense strand and an antisense strand, the antisense strand comprises any of the following: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 451 (5’[mUs][fUs][fA][mG][fU][mA][fG][mA][mA][fU][mU][mU][mC][fU][mC][fU][mG][mU][mA][mGs][mGs][mC]3’); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 452 (5’[mUs][fGs][fU][mA][fG][mU][fA][mG][mA][fA][mU][mU][mU][fC][mU][fC][mU][mG][mU][mAs][mGs][mG]3’); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 453 (5’[mUs][fAs][fU][mG][fU][mA][fG][mU][mA][fG][mA][mA][mU][fU][mU][fC][mU][mC][mU][mGs][mUs][mA]3’); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 454 (5’[mUs][fAs][fU][mA][fG][mA][fU][mG][mU][fA][mG][mU][mA][fG][mA][fA][mU][mU][mU][mCs][mUs][mC]3’); v) the antisense strand of the nucleic acid sequence according to SSEQ ID NO: 455 (5’[mUs][fAs][fU][mG][fA][mA][fG][mC][mA][fA][mU][mU][mC][fU][mC][fC][mU][mC][mA][mGs][mCs][mA]3’); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 456 (5’[mUs][fUs][fU][mU][fG][mU][fA][mU][mG][fA][mA][mG][mC][fA][mA][fU][mU][mC][mU][mCs][mCs][mU]3’); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 457 (5’[MeEPmUs][fUs][fA][mG][fU][mA][fG][mA][mA][fU][mU][mU][mC][fU][mC][fU][mG][mU][mA][mGs][mGs][mC]3’);viii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 458 (5’[MeEPmUs][fGs][fU][mA][fG][mU][fA][mG][mA][fA][mU][mU][mU][fC][mU][fC][mU][mG][mU][mAs][mGs][mG]3’); or ix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 459 (5’[MeEPmUs][fAs][fU][mG][fU][mA][fG][mU][mA][fG][mA][mA][mU][fU][mU][fC][mU][mC][mU][mGs][mUs][mA]3’), where “m” is a 2’-O-methyl modified nucleotide, “f” is a 2’-F modified nucleotide, “s” is a phosphorothioate nucleotide internucleoside linkage, and “MeEP” is a monomethyl protected phosphonate mimic.;

[0047] In some embodiments of the isolated oligonucleotides comprising a sense strand and an antisense strand, the sense strand comprises any of the following: i) a sense strand having the nucleic acid sequence according to SEQ ID NO: 444 (5’[mCs][mUs][mA][mC][mA][fG][mA][fG][fA][fA][fA][mU][mU][mC][mU][mA][mC][mUs][mAs][mA][G1b][G1b][G1b]3’); ii) a sense strand having the nucleic acid sequence according to SEQ ID NO: 445 (5’[mUs][mAs][mC][mA][mG][fA][mG][fA][fA][fA][fU][mU][mC][mU][mA][mC][mU][mAs][mCs][mA][G1b][G1b][G1b]3’); iii) a sense strand having the nucleic acid sequence according to SEQ ID NO: 446 (5’[mCs][mAs][mG][mA][mG][fA][mA][fA][fU][fU][fC][mU][mA][mC][mU][mA][mC][mAs][mUs][mA][G1b][G1b][G1b]3’), iv) a sense strand having the nucleic acid sequence according to SEQ ID NO: 447 (5’[mGs][mAs][mA][mA][mU][fU][mC][fU][fA][fC][fU][mA][mC][mA][mU][mC][mU][mAs][mUs][mA][G1b][G1b][G1b]3’); v) a sense strand having the nucleic acid sequence according to SEQ ID NO: 448 (5’[mCs][mUs][mG][mA][mG][fG][mA][fG][fA][fA][fU][mU][mG][mC][mU][mU][mC][mAs][mUs][mA][G1b][G1b][G1b]3’); or vi) a sense strand having the nucleic acid sequence according to SEQ ID NO: 449 (5’[mGs][mAs][mG][mA][mA][fU][mU][fG][fC][fU][fU][mC][mA][mU][mA][mC][mA][mAs][mAs][mA][G1b][G1b][G1b]3’), wherein “m” is a 2’-O-methyl modified nucleotide, “f” is a 2’-F modified nucleotide, “s” is a phosphorothioate internucleotide linkage, and “G1b” is a GalNac G1b moiety.

[0048] In some embodiments of the isolated oligonucleotides comprising a sense strand and an antisense strand, the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 451 (5’[mUs][fUs][fA][mG][fU][mA][fG][mA][mA][fU][mU][mU][mC][fU][mC][fU][mG][mU][mA][mGs][mGs][mC]3’) and the sense strand of the nucleic acid sequence according to SEQ ID NO: 444 (5’[mCs][mUs][mA][mC][mA][fG][mA][fG][fA][fA][fA][mU][mU][mC][mU][mA][mC][mUs][mAs][mA][G1b][G1b][G1b]3’); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 453 (5’[mUs][fAs][fU][mG][fU][mA][fG][mU][mA][fG][mA][mA][mU][fU][mU][fC][mU][mC][mU][mGs][mUs][mA]3’) and the sense strand of the nucleic acid sequence according to SEQ ID NO: 446 (5’[mCs][mAs][mG][mA][mG][fA][mA][fA][fU][fU][fC][mU][mA][mC][mU][mA][mC][mAs][mUs][mA][G1b][G1b][G1b]3’); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 457 (5’[MeEPmUs][fUs][fA][mG][fU][mA][fG][mA][mA][fU][mU][mU][mC][fU][mC][fU][mG][mU][mA][mGs][mGs][mC]3’) and the sense strand of the nucleic acid sequence according to SEQ ID NO: 444 (5’[mCs][mUs][mA][mC][mA][fG][mA][fG][fA][fA][fA][mU][mU][mC][mU][mA][mC][mUs][mAs][mA][G1b][G1b][G1b]3’);or iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 459 (5’ [MeEPmUs][fAs][fU][mG][fU][mA][fG][mU][mA][fG][mA][mA][mU][fU][mU][fC][mU][mC][mU][mGs][mUs][mA] 3’) and the sense strand of the nucleic acid sequence according to SEQ ID NO: 446 (5’ [mCs][mAs][mG][mA][mG][fA][mA][fA][fU][fU][fC][mU][mA][mC][mU][mA][mC][mAs][mUs][mA][G1b][G1b][G1b] 3’).;

[0049] The present disclosure also provides a vector encoding the isolated oligonucleotides disclosed herein.

[0050] The present disclosure also provides a delivery system comprising the isolated oligonucleotides or vectors disclosed herein.

[0051] The present disclosure also provides a pharmaceutical composition comprising the isolated oligonucleotides, vectors or delivery systems disclosed herein, and a pharmaceutically acceptable carrier, diluent or excipient.

[0052] The present disclosure also provides a kit comprising the isolated oligonucleotides, vectors, delivery systems or pharmaceutical compositions disclosed herein.

[0053] The present disclosure also provides a method for inhibiting or downregulating the expression or level of C3 in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of at least one of the isolated oligonucleotides, vectors, delivery systems or pharmaceutical compositions disclosed herein.

[0054] The present disclosure also provides a method for treating or preventing a disease or disorder associated with abnormal or increased expression or activity of C3, or a disease or disorder in which C3 plays a role, in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of at least one of the isolated oligonucleotides, vectors, delivery systems or pharmaceutical compositions disclosed herein. Brief Description of the Drawings

[0056] Figure 1 is a graph showing the efficacy of the siRNA compounds listed in Table 2 in silencing human complement C3 in cultured Huh-7 cells. The compounds were transfected into the cells at a concentration of 0.01 nM. Data are presented as the % of remaining human C3 mRNA relative to mock transfection when normalized to the Gapdh mRNA level (mean, + / - SEM). Each bar represents a single compound tested.

[0057] Figure 2 This is a graph showing the efficacy of the siRNA compounds listed in Table 2 in silencing human complement C3 in cultured Huh-7 cells. The compounds were transfected into the cells at a concentration of 0.1 nM. The data are presented as the percentage of remaining human C3 mRNA relative to mock transfection when normalized to the Gapdh mRNA level (mean, + / - SEM). Each bar represents a single compound tested.

[0058] Figure 3 This is a graph showing the in vivo efficacy of a subset of the compounds listed in Table 2 in mouse HDI liver on day 4 after administration at 1 mg / kg. The data are presented as the percentage of remaining human C3 mRNA relative to PBS when normalized to the NeoR mRNA level (mean, + / - SEM).

[0059] Figure 4 This is a graph showing the in vivo dose response of a subset of the compounds listed in Table 2 in mouse HDI liver on day 4 after administration at 0.25 mg / kg, 0.5 mg / kg, or 1 mg / kg. The data are presented as the percentage of remaining human C3 mRNA relative to PBS when normalized to the NeoR mRNA level (mean, + / - SEM).

[0060] Figures 5A - 5B This is a graph showing the in vivo efficacy evaluation of the compounds listed in Table 3 in cynomolgus monkeys (Macaca fascicularis) after a single subcutaneous (s.c.) administration at 3 mg / kg. The remaining cynomolgus monkey C3 mRNA ( Figure 5A ) and remaining serum C3 protein ( Figure 5B ) in the liver were measured over time. The data were normalized to the pre-dose mRNA or protein level for each animal.

[0061] Figure 6 This is a graph showing the remaining human C3 mRNA in human primary hepatocytes after treatment with the compounds from Table 3.

[0062] Details

[0063] The present disclosure provides isolated oligonucleotides, preferably small interfering RNAs (siRNAs), that form double-stranded regions and can reduce complement C3 mRNA expression, which in turn results in a reduced level of C3 protein expression in target cells. The oligonucleotides disclosed herein can have therapeutic applications for modulating C3 expression for the treatment of diseases involving complement component-related disorders, such as but not limited to paroxysmal nocturnal hemoglobinuria (PNH), rheumatoid arthritis, ischemia-reperfusion injury, multiple sclerosis (MS), Guillain-Barré syndrome, systemic lupus erythematosus, C3 glomerulonephritis (C3G), atypical hemolytic uremic syndrome (aHUS), myasthenia gravis (MG), neuromyelitis optica spectrum disorder (NMOSD), dense deposit disease (DDD), age-related macular degeneration (AMD), IgA nephropathy, multifocal motor neuropathy (MMN), organ transplantation, and neurodegenerative diseases.

[0064] In some aspects, the invention provides compositions and methods for treating a subject having a disorder that would benefit from a reduction in complement C3 expression. In some aspects, the methods disclosed herein prevent at least one symptom in a subject having a disease or disorder that would benefit from a reduction in complement C3 expression.

[0065] The present disclosure has identified specific regions within C3 mRNA that provide targets for binding double-stranded oligonucleotides (e.g., siRNAs), resulting in a reduced expression level of C3 mRNA.

[0066] The C3 mRNA sequence described herein is the mRNA sequence encoded by the complement C3 gene according to GenBank accession number NM_000064.4:

[0067] ACTCCTCCCCATCCTCTCCCTCTGTCCCTCTGTCCCTCTGACCCTGCACTGTCCCAGCAC

[0068] CATGGGACCCACCTCAGGTCCCAGCCTGCTGCTCCTGCTACTAACCCACCTCCCCCTGG

[0069] CTCTGGGGAGTCCCATGTACTCTATCATCACCCCCAACATCTTGCGGCTGGAGAGCGAG

[0070] GAGACCATGGTGCTGGAGGCCCACGACGCGCAAGGGGATGTTCCAGTCACTGTTACTGT

[0071] CCACGACTTCCCAGGCAAAAAACTAGTGCTGTCCAGTGAGAAGACTGTGCTGACCCCT

[0072] GCCACCAACCACATGGGCAACGTCACCTTCACGATCCCAGCCAACAGGGAGTTCAAGT

[0073] CAGAAAAGGGGCGCAACAAGTTCGTGACCGTGCAGGCCACCTTCGGGACCCAAGTGGT

[0074] GGAGAAGGTGGTGCTGGTCAGCCTGCAGAGCGGGTACCTCTTCATCCAGACAGACAAG

[0075] ACCATCTACACCCCTGGCTCCACAGTTCTCTATCGGATCTTCACCGTCAACCACAAGCTG

[0076] CTACCCGTGGGCCGGACGGTCATGGTCAACATTGAGAACCCGGAAGGCATCCCGGTCA

[0077] AGCAGGACTCCTTGTCTTCTCAGAACCAGCTTGGCGTCTTGCCCTTGTCTTGGGACATTC

[0078] CGGAACTCGTCAACATGGGCCAGTGGAAGATCCGAGCCTACTATGAAAACTCACCACA

[0079] GCAGGTCTTCTCCACTGAGTTTGAGGTGAAGGAGTACGTGCTGCCCAGTTTCGAGGTCA

[0080] TAGTGGAGCCTACAGAGAAATTCTACTACATCTATAACGAGAAGGGCCTGGAGGTCACC

[0081] ATCACCGCCAGGTTCCTCTACGGGAAGAAAGTGGAGGGAACTGCCTTTGTCATCTTCGG

[0082] GATCCAGGATGGCGAACAGAGGATTTCCCTGCCTGAATCCCTCAAGCGCATTCCGATTG

[0083] AGGATGGCTCGGGGGAGGTTGTGCTGAGCCGGAAGGTACTGCTGGACGGGGTGCAGAA

[0084] CCCCCGAGCAGAAGACCTGGTGGGGAAGTCTTTGTACGTGTCTGCCACCGTCATCTTGC

[0085] ACTCAGGCAGTGACATGGTGCAGGCAGAGCGCAGCGGGATCCCCATCGTGACCTCTCC

[0086] CTACCAGATCCACTTCACCAAGACACCCAAGTACTTCAAACCAGGAATGCCCTTTGACC

[0087] TCATGGTGTTCGTGACGAACCCTGATGGCTCTCCAGCCTACCGAGTCCCCGTGGCAGTC

[0088] CAGGGCGAGGACACTGTGCAGTCTCTAACCCAGGGAGATGGCGTGGCCAAACTCAGCA

[0089] TCAACACACACCCCAGCCAGAAGCCCTTGAGCATCACGGTGCGCACGAAGAAGCAGGA

[0090] GCTCTCGGAGGCAGAGCAGGCTACCAGGACCATGCAGGCTCTGCCCTACAGCACCGTG

[0091] GGCAACTCCAACAATTACCTGCATCTCTCAGTGCTACGTACAGAGCTCAGACCCGGGGA

[0092] GACCCTCAACGTCAACTTCCTCCTGCGAATGGACCGCGCCCACGAGGCCAAGATCCGCT

[0093] ACTACACCTACCTGATCATGAACAAGGGCAGGCTGTTGAAGGCGGGACGCCAGGTGCG

[0094] AGAGCCCGGCCAGGACCTGGTGGTGCTGCCCCTGTCCATCACCACCGACTTCATCCCTT

[0095] CCTTCCGCCTGGTGGCGTACTACACGCTGATCGGTGCCAGCGGCCAGAGGGAGGTGGT

[0096] GGCCGACTCCGTGTGGGTGGACGTCAAGGACTCCTGCGTGGGCTCGCTGGTGGTAAAA

[0097] AGCGGCCAGTCAGAAGACCGGCAGCCTGTACCTGGGCAGCAGATGACCCTGAAGATAG

[0098] AGGGTGACCACGGGGCCCGGGTGGTACTGGTGGCCGTGGACAAGGGCGTGTTCGTGCT

[0099] GAATAAGAAGAACAAACTGACGCAGAGTAAGATCTGGGACGTGGTGGAGAAGGCAGA

[0100] CATCGGCTGCACCCCGGGCAGTGGGAAGGATTACGCCGGTGTCTTCTCCGACGCAGGGC

[0101] TGACCTTCACGAGCAGCAGTGGCCAGCAGACCGCCCAGAGGGCAGAACTTCAGTGCCC

[0102] GCAGCCAGCCGCCCGCCGACGCCGTTCCGTGCAGCTCACGGAGAAGCGAATGGACAAA

[0103] GTCGGCAAGTACCCCAAGGAGCTGCGCAAGTGCTGCGAGGACGGCATGCGGGAGAACC

[0104] CCATGAGGTTCTCGTGCCAGCGCCGGACCCGTTTCATCTCCCTGGGCGAGGCGTGCAAG

[0105] AAGGTCTTCCTGGACTGCTGCAACTACATCACAGAGCTGCGGCGGCAGCACGCGCGGG

[0106] CCAGCCACCTGGGCCTGGCCAGGAGTAACCTGGATGAGGACATCATTGCAGAAGAGAA

[0107] CATCGTTTCCCGAAGTGAGTTCCCAGAGAGCTGGCTGTGGAACGTTGAGGACTTGAAA

[0108] GAGCCACCGAAAAATGGAATCTCTACGAAGCTCATGAATATATTTTTGAAAGACTCCATC

[0109] ACCACGTGGGAGATTCTGGCTGTGAGCATGTCGGACAAGAAAGGGATCTGTGTGGCAG

[0110] ACCCCTTCGAGGTCACAGTAATGCAGGACTTCTTCATCGACCTGCGGCTACCCTACTCTG

[0111] TTGTTCGAAACGAGCAGGTGGAAATCCGAGCCGTTCTCTACAATTACCGGCAGAACCAA

[0112] GAGCTCAAGGTGAGGGTGGAACTACTCCACAATCCAGCCTTCTGCAGCCTGGCCACCA

[0113] CCAAGAGGCGTCACCAGCAGACCGTAACCATCCCCCCCAAGTCCTCGTTGTCCGTTCCA

[0114] TATGTCATCGTGCCGCTAAAGACCGGCCTGCAGGAAGTGGAAGTCAAGGCTGCTGTCTA

[0115] CCATCATTTCATCAGTGACGGTGTCAGGAAGTCCCTGAAGGTCGTGCCGGAAGGAATCA

[0116] GAATGAACAAAACTGTGGCTGTTCGCACCCTGGATCCAGAACGCCTGGGCCGTGAAGG

[0117] AGTGCAGAAAGAGGACATCCCACCTGCAGACCTCAGTGACCAAGTCCCGGACACCGAG

[0118] TCTGAGACCAGAATTCTCCTGCAAGGGACCCCAGTGGCCCAGATGACAGAGGATGCCG

[0119] TCGACGCGGAACGGCTGAAGCACCTCATTGTGACCCCCTCGGGCTGCGGGGAACAGAA

[0120] CATGATCGGCATGACGCCCACGGTCATCGCTGTGCATTACCTGGATGAAACGGAGCAGT

[0121] GGGAGAAGTTCGGCCTAGAGAAGCGGCAGGGGGCCTTGGAGCTCATCAAGAAGGGGT

[0122] ACACCCAGCAGCTGGCCTTCAGACAACCCAGCTCTGCCTTTGCGGCCTTCGTGAAACG

[0123] GGCACCCAGCACCTGGCTGACCGCCTACGTGGTCAAGGTCTTCTCTCTGGCTGTCAACC

[0124] TCATCGCCATCGACTCCCAAGTCCTCTGCGGGGCTGTTAAATGGCTGATCCTGGAGAAG

[0125] CAGAAGCCCGACGGGGTCTTCCAGGAGGATGCGCCCGTGATACACCAAGAAATGATTG

[0126] GTGGATTACGGAACAACAACGAGAAAGACATGGCCCTCACGGCCTTTGTTCTCATCTCG

[0127] CTGCAGGAGGCTAAAGATATTTGCGAGGAGCAGGTCAACAGCCTGCCAGGCAGCATCA

[0128] CTAAAGCAGGAGACTTCCTTGAAGCCAACTACATGAACCTACAGAGATCCTACACTGTG

[0129] GCCATTGCTGGCTATGCTCTGGCCCAGATGGGCAGGCTGAAGGGGCCTCTTCTTAACAA

[0130] ATTTCTGACCACAGCCAAAGATAAGAACCGCTGGGAGGACCCTGGTAAGCAGCTCTACA

[0131] ACGTGGAGGCCACATCCTATGCCCTCTTGGCCCTACTGCAGCTAAAAGACTTTGACTTTG

[0132] TGCCTCCCGTCGTGCGTTGGCTCAATGAACAGAGATACTACGGTGGTGGCTATGGCTCTA

[0133] CCCAGGCCACCTTCATGGTGTTCCAAGCCTTGGCTCAATACCAAAAGGACGCCCCTGAC

[0134] CACCAGGAACTGAACCTTGATGTGTCCCTCCAACTGCCCAGCCGCAGCTCCAAGATCAC

[0135] CCACCGTATCCACTGGGAATCTGCCAGCCTCCTGCGATCAGAAGAGACCAAGGAAAATG

[0136] AGGGTTTCACAGTCACAGCTGAAGGAAAAGGCCAAGGCACCTTGTCGGTGGTGACAAT

[0137] GTACCATGCTAAGGCCAAAGATCAACTCACCTGTAATAAATTCGACCTCAAGGTCACCAT

[0138] AAAACCAGCACCGGAAACAGAAAAGAGGCCTCAGGATGCCAAGAACACTATGATCCTT

[0139] GAGATCTGTACCAGGTACCGGGGAGACCAGGATGCCACTATGTCTATATTGGACATATCC

[0140] ATGATGACTGGCTTTGCTCCAGACACAGATGACCTGAAGCAGCTGGCCAATGGTGTTGA

[0141] CAGATACATCTCCAAGTATGAGCTGGACAAAGCCTTCTCCGATAGGAACACCCTCATCAT

[0142] CTACCTGGACAAGGTCTCACACTCTGAGGATGACTGTCTAGCTTTCAAAGTTCACCAAT

[0143] ACTTTAATGTAGAGCTTATCCAGCCTGGAGCAGTCAAGGTCTACGCCTATTACAACCTGG

[0144] AGGAAAGCTGTACCCGGTTCTACCATCCGGAAAAGGAGGATGGAAAGCTGAACAAGCT

[0145] CTGCCGTGATGAACTGTGCCGCTGTGCTGAGGAGAATTGCTTCATACAAAAGTCGGATG

[0146] ACAAGGTCACCCTGGAAGAACGGCTGGACAAGGCCTGTGAGCCAGGAGTGGACTATGT

[0147] GTACAAGACCCGACTGGTCAAGGTTCAGCTGTCCAATGACTTTGACGAGTACATCATGG

[0148] CCATTGAGCAGACCATCAAGTCAGGCTCGGATGAGGTGCAGGTTGGACAGCAGCGCAC

[0149] GTTCATCAGCCCCATCAAGTGCAGAGAAGCCCTGAAGCTGGAGGAGAAGAAACACTAC

[0150] CTCATGTGGGGTCTCTCCTCCGATTTCTGGGGAGAGAAGCCCAACCTCAGCTACATCATC

[0151] GGGAAGGACACTTGGGTGGAGCACTGGCCCGAGGAGGACGAATGCCAAGACGAAGAG

[0152] AACCAGAAACAATGCCAGGACCTCGGCGCCTTCACCGAGAGCATGGTTGTCTTTGGGT

[0153] GCCCCAACTGACCACACCCCCATTCCCCCACTCCAGATAAAGCTTCAGTTATATCTCACG

[0154] TGTCTGGAGTTCTTTGCCAAGAGGGAGAGGCTGAAATCCCCAGCCGCCTCACCTGCAG

[0155] CTCAGCTCCATCCTACTTGAAACCTCACCTGTTCCCACCGCATTTTCTCCTGGCGTTCGCCTGCTAGTGTG(SEQ ID NO:1)

[0156] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region of 19 - 25 nucleotides between any of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.

[0157] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95% or at least 99% identical to a region of 19 - 25 nucleotides between any of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625.

[0158] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region of 19 - 25 nucleotides between any of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625.

[0159] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence substantially identical to a region between any of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 1281 to 1301; b) 1797 to 1817; c) 2862 to 2882; d) 4402 to 4424; and e) 4520 to 4540.

[0160] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95% or at least 99% identical to a region between any of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 1281 to 1301; b) 1797 to 1817; c) 2862 to 2882; d) 4402 to 4424; and e) 4520 to 4540.

[0161] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 1281 to 1301; b) 1797 to 1817; c) 2862 to 2882; d) 4402 to 4424; and e) 4520 to 4540.

[0162] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence substantially identical to a region of a sequence between any of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 772 to 801; b) 2424 to 2444; c) 3784 to 3805; d) 4123 to 4169; e) 4438 to 4509; and f) 4558 to 4621.

[0163] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising a sequence between any of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 772 to 801; b) 2424 to 2444; c) 3784 to 3805; d) 4123 to 4169; e) 4438 to 4509; and f) 4558 to 4621.

[0164] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence that is identical to a region comprising a sequence between any of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 772 to 801; b) 2424 to 2444; c) 3784 to 3805; d) 4123 to 4169; e) 4438 to 4509; and f) 4558 to 4621.

[0165] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence that is substantially identical to a region comprising a sequence between any of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 588 to 608; b) 773 to 800; c) 2533 to 2585; d) 3778 to 3836; e) 4492 to 4512; and f) 4600 to 4625.

[0166] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising a sequence between any of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 588 to 608; b) 773 to 800; c) 2533 to 2585; d) 3778 to 3836; e) 4492 to 4512; and f) 4600 to 4625.

[0167] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence that is identical to a region comprising a sequence between any of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 588 to 608; b) 773 to 800; c) 2533 to 2585; d) 3778 to 3836; e) 4492 to 4512; and f) 4600 to 4625.

[0168] The C3 mRNA sequence according to SEQ ID NO:1 as described herein is any heterologous mRNA sequence having sufficient identity to C3 according to accession number NM_000064.4 as described herein and that permits binding to the antisense strand of the oligonucleotides of the present disclosure.

[0169] In some embodiments of the isolated oligonucleotides of the present disclosure, the isolated oligonucleotides are capable of inducing degradation of C3 mRNA.

[0170] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of the present disclosure, both the sense strand and the antisense strand are single-stranded RNA molecules.

[0171] In some embodiments, the isolated oligonucleotides of the present disclosure are small interfering RNAs (siRNAs). Accordingly, the present disclosure provides siRNAs, wherein the siRNA comprises a sense region and an antisense region complementary to the sense region, which together form an RNA duplex, and wherein the sense region comprises a sequence that is at least 70% to 100% identical to the C3 mRNA sequence.

[0172] Definitions

[0173] "RNAi" or "RNA interference" refers to the process of sequence-specific post-transcriptional gene silencing mediated by double-stranded RNA (dsRNA). Double-stranded RNA siRNAs (small interfering RNAs), miRNAs (microRNAs), shRNAs (short hairpin RNAs), ddRNAs (DNA-directed RNAs), piRNAs (Piwi-interacting RNAs), or rasiRNAs (repeat-associated siRNAs) and their modified forms are all capable of mediating RNA interference. These dsRNA molecules can be commercially available or can be designed and prepared based on known sequence information, etc. The antisense strand of these molecules can include RNA, DNA, PNA, or combinations thereof. These DNA / RNA chimeric polynucleotides include, but are not limited to, double-stranded polynucleotides composed of DNA and RNA that inhibit the expression of a target gene. These dsRNA molecules can also include one or more modified nucleotides as described herein that can be incorporated into either strand.

[0174] During RNAi gene silencing or knockdown, double-stranded RNA (dsRNA) containing a first (antisense) strand complementary to a portion of a target gene and a second (sense) strand that is fully or partially complementary to the first antisense strand is introduced into an organism. After introduction into the organism, the target gene-specific dsRNA is processed into relatively small fragments (siRNAs), and can subsequently become distributed throughout the organism, reducing the messenger RNA of the target gene, resulting in a phenotype that may closely resemble the phenotype caused by the complete or partial deletion of the target gene.

[0175] Certain dsRNAs in cells can undergo the action of the Dicer enzyme (a ribonuclease III enzyme). Dicer can process dsRNA into shorter dsRNA fragments, namely siRNAs. RNAi also involves an endonuclease complex called the RNA-induced silencing complex (RISC). After cleavage by Dicer, the siRNA enters the RISC complex and directs the cleavage of single-stranded RNA targets having a sequence complementary to the antisense strand of the siRNA duplex. The other strand of the siRNA is the passenger strand. Cleavage of the target RNA occurs in the middle of the region complementary to the antisense strand of the siRNA duplex. Thus, siRNAs can downregulate or knockdown gene expression by mediating RNA interference in a sequence-specific manner.

[0176] As used herein, "target gene" or "target sequence" refers to a gene or gene sequence whose corresponding RNA is targeted for degradation via the RNAi pathway using the dsRNA or siRNA described herein. To target a gene, for example, using siRNA to target a gene, the siRNA contains an antisense region complementary or substantially complementary to at least a portion of the target gene or sequence and a sense strand complementary to the antisense strand. Once introduced into a cell, the siRNA directs the RISC complex to cleave the RNA containing the target sequence, thereby degrading the RNA.

[0177] As used herein, the terms "oligonucleotide," "nucleic acid," "nucleotide sequence," and "polynucleotide" are used interchangeably and encompass both RNA and DNA, including cDNA, genomic DNA, mRNA, synthetic (e.g., chemically synthesized) DNA or RNA, and chimeras of RNA and DNA. The term polynucleotide, nucleotide sequence, or nucleic acid refers to a chain of nucleotides, regardless of the length of the chain. Nucleic acids can be double-stranded or single-stranded. Where single-stranded, the nucleic acid can be the sense strand or the antisense strand. Nucleic acids can be synthesized using oligonucleotide analogs or derivatives (e.g., inosine or phosphorothioate nucleotides). Such oligonucleotides can be used, for example, to prepare nucleic acids with altered base-pairing capabilities or increased resistance to nucleases. The present disclosure also provides nucleic acids that are complements (which can be full complements or partial complements) of the nucleic acids, nucleotide sequences, or polynucleotides of the present disclosure. When synthesizing dsRNA, less common bases such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine, and other bases can also be used for antisense, dsRNA, and ribozyme pairing. Other modifications can also be made, such as modifications to the phosphodiester backbone or 2'-fluoro, 2'-hydroxy, or 2'-O-methyl in the ribose group of RNA.

[0178] The term "isolated" can refer to a nucleic acid, nucleotide sequence, or polypeptide that is substantially free of cellular material, viral material, and / or culture medium (when produced by recombinant DNA techniques), or chemical precursors or other chemicals (when chemically synthesized). Additionally, an "isolated fragment" is a fragment of a nucleic acid, nucleotide sequence, or polypeptide that does not occur as a fragment in nature and would not be found in its natural state. "Isolated" does not mean that the preparation is technically pure (homogeneous), but rather that it is pure enough to provide the polypeptide or nucleic acid in a form that can be used for the intended purpose.

[0179] The terms "region" or "fragment" are used interchangeably and apply to oligonucleotides.

[0180] Unless otherwise indicated, C3 mRNA sequences as described herein will be understood to mean full-length C3 mRNA nucleotide sequences. In some embodiments, a C3 mRNA sequence can be a nucleotide sequence that is reduced in length relative to a reference nucleic acid or nucleotide sequence of a C3 mRNA sequence and that comprises, consists essentially of, and / or consists of contiguous nucleotides that are the same as or substantially the same as (e.g., 60%, 70%, 80%, 90%, 92%, 95%, 98%, or 99% identical) to the reference nucleic acid or nucleotide sequence. In appropriate instances, such nucleic acid fragments according to the present disclosure can be included in larger polynucleotides of which they are a component. In some embodiments, such fragments can comprise, consist essentially of, and / or consist of oligonucleotides having a length of at least about 8, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200, or more contiguous nucleotides of a nucleic acid or nucleotide sequence according to the present disclosure.

[0181] As used herein, "complementary" polynucleotides are those capable of base-pairing according to the standard Watson-Crick complementarity rules. Specifically, purines will base-pair with pyrimidine bases to form combinations of guanine with cytosine (G:C) and adenine with thymine (A:T) (in the case of DNA) or adenine with uracil (A:U) (in the case of RNA). For example, the sequence "A-G-T" binds to the complementary sequence "T-C-A". It should be understood that even if two polynucleotides are not completely complementary to each other, they can hybridize to each other provided that each has at least one region that is substantially complementary to the other.

[0182] As used herein, the term "substantially complementary" is at least 90% complementary to the sense strand (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary), i.e., substantially the same as the nucleotide sequence within the defined region in SEQ ID NO:1. As used herein, the term "substantially complementary" means that two nucleic acid sequences are complementary at at least about 90%, 95%, or 99% of their nucleotides.

[0183] In some embodiments, two nucleic acid sequences can be complementary at at least 90%, 95%, 96%, 97%, 98%, 99% or more of their nucleotides. In some embodiments, two nucleic acid sequences can be complementary between 90% and 95%, between 70% and 100%, between 95% and 96%, between 90% and 100%, between 96% and 97%, between 60% and 80%, between 97% and 98%, between 70% and 90%, between 98% and 99%, between 80% and 100%, or between 99% and 100%.

[0184] The term "substantially complementary" can also mean that two nucleic acid sequences of a sense strand and an antisense strand have sufficient complementarity to allow binding between the sense strand and the antisense strand to form a double-stranded region consisting of between 19 and 25 nucleotides in length. The term "substantially complementary" can also mean that two nucleic acid sequences can hybridize under high stringency conditions, and such conditions are well known in the art.

[0185] As used herein, the terms "substantially identical" or "sufficient identity" are used interchangeably herein and are at least 70%, at least 80%, at least 90%, at least 95% or at least 99% (e.g., between 70% and 80%, 85% and 90%, or 90% and 95%, or 95% and 99%, or 99% and 100%) identical to the nucleotide sequence within the defined region of SEQ ID NO:1.

[0186] As used herein, the term "identity" means comparing sequences to each other. To determine the percentage identity of two nucleic acid sequences, the sequences can first be aligned relative to each other so as to subsequently enable comparison of these sequences. To this end, for example, gaps can be inserted into the sequence of the first nucleic acid sequence, and the nucleotides can be compared to the corresponding positions of the second nucleic acid sequence. If the position in the first nucleic acid sequence is occupied by the same nucleotide as at the position in the second sequence, then the two sequences are identical at that position. The percentage identity between two sequences is a function of the number of identical positions divided by the number of all positions compared in the sequences being studied.

[0187] For an alignment segment of a test sequence and a reference sequence, the "percentage identity" or "% identity", used interchangeably herein, is the percentage of the total number of components in the reference sequence segment (i.e., the entire reference sequence or a smaller defined portion of the reference sequence) that is shared by the two aligned sequences.

[0188] Unless otherwise indicated, the terms "nucleotide sequence" and "nucleic acid sequence" are used interchangeably herein.

[0189] The percent identity between two sequences can be determined using a mathematical algorithm. A preferred, but not limiting example of a mathematical algorithm for comparing two sequences is the algorithm of Karlin et al. (1993), PNAS USA, 90:5873-5877. Such an algorithm is incorporated into the NBLAST program, which can be used to identify sequences having a desired identity with the sequences of the present disclosure. To obtain gapped alignments, as described herein, the "Gapped BLAST" program can be used, as described in Altschul et al. (1997), Nucleic Acids Res, 25:3389-3402. When using the BLAST and Gapped BLAST programs, the default parameters of a particular program (e.g., NBLAST) can be used. The sequences can be further aligned using version 9 of the GAP (Global Alignment Program) of the "Genetic Computing Group", using the default (BLOSUM62) matrix (values -4 to +11), where the gap opening penalty is -12 (for the first zero of the gap), and the gap extension penalty is -4 (for each additional consecutive zero in the gap). After alignment, the percent identity is calculated by expressing the number of identities as a percentage of the nucleic acids in the claimed sequence. If necessary, the methods described for determining the percent identity between two nucleic acid sequences can also be correspondingly applied to the encoded amino acid sequences.

[0190] Useful methods for determining sequence identity are also disclosed in Guide to Huge Computers (Martin J. Bishop, ed., Academic Press, San Diego (1994)), and Carillo, H. and Lipton, D., (Applied Math 48:1073 (1988)). More specifically, preferred computer programs for determining sequence identity include, but are not limited to, the Basic Local Alignment Search Tool (BLAST) program, which is publicly available from the National Center for Biotechnology Information (NCBI), National Library of Medicine, National Institutes of Health, Bethesda, Md. 20894; see BLAST Manual, Altschul et al., NCBI, NLM, NIH; (Altschul et al., J. Mol. Biol. 215:403-410 (1990)); BLAST programs version 2.0 or higher allow gaps (deletions and insertions) to be introduced in the alignment; for peptide sequences, BLASTX can be used to determine sequence identity; and, for polynucleotide sequences, BLASTN can be used to determine sequence identity. The percent identity can be 70% identity or higher, e.g., at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 98% identity, at least 99% identity or 100% identity.

[0191] As used herein, "heterologous" means a nucleic acid sequence derived from another species or from the same species or organism but modified from its original form or from the form primarily expressed in the cell. Thus, a nucleotide sequence derived from an organism or species different from the cell into which the nucleotide sequence is introduced is heterologous with respect to that cell and the progeny of that cell. Additionally, heterologous nucleotide sequences include nucleotide sequences derived from the same native, original cell type and inserted into the same native, original cell type, but which are present in a non-native state, e.g., different copy numbers, and / or under the control of different regulatory sequences than those found in nature.

[0192] Double-stranded RNA targeting human complement C3

[0193] The present disclosure provides isolated oligonucleotides that include a double-stranded RNA (dsRNA) duplex region targeting a C3 mRNA sequence for degradation. The double-stranded RNA molecules of the present disclosure can be in the form of any type of RNA interference molecule known in the art. In some embodiments, the double-stranded RNA molecule is a small interfering RNA (siRNA). In other embodiments, the double-stranded RNA molecule is a short hairpin RNA (shRNA) molecule. In other embodiments, the double-stranded RNA molecule is a Dicer substrate that is processed in a cell to produce siRNA. In other embodiments, the double-stranded RNA molecule is part of a microRNA precursor molecule.

[0194] In some embodiments, the dsRNA is a small interfering RNA (siRNA) targeting a C3 mRNA sequence for degradation. In some embodiments, the siRNA targeting C3 is packaged in a delivery system (e.g., nanoparticles) described herein.

[0195] The isolated oligonucleotides of the present disclosure that target C3 for degradation can include a sense strand that is at least 70% identical to any fragment of the C3 mRNA (e.g., the C3 mRNA of SEQ ID NO:1). In some embodiments, the sense strand comprises or consists essentially of a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or 100% identical to any fragment of SEQ ID NO:1. The siRNA targeting C3 for degradation can include an antisense strand that is at least 70% identical to a sequence complementary to any fragment of the C3 mRNA (e.g., the C3 mRNA of SEQ ID NO:1). In some embodiments, the antisense strand comprises or consists essentially of a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or 100% identical to a sequence complementary to any fragment of SEQ ID NO:1. In some embodiments, the sense region and the antisense region are complementary and base pair to form an RNA duplex structure. The fragment of the C3 mRNA that has a percent identity to the sense region of the siRNA and is complementary to the antisense region of the siRNA can be the protein-coding sequence of the mRNA, the untranslated region (UTR) of the mRNA (5' UTR or 3' UTR), or both.

[0196] In some embodiments, the isolated oligonucleotides of the present disclosure include a sense region and an antisense region complementary to the sense region that together form an RNA duplex, and the sense region includes a sequence that is at least 70% identical to the C3 mRNA sequence. In some embodiments, the sense region is identical to the C3 mRNA sequence.

[0197] As used herein, the term "sense strand" or "sense region" refers to the nucleotide sequence of a siRNA molecule that is partially or fully complementary to at least a portion of the corresponding antisense strand or antisense region of the siRNA molecule. The sense strand of an isolated oligonucleotide of the molecules of the present disclosure can include a nucleic acid sequence having a certain percentage identity to a target nucleic acid sequence such as a C3 mRNA sequence. In some cases, the sense region can have 100% identity to the target nucleic acid sequence, i.e., complete identity or homology. In other cases, one or more mismatches can exist between the sense region and the target nucleic acid sequence. For example, 1, 2, 3, 4, 5, 6, or 7 mismatches can exist between the sense region and the target nucleic acid sequence.

[0198] As used herein, the term "antisense strand" or "antisense region" refers to the nucleotide sequence in an isolated oligonucleotide of the present disclosure that is partially or fully complementary to at least a portion of the target nucleic acid sequence. The antisense strand of an isolated oligonucleotide of the molecules of the present disclosure can include a nucleic acid sequence that is complementary to at least a portion of the corresponding sense strand of the isolated oligonucleotide.

[0199] In some embodiments, the sense region comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence of SEQ ID NO:1 or a region of SEQ ID NO:1 as disclosed herein. In some embodiments, the sense region consists essentially of a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence of SEQ ID NO:1 or a region of SEQ ID NO:1 as disclosed herein. In some embodiments, the sense region comprises a sequence that is identical to the sequence of SEQ ID NO:1 or a region of SEQ ID NO:1 as disclosed herein. In some embodiments, the sense region consists essentially of a sequence that is identical to the sequence of SEQ ID NO:1 or a region of SEQ ID NO:1 as disclosed herein.

[0200] In some embodiments, the sense region of the isolated oligonucleotide targeting C3 has one or more mismatches between the sequence of the isolated oligonucleotide and the C3 sequence. For example, the sequence of the sense region can have 1, 2, 3, 4, or 5 mismatches between the sequence of the sense region of the isolated oligonucleotide and the C3 sequence. In some embodiments, the C3 sequence is a C3 3' untranslated region sequence (3'UTR). Without wishing to be bound by theory, it is believed that siRNAs targeting the 3'UTR have increased mismatch tolerance compared to mismatches in isolated oligonucleotides targeting gene coding regions. In addition, the isolated oligonucleotide RNA can tolerate mismatches outside the seed region. As used herein, the "seed region" of an isolated oligonucleotide refers to base pairs 2-8 of the antisense region of the isolated oligonucleotide, i.e., the strand of the isolated oligonucleotide that is complementary to and hybridizes to the target mRNA.

[0201] In some embodiments, the antisense region comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence complementary to the sequence of SEQ ID NO:1 as disclosed herein or a region of SEQ ID NO:1. In some embodiments, the antisense region consists primarily of a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence complementary to the sequence of SEQ ID NO:1 or a region of SEQ ID NO:1. In some embodiments, the antisense region comprises a sequence identical to a sequence complementary to the sequence of SEQ ID NO:1 or a region of SEQ ID NO:1. In some embodiments, the sense region consists primarily of a sequence complementary to the sequence of SEQ ID NO:1 or a region of SEQ ID NO:1.

[0202] The antisense region of the isolated oligonucleotide targeting C3 of the present disclosure is complementary to the sense region. In some embodiments, the sense region and the antisense region are fully complementary (no mismatches). In some embodiments, the antisense region is partially complementary to the sense region, i.e., there are 1, 2, 3, 4, or 5 mismatches between the sense region and the antisense region.

[0203] Generally, the isolated oligonucleotides of the present disclosure comprise an RNA duplex that is from about 16 to about 25 nucleotides in length. In some embodiments, the RNA duplex is between about 17 and about 24 nucleotides in length, between about 18 and about 23 nucleotides in length, or between about 19 and about 22 nucleotides in length. In some embodiments, the RNA duplex is 19 nucleotides in length. In some embodiments, the RNA duplex is 20 nucleotides in length.

[0204] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand is a single-stranded RNA molecule. In some embodiments, both the sense strand and the antisense strand are single-stranded RNA molecules. In some embodiments, the isolated oligonucleotides of the present disclosure are siRNAs targeting C3, which comprise two different single-stranded RNAs, the first comprising a sense region and the second comprising an antisense region, which hybridize to form an RNA duplex.

[0205] In some embodiments, the isolated oligonucleotides of the present disclosure may have one or more overhangs from the duplex region. In some embodiments, the overhangs (which are unpaired single-stranded regions) can be from 1 to 8 nucleotides or longer in length. In some embodiments, the overhang can be a 3' overhang, where the 3' end of the strand has a single-stranded region from 1 to 8 nucleotides. In some embodiments, the overhang can be a 5' overhang, where the 5' end of the strand has a single-stranded region from 1 to 8 nucleotides. In some embodiments, the overhangs of the isolated oligonucleotides are of the same length. In some embodiments, the overhangs of the isolated oligonucleotides are of different lengths.

[0206] In some embodiments of the isolated oligonucleotides of the present disclosure, the single-stranded RNA molecule of the sense strand comprises a 3' overhang. In some embodiments, the 3' overhang of the single-stranded RNA molecule of the sense strand comprises at least one nucleotide. In some embodiments, the 3' overhang of the single-stranded RNA molecule of the sense strand comprises two nucleotides.

[0207] In some embodiments of the isolated oligonucleotides of the present disclosure, the single-stranded RNA molecule of the antisense strand comprises a 3' overhang. In some embodiments, the 3' overhang of the single-stranded RNA molecule of the antisense strand comprises at least one nucleotide. In some embodiments, the 3' overhang of the single-stranded RNA molecule of the antisense strand comprises two nucleotides.

[0208] In some embodiments of the isolated oligonucleotides of the present disclosure, both ends of the isolated oligonucleotide have overhangs, for example, having 3'-dinucleotide overhangs at each end. In some embodiments, the overhangs at the 5' end and the 3' end are of different lengths. In some embodiments, the overhangs at the 5' end and the 3' end are of the same length.

[0209] In some embodiments of the isolated oligonucleotides of the present disclosure, the overhangs can comprise one or more deoxyribonucleotides, one or more ribonucleotides, or a combination of deoxyribonucleotides and ribonucleotides. In some embodiments, one or both overhang nucleotides of the siRNA can be 2'-deoxyribonucleotides.

[0210] In some embodiments of the isolated oligonucleotides of the present disclosure, the first single-stranded RNA molecule comprises a first 3' overhang. In some embodiments, the second single-stranded RNA molecule comprises a second 3' overhang. In some embodiments, the first 3' overhang and the second 3' overhang comprise dinucleotides.

[0211] In some embodiments of the isolated oligonucleotides of the present disclosure, the 3' overhang comprises any one of thymidine-thymidine (dTdT), adenine-adenine (AA), cytosine-cytosine (CC), guanine-guanine (GG), or uracil-uracil (UU). In some embodiments of the isolated oligonucleotides of the present disclosure, the 3' overhang comprises a thymidine-thymidine (dTdT) or uracil-uracil (UU) overhang. In some embodiments, the 3' overhang comprises a uracil-uracil (UU) overhang. Without wishing to be bound by theory, it is believed that 3' overhangs (such as dinucleotide overhangs) enhance siRNA-mediated mRNA degradation by enhancing siRNA-RISC complex formation and / or enhancing the rate of cleavage of target mRNA by the siRNA-RISC complex.

[0212] In some embodiments, the isolated oligonucleotides of the present disclosure can have one or more blunt ends, where there is no overhang at the end of the duplex region and the strands base pair at the end of the duplex region. In some embodiments, the isolated oligonucleotides of the present disclosure can have one or more blunt ends, or can have one or more overhangs, or can have a combination of blunt ends and overhang ends. For example, the 5' end of the siRNA can be blunt and the 3' end of the same isolated oligonucleotide comprises an overhang, or vice versa.

[0213] In some embodiments, both ends of the isolated oligonucleotides of the present disclosure are blunt ends.

[0214] In some embodiments of the isolated oligonucleotides of the present disclosure, the double-stranded region comprises an antisense strand and a sense strand according to any of the antisense and sense strand sequences in Table 1, as described below.

[0215] Complement system

[0216] The complement system is a key component of the innate immune system and comprises a group of proteins that are normally present in an inactive state. These proteins are organized into three activation pathways: the classical pathway, the lectin pathway, and the alternative pathway.

[0217] Molecules from microorganisms, antibodies, or cellular components can activate these pathways, leading to the formation of protease complexes called C3 convertase and C5 convertase. The first enzymatically activated cascade, called the classical pathway, is a calcium / magnesium-dependent cascade that is typically activated by the formation of an antigen-antibody complex. It can also be activated in an antibody-independent manner by the binding of C-reactive protein complexed with a ligand and by many pathogens, including Gram-negative bacteria.

[0218] As described in US 8,703,136, the classical pathway comprises several components, C1, C4, C2, C3, and C5 (listed in the order in which they occur in the pathway). Initiation of the classical pathway of the complement system occurs after the first complement component (C1) is bound and activated by both immune and non-immune activators. C1 comprises a calcium-dependent complex of the components C1q, C1r, and C1s and is activated by the binding of the C1q component. C1q contains six identical subunits, and each subunit comprises three chains (A chain, B chain, and C chain). Each chain has a globular head region attached to a collagen-like tail. Binding and activation of C1q by the antigen-antibody complex occurs through the C1q head group region. Many non-antibody C1q activators, including proteins, lipids, and nucleic acids, bind and activate C1q through unique sites on the collagen-like stalk region. The C1qrs complex then catalyzes the activation of complement components C4 and C2 to form the C4b2a complex, which functions as a C3 convertase.

[0219] The second enzymatically activated cascade, called the alternative pathway, is a rapid, antibody-independent route of complement system activation and amplification. The alternative pathway is a magnesium-dependent cascade that is activated by the deposition and activation of C3 on certain susceptible surfaces (e.g., the cell wall polysaccharides of yeast and bacteria and certain biopolymeric materials). The alternative pathway includes several components, which include: C3, factor B, and factor D (listed in the order in which they occur in the pathway). Activation of the alternative pathway occurs when C3b (the proteolytic cleavage form of C3) binds to an activating surface such as a bacterium. Factor B then binds to C3b and is cleaved by factor D to produce the active enzyme Ba. The enzyme Ba then cleaves more C3 to produce more C3b, resulting in the extensive deposition of the C3b-Ba complex on the activating surface.

[0220] Thus, both the classical and alternative complement pathways produce C3 convertases that cleave factor C3 into C3a and C3b. At this point, both C3 convertases are also assembled into C5 convertases (C4b2a3b and C3b3bBb). These complexes then cleave complement component C5 into two components: the C5a polypeptide (9 kDa) and the C5b polypeptide (170 kDa). The C5a polypeptide binds to a 7-transmembrane G protein-coupled receptor that was initially associated with leukocytes and is now known to be expressed on a variety of tissues including hepatocytes and neurons. The C5a molecule is the major chemotactic component of the human complement system and can trigger a variety of biological responses, including leukocyte chemotaxis, smooth muscle contraction, activation of intracellular signal transduction pathways, neutrophil-endothelial adhesion, release of cytokines and lipid mediators, and formation of oxidants.

[0221] The larger C5b fragment sequentially binds to the later components C6, C7, C8, and C9 of the complement cascade to form the C5b-9 membrane attack complex (“MAC”). The lipophilic C5b-9 MAC can directly lyse red blood cells, and in larger amounts, it lyses white blood cells and damages tissues such as muscle, epithelial, and endothelial cells. In sublytic amounts, the C5b-9 MAC can stimulate upregulation of adhesion molecules, an increase in intracellular calcium, and cytokine release. Additionally, at sublytic concentrations, the C5b-9 MAC can stimulate cells such as endothelial cells and platelets without causing cell lysis. The non-lytic effects of C5a and C5b-9 MAC are comparable and interchangeable.

[0222] The lectin pathway is initiated when pattern recognition molecules (MBL, CL-K1, and ficolin) bind to so-called pathogen-associated molecular patterns (PAMPs) (D-mannose, N-acetyl-D-glucosamine, or acetyl groups) on the surface of pathogens or to apoptotic or necrotic cells (Beltrame et al., 2015).

[0223] Although the complement system has an important role in the maintenance of health, it has the potential to cause or contribute to disease.

[0224] There are four diseases for which complement-targeted drugs have been approved by the US Food and Drug Administration (FDA) and the European Medicines Agency for routine clinical use (Garred et al., 2021). In 2007, the mAb eculizumab (Soliris), which blocks C5 cleavage, was shown to be highly effective in preventing hemolysis in PNH (Brodsky et al., 2008; Parker, 2009), and this was subsequently the treatment for atypical hemolytic uremic syndrome (aHUS) (Tschumi et al., 2011; Loirat et al., 2016). More recently, it has also been approved for the neurological diseases generalized myasthenia gravis (Dhillon, 2018) and neuromyelitis optica spectrum disorder (Selmaj and Selmaj, 2019).

[0225] Eculizumab has been the only complement inhibitor approved for routine use until recently when ravulizumab (Ultomiris) and zilucoplan were introduced. Ravulizumab is a second-generation of eculizumab; in other words, some minor amino acid modifications were made in the eculizumab molecule, thus significantly increasing the half-life, and therefore the treatment interval can be increased from once every 2 weeks to once every 8 weeks. It has the same C5 binding site as eculizumab (i.e., blocks the cleavage of C5 and thus prevents the release of C5a and the formation of C5b-9) (Kulasekararaj et al., 2019; Lee et al., 2019; McKeage, 2019; Stern and Connell, 2019; Lee and Kulasekararaj, 2020).

[0226] Zilucoplan is a drug that is structurally completely different from the above antibodies but has the same main function. It is a synthetic macrocyclic peptide inhibitor for subcutaneous self-administration and has mainly the same function as eculizumab, blocking the cleavage of C5 (Beecher et al., 2019; Albazli et al., 2020; Howard et al., 2020). A phase 2 randomized, double-blind, placebo-controlled, multicenter clinical trial confirmed that in a broad population of patients with moderate to severe acetylcholine receptor antibody-positive generalized myasthenia gravis, zilucoplan administration produced rapid, meaningful, and sustained improvement within 12 weeks (Howard et al., 2020). A close analogue of zilucoplan (RA101495), RA 101295, has been used in animal studies and has been shown to increase survival in baboon Escherichia coli sepsis (Keshari et al., 2017).

[0227] Accordingly, the isolated oligonucleotides disclosed in the present disclosure can be used to treat or prevent diseases or disorders associated with abnormal or increased expression or activity of C3 or diseases or disorders in which C3 plays a role. Exemplary isolated oligonucleotides of the present disclosure are described in Table 1. In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence selected from the group consisting of the sense strand / passenger strand sequences listed in Tables 1, 2, and 3. In some embodiments, the antisense strand comprises a sequence selected from the group consisting of the antisense strand / guide strand sequences listed in Tables 1, 2, and 3. In some embodiments, the sense region and the antisense region comprise complementary sequences selected from the group listed in Tables 1, 2, and 3.

[0228] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2-31.

[0229] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 32-61.

[0230] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2-31; and the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 32-61, wherein the antisense strand and the sense strand sequences have sufficient complementarity to allow the formation of a double-stranded region between the antisense strand and the sense strand.

[0231] Sequences of the present disclosure

[0232] The present disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence that is substantially identical to the region between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.

[0233] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95% or at least 99% identical to a region of 19 - 25 nucleotides between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625.

[0234] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence identical to a region of 19 - 25 nucleotides between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625.

[0235] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence that is substantially identical to a region between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 1281 to 1301; b) 1797 to 1817; c) 2862 to 2882; d) 4402 to 4424; and e) 4520 to 4540.

[0236] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95% or at least 99% identical to a region between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 1281 to 1301; b) 1797 to 1817; c) 2862 to 2882; d) 4402 to 4424; and e) 4520 to 4540.

[0237] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence identical to a region of a sequence between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 1281 to 1301; b) 1797 to 1817; c) 2862 to 2882; d) 4402 to 4424; and e) 4520 to 4540.

[0238] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to a region of a sequence between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 1281 to 1301; b) 1797 to 1817; c) 2862 to 2882; d) 4402 to 4424; and e) 4520 to 4540, the double-stranded region comprises: i) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5’UGUGUGUUGAUGCUGAGUUUGG 3’), and a sense strand of the nucleic acid sequence according to SEQ ID NO: 40 (5’AAACUCAGCAUCAACACACA 3’); ii) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5’UCUAUCUUCAGGGUCAUCUGCU 3’), and a sense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5’CAGAUGACCCUGAAGAUAGA 3’); iii) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5’UUUUUGUUCAUUCUGAUUCCUU 3’), and a sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5’GGAAUCAGAAUGAACAAAAA 3’); iv) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5’UGAGUGUGAGACCUUGUCCAGG 3’), and a sense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5’UGGACAAGGUCUCACACUCA 3’); v) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5’UCAGAGUGUGAGACCUUGUCCA 3’), and a sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5’GACAAGGUCUCACACUCUGA 3’); or vi) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5’UGUAGAACCGGGUACAGCUUUC 3’), and a sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5’AAGCUGUACCCGGUUCUACA 3’).

[0239] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence substantially identical to a region comprising a sequence between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 772 to 801; b) 2424 to 2444; c) 3784 to 3805; d) 4123 to 4169; e) 4438 to 4509; and f) 4558 to 4621.

[0240] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95% or at least 99% identical to a region comprising a sequence between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 772 to 801; b) 2424 to 2444; c) 3784 to 3805; d) 4123 to 4169; e) 4438 to 4509; and f) 4558 to 4621.

[0241] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence identical to a region comprising a sequence between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 772 to 801; b) 2424 to 2444; c) 3784 to 3805; d) 4123 to 4169; e) 4438 to 4509; and f) 4558 to 4621.

[0242] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region comprising a sequence between any of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 772 to 801; b) 2424 to 2444; c) 3784 to 3805; d) 4123 to 4169; e) 4438 to 4509; and f) 4558 to 4621, and the double-stranded region comprises: i) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UUAGUAGAAUUUCUCUGUAGGC 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5'CUACAGAGAAAUUCUACUAA3'); ii) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UAUGUAGUAGAAUUUCUCUGUA 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'CAGAGAAAUUCUACUACAUA3'); iii) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UGAUGUAGUAGAAUUUCUCUGU 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5'AGAGAAAUUCUACUACAUCA3'); iv) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5'UUUAUAGAUGUAGUAGAAUUUC 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'AAUUCUACUACAUCUAUAAA3'); v) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UAAAAUAUAUUCAUGAGCUUCG 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5'AAGCUCAUGAAUAUAUUUUA3'); vi) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UAAGUCAAAGUCUUUUAGCUGC 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5'AGCUAAAAGACUUUGACUUA 3'); vii) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UAAAGUCAAAGUCUUUUAGCUG 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5'GCUAAAAGACUUUGACUUUA3');viii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:20 (5’UAAUUUAUUACAGGUGAGUUGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:50 (5’AACUCACCUGUAAUAAAUUA3’); ix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:21 (5’UCUGGUUUUAUGGUGACCUUGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:51 (5’AAGGUCACCAUAAAACCAGA3’); x) The antisense strand of the nucleic acid sequence according to SEQ ID NO:24 (5’UUAUUGGUGAACUUUGAAAGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:54 (5’CUUUCAAAGUUCACCAAUAA3’); xi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:25 (5’UUAAUAGGCGUAGACCUUGACU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:55 (5’UCAAGGUCUACGCCUAUUAA3’); xii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:28 (5’UCAGAGCUUGUUCAGCUUUCCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:58 (5’GAAAGCUGAACAAGCUCUGA3’); or xiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:30 (5’UUAUGAAGCAAUUCUCCUCAGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:60 (5’UGAGGAGAAUUGCUUCAUAA3’).;

[0243] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence substantially identical to a region of a sequence between any one of the following nucleotide positions starting from the 5’ end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 588 to 608; b) 773 to 800; c) 2533 to 2585; d) 3778 to 3836; e) 4492 to 4512; and f) 4600 to 4625.

[0244] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95% or at least 99% identical to a region comprising a sequence between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 588 to 608; b) 773 to 800; c) 2533 to 2585; d) 3778 to 3836; e) 4492 to 4512; and f) 4600 to 4625.

[0245] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence identical to a region comprising a sequence between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 588 to 608; b) 773 to 800; c) 2533 to 2585; d) 3778 to 3836; e) 4492 to 4512; and f) 4600 to 4625.

[0246] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region comprising a sequence between any of the following nucleotide positions starting from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1: a) 588 to 608; b) 773 to 800; c) 2533 to 2585; d) 3778 to 3836; e) 4492 to 4512; and f) 4600 to 4625, and the double-stranded region comprises: i) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5’UGAGAAGACAAGGAGUCCUGCU3’) and a sense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5’CAGGACUCCUUGUCUUCUCA3’); ii) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5’UGUAGUAGAAUUUCUCUGUAGG 3’) and a sense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5’UACAGAGAAAUUCUACUACA3’); iii) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5’UAUAGAUGUAGUAGAAUUUCUC 3’) and a sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5’GAAAUUCUACUACAUCUAUA3’); iv) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5’UUAUAGAUGUAGUAGAAUUUCU 3’) and a sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5’AAAUUCUACUACAUCUAUAA3’); v) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5’UAUGAAGAAGUCCUGCAUUACU 3’) and a sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5’UAAUGCAGGACUUCUUCAUA3’); vi) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5’UUUCGAACAACAGAGUAGGGUA3’) and a sense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5’CCCUACUCUGUUGUUCGAAA3’); vii) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5’UAAGUCUUUUAGCUGCAGUAGG 3’) and a sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5’UACUGCAGCUAAAAGACUUA3’);viii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:19 (5’UGUUCAUUGAGCCAACGCACGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:49 (5’GUGCGUUGGCUCAAUGAACA3’); ix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:26 (5’UUUGUAAUAGGCGUAGACCUUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:56 (5’AGGUCUACGCCUAUUACAAA3’); x) The antisense strand of the nucleic acid sequence according to SEQ ID NO:29 (5’UAUGAAGCAAUUCUCCUCAGCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:59 (5’CUGAGGAGAAUUGCUUCAUA3’); or xi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:31 (5’UUUUGUAUGAAGCAAUUCUCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:61 (5’GAGAAUUGCUUCAUACAAAA3’).;

[0247] Knock down C3 by at least 50% at 0.1 nM

[0248] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region of the sequence between any of the following nucleotide positions starting from the 5’ end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, wherein the isolated oligonucleotide reduces the expression of C3 mRNA by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95% or 95% to 99%, 99% to 100%) at a dose of 0.1 nM.

[0249] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region comprising a sequence between any of the following nucleotide positions starting from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide reduces the expression of C3 mRNA by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95% or 95% to 100%) at a dose of 0.1 nM, wherein the double-stranded region comprises: i) an antisense strand with a nucleic acid sequence according to SEQ ID NO: 9 (5’UUUAUAGAUGUAGUAGAAUUUC 3’) and a sense strand with a nucleic acid sequence according to SEQ ID NO: 39 (5’AAUUCUACUACAUCUAUAAA3’); ii) an antisense strand with a nucleic acid sequence according to SEQ ID NO: 5 (5’UAUGUAGUAGAAUUUCUCUGUA3’) and a sense strand with a nucleic acid sequence according to SEQ ID NO: 35 (5’CAGAGAAAUUCUACUACAUA3’); iii) an antisense strand with a nucleic acid sequence according to SEQ ID NO: 3 (5’UUAGUAGAAUUUCUCUGUAGGC 3’) and a sense strand with a nucleic acid sequence according to SEQ ID NO: 33 (5’CUACAGAGAAAUUCUACUAA3’); iv) an antisense strand with a nucleic acid sequence according to SEQ ID NO: 18 (5’UAAAGUCAAAGUCUUUUAGCUG 3’) and a sense strand with a nucleic acid sequence according to SEQ ID NO: 48 (5’GCUAAAAGACUUUGACUUUA3’); v) an antisense strand with a nucleic acid sequence according to SEQ ID NO: 4 (5’UGUAGUAGAAUUUCUCUGUAGG 3’) and a sense strand with a nucleic acid sequence according to SEQ ID NO: 34 (5’UACAGAGAAAUUCUACUACA3’);(vi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:26 (5’UUUGUAAUAGGCGUAGACCUUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:56 (5’AGGUCUACGCCUAUUACAAA3’); (vii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:25 (5’UUAAUAGGCGUAGACCUUGACU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:55 (5’UCAAGGUCUACGCCUAUUAA3’); (viii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:22 (5’UGAGUGUGAGACCUUGUCCAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:52 (5’UGGACAAGGUCUCACACUCA3’); (ix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:7 (5’UAUAGAUGUAGUAGAAUUUCUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:37 (5’GAAAUUCUACUACAUCUAUA 3’); (x) The antisense strand of the nucleic acid sequence according to SEQ ID NO:8 (5’UUAUAGAUGUAGUAGAAUUUCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:38 (5’AAAUUCUACUACAUCUAUAA3’); (xi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:23 (5’UCAGAGUGUGAGACCUUGUCCA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:53 (5’GACAAGGUCUCACACUCUGA3’); (xii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:6 (5’UGAUGUAGUAGAAUUUCUCUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:36 (5’AGAGAAAUUCUACUACAUCA3’); (xiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:17 (5’UAAGUCAAAGUCUUUUAGCUGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:47 (5’AGCUAAAAGACUUUGACUUA3’); (xiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:28 (5’UCAGAGCUUGUUCAGCUUUCCA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:58 (5’GAAAGCUGAACAAGCUCUGA3’);xv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:10 (5’UGUGUGUUGAUGCUGAGUUUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:40 (5’AAACUCAGCAUCAACACACA3’); xvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:2 (5’UGAGAAGACAAGGAGUCCUGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:32 (5’CAGGACUCCUUGUCUUCUCA3’); xvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:12 (5’UAAAAUAUAUUCAUGAGCUUCG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:42 (5’AAGCUCAUGAAUAUAUUUUA3’); xviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:30 (5’UUAUGAAGCAAUUCUCCUCAGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:60 (5’UGAGGAGAAUUGCUUCAUAA3’); xix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:29 (5’UAUGAAGCAAUUCUCCUCAGCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:59 (5’CUGAGGAGAAUUGCUUCAUA3’); xx) The antisense strand of the nucleic acid sequence according to SEQ ID NO:13 (5’UAUGAAGAAGUCCUGCAUUACU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:43 (5’UAAUGCAGGACUUCUUCAUA3’); xxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:14 (5’UUUCGAACAACAGAGUAGGGUA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:44 (5’CCCUACUCUGUUGUUCGAAA3’); xxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:19 (5’UGUUCAUUGAGCCAACGCACGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:49 (5’GUGCGUUGGCUCAAUGAACA3’); xxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:20 (5’UAAUUUAUUACAGGUGAGUUGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:50 (5’AACUCACCUGUAAUAAAUUA3’);(xxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:15 (5’UUUUUGUUCAUUCUGAUUCCUU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:45 (5’GGAAUCAGAAUGAACAAAAA3’); (xxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:21 (5’UCUGGUUUUAUGGUGACCUUGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:51 (5’AAGGUCACCAUAAAACCAGA3’); (xxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:31 (5’UUUUGUAUGAAGCAAUUCUCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:61 (5’GAGAAUUGCUUCAUACAAAA3’); (xxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:11 (5’UCUAUCUUCAGGGUCAUCUGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:41 (5’CAGAUGACCCUGAAGAUAGA3’); (xxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:16 (5’UAAGUCUUUUAGCUGCAGUAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:46 (5’UACUGCAGCUAAAAGACUUA3’); (xxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:24 (5’UUAUUGGUGAACUUUGAAAGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:54 (5’CUUUCAAAGUUCACCAAUAA3’); or (xxx) The antisense strand of the nucleic acid sequence according to SEQ ID NO:27 (5’UGUAGAACCGGGUACAGCUUUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:57 (5’AAGCUGUACCCGGUUCUACA3’).;

[0250] Knock down C3 by 20%-50% at 0.1 nM

[0251] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region comprising a sequence between any of the following nucleotide positions starting from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, wherein the isolated oligonucleotide attenuates the expression of C3 mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%) at a dose of 0.1 nM.

[0252] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region comprising a sequence between any of the following nucleotide positions starting from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide is at 0.A dose of 1 nM attenuates the expression of C3 mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%), wherein the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5’UCUAUCUUCAGGGUCAUCUGCU 3’) and the sense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5’CAGAUGACCCUGAAGAUAGA3’); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5’UUAUUGGUGAACUUUGAAAGCU 3’) and the sense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5’CUUUCAAAGUUCACCAAUAA 3’); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5’UUUUGUAUGAAGCAAUUCUCCU 3’) and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5’GAGAAUUGCUUCAUACAAAA3’); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5’UAAGUCUUUUAGCUGCAGUAGG 3’) and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5’UACUGCAGCUAAAAGACUUA3’); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5’UAAAAUAUAUUCAUGAGCUUCG 3’) and the sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5’AAGCUCAUGAAUAUAUUUUA3’); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5’UUUUUGUUCAUUCUGAUUCCUU 3’) and the sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5’GGAAUCAGAAUGAACAAAAA3’); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5’UAUGAAGAAGUCCUGCAUUACU 3’) and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5’UAAUGCAGGACUUCUUCAUA3’); or viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5’UGUGUGUUGAUGCUGAGUUUGG 3’) and the sense strand of the nucleic acid sequence according to SEQ ID NO: 40 (5’AAACUCAGCAUCAACACACA3’).

[0253] A dose of 0.01 nM knocks down C3 by at least 50%

[0254] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region comprising a sequence between any of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, wherein the isolated oligonucleotide attenuates the expression of C3 mRNA by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95% or 95% to 99%, 99% to 100%) at a dose of 0.01 nM.

[0255] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region comprising a sequence between any of the following nucleotide positions starting from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide reduces the expression of C3 mRNA by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95% or 95% to 100%) at a dose of 0.01 nM, wherein the double-stranded region comprises: i) an antisense strand with a nucleic acid sequence according to SEQ ID NO: 3 (5'UUAGUAGAAUUUCUCUGUAGGC 3') and a sense strand with a nucleic acid sequence according to SEQ ID NO: 33 (5'CUACAGAGAAAUUCUACUAA3'); ii) an antisense strand with a nucleic acid sequence according to SEQ ID NO: 29 (5'UAUGAAGCAAUUCUCCUCAGCA3') and a sense strand with a nucleic acid sequence according to SEQ ID NO: 59 (5'CUGAGGAGAAUUGCUUCAUA3'); iii) an antisense strand with a nucleic acid sequence according to SEQ ID NO: 25 (5'UUAAUAGGCGUAGACCUUGACU 3') and a sense strand with a nucleic acid sequence according to SEQ ID NO: 55 (5'UCAAGGUCUACGCCUAUUAA3'); iv) an antisense strand with a nucleic acid sequence according to SEQ ID NO: 9 (5'UUUAUAGAUGUAGUAGAAUUUC 3') and a sense strand with a nucleic acid sequence according to SEQ ID NO: 39 (5'AAUUCUACUACAUCUAUAAA3'); v) an antisense strand with a nucleic acid sequence according to SEQ ID NO: 8 (5'UUAUAGAUGUAGUAGAAUUUCU 3') and a sense strand with a nucleic acid sequence according to SEQ ID NO: 38 (5'AAAUUCUACUACAUCUAUAA3');(vi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:26 (5’UUUGUAAUAGGCGUAGACCUUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:56 (5’AGGUCUACGCCUAUUACAAA3’); (vii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:5 (5’UAUGUAGUAGAAUUUCUCUGUA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:35 (5’CAGAGAAAUUCUACUACAUA3’); (viii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:17 (5’UAAGUCAAAGUCUUUUAGCUGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:47 (5’AGCUAAAAGACUUUGACUUA3’); (ix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:7 (5’UAUAGAUGUAGUAGAAUUUCUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:37 (5’GAAAUUCUACUACAUCUAUA3’); (x) The antisense strand of the nucleic acid sequence according to SEQ ID NO:18 (5’UAAAGUCAAAGUCUUUUAGCUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:48 (5’GCUAAAAGACUUUGACUUUA3’); (xi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:4 (5’UGUAGUAGAAUUUCUCUGUAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:34 (5’UACAGAGAAAUUCUACUACA3’); (xii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:28 (5’UCAGAGCUUGUUCAGCUUUCCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:58 (5’GAAAGCUGAACAAGCUCUGA3’); (xiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:22 (5’UGAGUGUGAGACCUUGUCCAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:52 (5’UGGACAAGGUCUCACACUCA3’); (xiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:14 (5’UUUCGAACAACAGAGUAGGGUA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:44 (5’CCCUACUCUGUUGUUCGAAA 3’);xv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5’UCAGAGUGUGAGACCUUGUCCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5’GACAAGGUCUCACACUCUGA3’); xvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5’UGAUGUAGUAGAAUUUCUCUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5’AGAGAAAUUCUACUACAUCA3’); xvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5’UGUUCAUUGAGCCAACGCACGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5’GUGCGUUGGCUCAAUGAACA3’); xviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5’UAAUUUAUUACAGGUGAGUUGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5’AACUCACCUGUAAUAAAUUA3’); xix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5’UUAUGAAGCAAUUCUCCUCAGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5’UGAGGAGAAUUGCUUCAUAA3’); xx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5’UGAGAAGACAAGGAGUCCUGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5’CAGGACUCCUUGUCUUCUCA3’); xxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5’UGUAGAACCGGGUACAGCUUUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5’AAGCUGUACCCGGUUCUACA3’); or xxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5’UCUGGUUUUAUGGUGACCUUGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5’AAGGUCACCAUAAAACCAGA3’).;

[0256] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region of 19 - 25 nucleotides between any of the following nucleotide positions starting from the 5' end of the C3 mRNA sequence according to SEQ ID NO:1: a) 33 to 53; b) 237 to 260; c) 444 to 480; d) 583 to 879; e) 1118 to 1328; f) 1409 to 1542; g) 1619 to 1648; h) 1754 to 1816; i) 2232 to 2256; j) 2300 to 2368; k) 2423 to 2452; l) 2518 to 2726; m) 2860 to 2883; n) 2981 to 3043; o) 3125 to 3239; p) 3298 to 3437; q) 3567 to 3638; r) 3767 to 3913; s) 3985 to 4430; and t) 4490 to 5054, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.

[0257] In some embodiments of the isolated oligonucleotides comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19 - 25 nucleotides between any of the following nucleotide positions starting from the 5' end of the C3 mRNA sequence according to SEQ ID NO:1: a) 33 to 53; b) 237 to 260; c) 444 to 480; d) 583 to 879; e) 1118 to 1328; f) 1409 to 1542; g) 1619 to 1648; h) 1754 to 1816; i) 2232 to 2256; j) 2300 to 2368; k) 2423 to 2452; l) 2518 to 2726; m) 2860 to 2883; n) 2981 to 3043; o) 3125 to 3239; p) 3298 to 3437; q) 3567 to 3638; r) 3767 to 3913; s) 3985 to 4430; and t) 4490 to 5054, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide reduces the expression of C3 mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45% or 45% to 50%) at a dose of 0.1 nM.

[0258] In some embodiments of the isolated oligonucleotides comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19 - 25 nucleotides between any of the following nucleotide positions starting from the 5' end of the C3 mRNA sequence according to SEQ ID NO:1: a) 33 to 53; b) 237 to 260; c) 444 to 480; d) 583 to 879; e) 1118 to 1328; f) 1409 to 1542; g) 1619 to 1648; h) 1754 to 1816; i) 2232 to 2256; j) 2300 to 2368; k) 2423 to 2452; l) 2518 to 2726; m) 2860 to 2883; n) 2981 to 3043; o) 3125 to 3239; p) 3298 to 3437; q) 3567 to 3638; r) 3767 to 3913; s) 3985 to 4430; and t) 4490 to 5054, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide reduces the expression of C3 mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45% or 45% to 50%) at a dose of 0.1 nM, wherein the double-stranded region comprises: i) an antisense strand with the nucleic acid sequence according to SEQ ID NO:71 (5’UGUAGAUGGUCUUGUCUGUCUG 3’), and a sense strand with the nucleic acid sequence according to SEQ ID NO:236 (5’GACAGACAAGACCAUCUACA 3’); ii) an antisense strand with the nucleic acid sequence according to SEQ ID NO:106 (5’UUGAUGCUCAAGGGCUUCUGGC 3’), and a sense strand with the nucleic acid sequence according to SEQ ID NO:271 (5’CAGAAGCCCUUGAGCAUCAA3’); iii) an antisense strand with the nucleic acid sequence according to SEQ ID NO:97 (5’UAAGAUGACAAAGGCAGUUCCC 3’), and a sense strand with the nucleic acid sequence according to SEQ ID NO:262 (5’GAACUGCCUUUGUCAUCUUA3’); iv) an antisense strand with the nucleic acid sequence according to SEQ ID NO:168 (5’UCAAAGUCAAAGUCUUUUAGCU 3’), and a sense strand with the nucleic acid sequence according to SEQ ID NO:333 (5’CUAAAAGACUUUGACUUUGA3’);v) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 115 (5’UGAAGGAAGGGAUGAAGUCGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 280 (5’CGACUUCAUCCCUUCCUUCA3’); vi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 173 (5’UCUUUUGGUAUUGAGCCAAGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 338 (5’CUUGGCUCAAUACCAAAAGA3’); vii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 116 (5’UUUCUGACUGGCCGCUUUUUAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 281 (5’AAAAAGCGGCCAGUCAGAAA3’); viii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 169 (5’UCACAAAGUCAAAGUCUUUUAG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 334 (5’AAAAGACUUUGACUUUGUGA3’); ix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5’UGUUUUUUGCCUGGGAAGUCGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 231 (5’GACUUCCCAGGCAAAAAACA 3’); x) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 153 (5’UUGAAGGCCAGCUGCUGGGUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 318 (5’ACCCAGCAGCUGGCCUUCAA3’); xi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 189 (5’UCUGUUUCCGGUGCUGGUUUUA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 354 (5’AAACCAGCACCGGAAACAGA3’); xii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 103 (5’UUGUUGAUGCUGAGUUUGGCCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 268 (5’GCCAAACUCAGCAUCAACAA3’); xiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 225 (5’UGUCCAACCUGCACCUCAUCCG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 390 (5’GAUGAGGUGCAGGUUGGACA3’);xiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 117 (5’UAUCUUCAGGGUCAUCUGCUGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 282 (5’AGCAGAUGACCCUGAAGAUA3’); xv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5’UCAUAGUAGGCUCGGAUCUUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 246 (5’AAGAUCCGAGCCUACUAUGA3’); xvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 133 (5’UGUUUCGAACAACAGAGUAGGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 298 (5’CUACUCUGUUGUUCGAAACA3’); xvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 107 (5’UCAGGUAAUUGUUGGAGUUGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 272 (5’CAACUCCAACAAUUACCUGA3’); xviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5’UGUCUGUCUGGAUGAAGAGGUA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 233 (5’CCUCUUCAUCCAGACAGACA3’); xix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 222 (5’UGUACUCGUCAAAGUCAUUGGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 387 (5’CAAUGACUUUGACGAGUACA3’); xx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 139 (5’UGGAUUGUGGAGUAGUUCCACC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 304 (5’UGGAACUACUCCACAAUCCA3’); xxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 158 (5’UGGAAGUCUCCUGCUUUAGUGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 323 (5’ACUAAAGCAGGAGACUUCCA3’); xxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 83 (5’UUUUCAUAGUAGGCUCGGAUCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 248 (5’AUCCGAGCCUACUAUGAAAA3’);(xxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 156 (5’UCAGGAUCAGCCAUUUAACAGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 321 (5’UGUUAAAUGGCUGAUCCUGA3’); (xxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 208 (5’UCUUGUCCAGGUAGAUGAUGAG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5’CAUCAUCUACCUGGACAAGA 3’); (xxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5’UGACAGUGCAGGGUCAGAGGGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 227 (5’CCUCUGACCCUGCACUGUCA3’); (xxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 202 (5’UCUAUCGGAGAAGGCUUUGUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 367 (5’ACAAAGCCUUCUCCGAUAGA3’); (xxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 80 (5’UCUUCCACUGGCCCAUGUUGAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 245 (5’CAACAUGGGCCAGUGGAAGA3’); (xxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 174 (5’UGAUUCCCAGUGGAUACGGUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 339 (5’ACCGUAUCCACUGGGAAUCA 3’); (xxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5’UUUUUUUGCCUGGGAAGUCGUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 230 (5’CGACUUCCCAGGCAAAAAAA3’); (xxx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 214 (5’UGGUUGUAAUAGGCGUAGACCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5’GUCUACGCCUAUUACAACCA3’); (xxxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 141 (5’UCUGCAGAAGGCUGGAUUGUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 306 (5’ACAAUCCAGCCUUCUGCAGA 3’);(xxxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 91 (5’UCUCUGUAGGCUCCACUAUGAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 256 (5’CAUAGUGGAGCCUACAGAGA3’); (xxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 88 (5’UGAAACUGGGCAGCACGUACUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 253 (5’GUACGUGCUGCCCAGUUUCA3’); (xxxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 165 (5’UCUGCAGUAGGGCCAAGAGGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 330 (5’CCUCUUGGCCCUACUGCAGA 3’); (xxxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 140 (5’UCUGGAUUGUGGAGUAGUUCCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 305 (5’GAACUACUCCACAAUCCAGA3’); (xxxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 183 (5’UCUUUUCCUUCAGCUGUGACUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 348 (5’GUCACAGCUGAAGGAAAAGA3’); (xxxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 179 (5’UCUGUGAAACCCUCAUUUUCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 344 (5’GAAAAUGAGGGUUUCACAGA3’); (xxxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 127 (5’UCAUUACUGUGACCUCGAAGGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 292 (5’CUUCGAGGUCACAGUAAUGA3’); (xxxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 185 (5’UGAGGUCGAAUUUAUUACAGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 350 (5’CUGUAAUAAAUUCGACCUCA3’);xL) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 111 (5’UCAUUCGCAGGAGGAAGUUGAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 276 (5’CAACUUCCUCCUGCGAAUGA3’); xLi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 157 (5’UGUAUCACGGGCGCAUCCUCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 322 (5’GAGGAUGCGCCCGUGAUACA 3’); xLii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 164 (5’UCAGCAAUGGCCACAGUGUAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 329 (5’UACACUGUGGCCAUUGCUGA3’); xLiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5’UCACUAUGACCUCGAAACUGGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 255 (5’CAGUUUCGAGGUCAUAGUGA 3’); xLiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 87 (5’UGUACUCCUUCACCUCAAACUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 252 (5’GUUUGAGGUGAAGGAGUACA3’); xLv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 199 (5’UCUCAUACUUGGAGAUGUAUCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 364 (5’AUACAUCUCCAAGUAUGAGA3’); xLvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 184 (5’UCUUAGCAUGGUACAUUGUCAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 349 (5’GACAAUGUACCAUGCUAAGA3’); xLvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 400 (5’UUGUAGUUGCAGCAGUCCAGGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 426 (5’CUGGACUGCUGCAACUACAA 3’); xLiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5’UGAGGAAGUUGACGUUGAGGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 275 (5’CCUCAACGUCAACUUCCUCA3’);xLix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 147 (5’UGGCAUCCUCUGUCAUCUGGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 312 (5’CCAGAUGACAGAGGAUGCCA3’); L) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 218 (5’UUUUUGUAUGAAGCAAUUCUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 383 (5’AGAAUUGCUUCAUACAAAAA3’); Li) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 138 (5’UGAUUGUGGAGUAGUUCCACCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 303 (5’GUGGAACUACUCCACAAUCA3’); Lii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 114 (5’UGAUGAAGUCGGUGGUGAUGGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 279 (5’CAUCACCACCGACUUCAUCA3’); Liii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 85 (5’UCUCCUUCACCUCAAACUCAGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 250 (5’UGAGUUUGAGGUGAAGGAGA3’); Liv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 152 (5’UCUUCUUGAUGAGCUCCAAGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 317 (5’CUUGGAGCUCAUCAAGAAGA3’); Lv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 402 (5’UCUCAUCCAGGUUACUCCUGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 428 (5’CAGGAGUAACCUGGAUGAGA3’); Lvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 136 (5’UCUUGGUUCUGCCGGUAAUUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 301 (5’AAUUACCGGCAGAACCAAGA 3’); Lvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 209 (5’UGACCUUGUCCAGGUAGAUGAU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 374 (5’CAUCUACCUGGACAAGGUCA3’);Or Lviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 412 (5’UCUCUGGGAACUCACUUCGGGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 438 (5’CCGAAGUGAGUUCCCAGAGA3’).;

[0259] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19 - 25 nucleotides between any of the following nucleotide positions starting from the 5’ end of the C3 mRNA sequence according to SEQ ID NO: 1: a) 33 to 53; b) 237 to 260; c) 444 to 480; d) 583 to 879; e) 1118 to 1328; f) 1409 to 1542; g) 1619 to 1648; h) 1754 to 1816; i) 2232 to 2256; j) 2300 to 2368; k) 2423 to 2452; l) 2518 to 2726; m) 2860 to 2883; n) 2981 to 3043; o) 3125 to 3239; p) 3298 to 3437; q) 3567 to 3638; r) 3767 to 3913; s) 3985 to 4430; and t) 4490 to 5054, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates the expression of C3 mRNA by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95% or 95% to 100%) at a dose of 0.1 nM.

[0260] In some embodiments of the isolated oligonucleotides comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19 - 25 nucleotides between any of the following nucleotide positions starting from the 5'-end of the C3 mRNA sequence according to SEQ ID NO:1: a) 33 to 53; b) 237 to 260; c) 444 to 480; d) 583 to 879; e) 1118 to 1328; f) 1409 to 1542; g) 1619 to 1648; h) 1754 to 1816; i) 2232 to 2256; j) 2300 to 2368; k) 2423 to 2452; l) 2518 to 2726; m) 2860 to 2883; n) 2981 to 3043; o) 3125 to 3239; p) 3298 to 3437; q) 3567 to 3638; r) 3767 to 3913; s) 3985 to 4430; and t) 4490 to 5054, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide reduces the expression of C3 mRNA by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95% or 95% to 100%) at a dose of 0.1 nM, wherein the double-stranded region comprises: i) an antisense strand with the nucleic acid sequence according to SEQ ID NO:94 (5’UUAGAUGUAGUAGAAUUUCUCU 3’) and a sense strand with the nucleic acid sequence according to SEQ ID NO:259 (5’AGAAAUUCUACUACAUCUAA3’); ii) an antisense strand with the nucleic acid sequence according to SEQ ID NO:74 (5’UGACAAGGAGUCCUGCUUGACC 3’) and a sense strand with the nucleic acid sequence according to SEQ ID NO:239 (5’UCAAGCAGGACUCCUUGUCA3’); iii) an antisense strand with the nucleic acid sequence according to SEQ ID NO:70 (5’UUAGAUGGUCUUGUCUGUCUGG 3’) and a sense strand with the nucleic acid sequence according to SEQ ID NO:235 (5’AGACAGACAAGACCAUCUAA3’); iv) an antisense strand with the nucleic acid sequence according to SEQ ID NO:64 (5’UUUUUUGCCUGGGAAGUCGUGG 3’) and a sense strand with the nucleic acid sequence according to SEQ ID NO:229 (5’ACGACUUCCCAGGCAAAAAA3’);v) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 172 (5’UUAGUAUCUCUGUUCAUUGAGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 337 (5’UCAAUGAACAGAGAUACUAA3’); vi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 226 (5’UGUCAGUUGGGGCACCCAAAGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 391 (5’UUUGGGUGCCCCAACUGACA3’); vii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 217 (5’UUUGUAUGAAGCAAUUCUCCUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5’GGAGAAUUGCUUCAUACAAA3’); viii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 131 (5’UGAACAACAGAGUAGGGUAGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 296 (5’CUACCCUACUCUGUUGUUCA 3’); ix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 (5’UAUCAGGUAGGUGUAGUAGCGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 278 (5’GCUACUACACCUACCUGAUA3’); x) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 (5’UAUUACUGUGACCUCGAAGGGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 291 (5’CCUUCGAGGUCACAGUAAUA3’); xi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 146 (5’UGAAUUCUGGUCUCAGACUCGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 311 (5’GAGUCUGAGACCAGAAUUCA3’); xii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 170 (5’UGUAUCUCUGUUCAUUGAGCCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 335 (5’GCUCAAUGAACAGAGAUACA3’); xiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 123 (5’UUUUCAAAAAUAUAUUCAUGAG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 288 (5’CAUGAAUAUAUUUUUGAAAA3’);(xiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:93 (5’UAGUAGAAUUUCUCUGUAGGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:258 (5’CCUACAGAGAAAUUCUACUA3’); (xv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:124 (5’UCUUUCAAAAAUAUAUUCAUGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:289 (5’AUGAAUAUAUUUUUGAAAGA3’); (xvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:198 (5’UCAUACUUGGAGAUGUAUCUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:363 (5’AGAUACAUCUCCAAGUAUGA3’); (xvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:145 (5’UAAUUCUGGUCUCAGACUCGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:310 (5’CGAGUCUGAGACCAGAAUUA3’); (xviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:188 (5’UGUUUUAUGGUGACCUUGAGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:353 (5’CUCAAGGUCACCAUAAAACA3’); (xix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:67 (5’UCUGUCUGGAUGAAGAGGUACC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:232 (5’UACCUCUUCAUCCAGACAGA3’); (xx) The antisense strand of the nucleic acid sequence according to SEQ ID NO:72 (5’UUGUAGAUGGUCUUGUCUGUCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:237 (5’ACAGACAAGACCAUCUACAA3’); (xxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:159 (5’UAAGGAAGUCUCCUGCUUUAGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:324 (5’UAAAGCAGGAGACUUCCUUA3’); (xxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:181 (5’UUUCCUUCAGCUGUGACUGUGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:346 (5’ACAGUCACAGCUGAAGGAAA3’);(xxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 108 (5’UGAGAUGCAGGUAAUUGUUGGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 273 (5’CAACAAUUACCUGCAUCUCA3’); (xxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 96 (5’UAGAUGACAAAGGCAGUUCCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 261 (5’GGAACUGCCUUUGUCAUCUA3’); (xxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 129 (5’UGAAGAAGUCCUGCAUUACUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 294 (5’AGUAAUGCAGGACUUCUUCA3’); (xxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 196 (5’UUACUUGGAGAUGUAUCUGUCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 361 (5’ACAGAUACAUCUCCAAGUAA3’); (xxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 122 (5’UUUCAAAAAUAUAUUCAUGAGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 287 (5’UCAUGAAUAUAUUUUUGAAA3’); (xxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 160 (5’UUUCAUGUAGUUGGCUUCAAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 325 (5’UUGAAGCCAACUACAUGAAA3’); (xxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 162 (5’UAUCUCUGUAGGUUCAUGUAGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 327 (5’UACAUGAACCUACAGAGAUA3’); (xxx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 104 (5’UGUGUUGAUGCUGAGUUUGGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 269 (5’CCAAACUCAGCAUCAACACA3’); (xxxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 201 (5’UCUUUGUCCAGCUCAUACUUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 366 (5’AAGUAUGAGCUGGACAAAGA3’);(xxxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5’UUUUUGCCUGGGAAGUCGUGGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 228 (5’CACGACUUCCCAGGCAAAAA3’); (xxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 178 (5’UCAUUUUCCUUGGUCUCUUCUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 343 (5’GAAGAGACCAAGGAAAAUGA 3’); (xxxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 203 (5’UUUCCUAUCGGAGAAGGCUUUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 368 (5’AAGCCUUCUCCGAUAGGAAA3’); (xxxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 216 (5’UGAAGCAAUUCUCCUCAGCACA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5’UGCUGAGGAGAAUUGCUUCA 3’); (xxxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 220 (5’UGUACACAUAGUCCACUCCUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5’AGGAGUGGACUAUGUGUACA3’); (xxxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 118 (5’UUAUCUUCAGGGUCAUCUGCUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 283 (5’GCAGAUGACCCUGAAGAUAA3’); (xxxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 194 (5’UUAGACAUAGUGGCAUCCUGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 359 (5’CAGGAUGCCACUAUGUCUAA3’); (xxxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 219 (5’UUACACAUAGUCCACUCCUGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5’CAGGAGUGGACUAUGUGUAA3’);xL) The antisense strand of the nucleic acid sequence according to SEQ ID NO:99 (5’UGUCUUGGUGAAGUGGAUCUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:264 (5’AGAUCCACUUCACCAAGACA3’); xLi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:154 (5’UAAGACCUUGACCACGUAGGCG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:319 (5’CCUACGUGGUCAAGGUCUUA3’); xLii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:171 (5’UAGUAUCUCUGUUCAUUGAGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:336 (5’CUCAAUGAACAGAGAUACUA3’); xLiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:195 (5’UCAGUCAUCAUGGAUAUGUCCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:360 (5’GACAUAUCCAUGAUGACUGA3’); xLiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:73 (5’UGUGUAGAUGGUCUUGUCUGUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:238 (5’CAGACAAGACCAUCUACACA3’); xLv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:180 (5’UUUCAGCUGUGACUGUGAAACC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:345 (5’UUUCACAGUCACAGCUGAAA3’); xLvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:92 (5’UUUCUCUGUAGGCUCCACUAUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:257 (5’UAGUGGAGCCUACAGAGAAA3’); xLvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:75 (5’UAAGACAAGGAGUCCUGCUUGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:240 (5’AAGCAGGACUCCUUGUCUUA3’); xLviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:137 (5’UGUAGUUCCACCCUCACCUUGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:302 (5’AAGGUGAGGGUGGAACUACA3’);xLix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:89 (5’UCUAUGACCUCGAAACUGGGCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:254 (5’CCCAGUUUCGAGGUCAUAGA3’); L) The antisense strand of the nucleic acid sequence according to SEQ ID NO:130 (5’UGAUGAAGAAGUCCUGCAUUAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:295 (5’AAUGCAGGACUUCUUCAUCA3’); Li) The antisense strand of the nucleic acid sequence according to SEQ ID NO:69 (5’UUUGUCUGUCUGGAUGAAGAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:234 (5’UCUUCAUCCAGACAGACAAA3’); Lii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:176 (5’UUUUUCCUUGGUCUCUUCUGAU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:341 (5’CAGAAGAGACCAAGGAAAAA3’); Liii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:100 (5’UGAGGUCAAAGGGCAUUCCUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:265 (5’AGGAAUGCCCUUUGACCUCA3’); Liv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:82 (5’UUUCAUAGUAGGCUCGGAUCUU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:247 (5’GAUCCGAGCCUACUAUGAAA3’); Lv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:212 (5’UGUAAUAGGCGUAGACCUUGAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:377 (5’CAAGGUCUACGCCUAUUACA3’); Lvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:191 (5’UAUCAUAGUGUUCUUGGCAUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:356 (5’AUGCCAAGAACACUAUGAUA3’); Lvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:161 (5’UUGUAGGUUCAUGUAGUUGGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:326 (5’CCAACUACAUGAACCUACAA3’);(Lviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 112 (5’UGUGUAGUAGCGGAUCUUGGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 277 (5’CCAAGAUCCGCUACUACACA3’); (Lix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 151 (5’UUUCUUGAUGAGCUCCAAGGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 316 (5’CCUUGGAGCUCAUCAAGAAA3’); (Lx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 213 (5’UGUUGUAAUAGGCGUAGACCUU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 378 (5’GGUCUACGCCUAUUACAACA3’); (Lxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 206 (5’UGAUGAUGAGGGUGUUCCUAUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5’UAGGAACACCCUCAUCAUCA3’); (Lxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 155 (5’UGAGAGAAGACCUUGACCACGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 320 (5’GUGGUCAAGGUCUUCUCUCA 3’); (Lxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 143 (5’UUUGUUCAUUCUGAUUCCUUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 308 (5’AAGGAAUCAGAAUGAACAAA 3’); (Lxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 193 (5’UCAAGGAUCAUAGUGUUCUUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 358 (5’AAGAACACUAUGAUCCUUGA3’); (Lxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 163 (5’UCAGUGUAGGAUCUCUGUAGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 328 (5’CUACAGAGAUCCUACACUGA3’); (Lxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 149 (5’UUUCAUCCAGGUAAUGCACAGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 314 (5’UGUGCAUUACCUGGAUGAAA 3’);(Lxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 200 (5’UUUUGUCCAGCUCAUACUUGGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 365 (5’CAAGUAUGAGCUGGACAAAA3’); (Lxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 210 (5’UCUCAGAGUGUGAGACCUUGUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5’CAAGGUCUCACACUCUGAGA3’); (Lxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 215 (5’UUGUUCAGCUUUCCAUCCUCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 380 (5’GAGGAUGGAAAGCUGAACAA3’); (Lxx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 98 (5’UCUUGGUGAAGUGGAUCUGGUA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 263 (5’CCAGAUCCACUUCACCAAGA3’); (Lxxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 182 (5’UUUUUCCUUCAGCUGUGACUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 347 (5’AGUCACAGCUGAAGGAAAAA3’); (Lxxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 150 (5’UGUUUCAUCCAGGUAAUGCACA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 315 (5’UGCAUUACCUGGAUGAAACA3’); (Lxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 223 (5’UAUGAUGUACUCGUCAAAGUCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 388 (5’ACUUUGACGAGUACAUCAUA3’); (Lxxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 177 (5’UAUUUUCCUUGGUCUCUUCUGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 342 (5’AGAAGAGACCAAGGAAAAUA3’); (Lxxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 128 (5’UGAAGUCCUGCAUUACUGUGAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 293 (5’CACAGUAAUGCAGGACUUCA3’);The antisense strand of the nucleic acid sequence according to SEQ ID NO: 224 (5’UCUCAUCCGAGCCUGACUUGAU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 389 (5’CAAGUCAGGCUCGGAUGAGA3’); Lxxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 205 (5’UAUGAUGAGGGUGUUCCUAUCG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 370 (5’AUAGGAACACCCUCAUCAUA3’); Lxxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 186 (5’UUUUAUGGUGACCUUGAGGUCG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 351 (5’ACCUCAAGGUCACCAUAAAA3’); Lxxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 77 (5’UGACGAGUUCCGGAAUGUCCCA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 242 (5’GGACAUUCCGGAACUCGUCA3’); Lxxx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 197 (5’UAUACUUGGAGAUGUAUCUGUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 362 (5’CAGAUACAUCUCCAAGUAUA3’); Lxxxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5’UGUUAUAGAUGUAGUAGAAUUU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 260 (5’AUUCUACUACAUCUAUAACA3’); Lxxxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 78 (5’UUUGACGAGUUCCGGAAUGUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 243 (5’ACAUUCCGGAACUCGUCAAA3’); Lxxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 101 (5’UAACACCAUGAGGUCAAAGGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 266 (5’CCUUUGACCUCAUGGUGUUA3’);Lxxxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:79 (5’UGUUGACGAGUUCCGGAAUGUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:244 (5’CAUUCCGGAACUCGUCAACA3’); Lxxxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:221 (5’UGUCUUGUACACAUAGUCCACU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:386 (5’UGGACUAUGUGUACAAGACA3’); Lxxxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:167 (5’UGUCUUUUAGCUGCAGUAGGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:332 (5’CCUACUGCAGCUAAAAGACA3’); Lxxxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:84 (5’UCAAACUCAGUGGAGAAGACCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:249 (5’GUCUUCUCCACUGAGUUUGA3’); Lxxxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:144 (5’UGUUUUGUUCAUUCUGAUUCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:309 (5’GAAUCAGAAUGAACAAAACA3’); Lxxxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:166 (5’UUCUUUUAGCUGCAGUAGGGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:331 (5’CCCUACUGCAGCUAAAAGAA3’); xc) The antisense strand of the nucleic acid sequence according to SEQ ID NO:76 (5’UUUCUGAGAAGACAAGGAGUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:241 (5’ACUCCUUGUCUUCUCAGAAA3’); xci) The antisense strand of the nucleic acid sequence according to SEQ ID NO:204 (5’UGUGUUCCUAUCGGAGAAGGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:369 (5’CCUUCUCCGAUAGGAACACA3’);xcii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 211 (5’UCAUCCUCAGAGUGUGAGACCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 376 (5’GUCUCACACUCUGAGGAUGA 3’); xciii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 132 (5’UUUUCGAACAACAGAGUAGGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 297 (5’CCUACUCUGUUGUUCGAAAA3’); xciv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 142 (5’UGGAUGGUUACGGUCUGCUGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 307 (5’CAGCAGACCGUAACCAUCCA3’); xcv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 148 (5’UCAGGUAAUGCACAGCGAUGAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 313 (5’CAUCGCUGUGCAUUACCUGA3’); xcvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 207 (5’UGUAGAUGAUGAGGGUGUUCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 372 (5’GAACACCCUCAUCAUCUACA3’); xcvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 86 (5’UUACUCCUUCACCUCAAACUCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 251 (5’AGUUUGAGGUGAAGGAGUAA3’); xcviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 192 (5’UAAGGAUCAUAGUGUUCUUGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 357 (5’CAAGAACACUAUGAUCCUUA3’); xcix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 175 (5’UCAGAUUCCCAGUGGAUACGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 340 (5’CGUAUCCACUGGGAAUCUGA3’); c) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 187 (5’UUUUUAUGGUGACCUUGAGGUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 352 (5’CCUCAAGGUCACCAUAAAAA3’);(ci) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 109 (5’UCUGAGAGAUGCAGGUAAUUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 274 (5’AAUUACCUGCAUCUCUCAGA3’); (cii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 102 (5’UGACUCGGUAGGCUGGAGAGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 267 (5’CUCUCCAGCCUACCGAGUCA3’); (ciii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 121 (5’UCAAAAAUAUAUUCAUGAGCUU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 286 (5’GCUCAUGAAUAUAUUUUUGA3’); (civ) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 134 (5’UGAUUUCCACCUGCUCGUUUCG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 299 (5’AAACGAGCAGGUGGAAAUCA3’); (cv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 135 (5’UUUGGUUCUGCCGGUAAUUGUA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 300 (5’CAAUUACCGGCAGAACCAAA3’); (cvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 105 (5’UGAUGCUCAAGGGCUUCUGGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 270 (5’CCAGAAGCCCUUGAGCAUCA3’); (cvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 125 (5’UGUCUUUCAAAAAUAUAUUCAU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 290 (5’GAAUAUAUUUUUGAAAGACA3’); (cviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 190 (5’UGUGUUCUUGGCAUCCUGAGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 355 (5’CUCAGGAUGCCAAGAACACA3’); (cix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 119 (5’UAUGUAGUUGCAGCAGUCCAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 284 (5’UGGACUGCUGCAACUACAUA3’);cx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 120 (5’UGUGAUGUAGUUGCAGCAGUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 285 (5’ACUGCUGCAACUACAUCACA3’); or cxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 394 (5’UAAAUAUAUUCAUGAGCUUCGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 420 (5’GAAGCUCAUGAAUAUAUUUA3’).;

[0261] In some embodiments of the isolated oligonucleotides comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19 - 25 nucleotides between any of the following nucleotide positions starting from the 5’ end of the C3 mRNA sequence according to SEQ ID NO: 1: a) 33 to 53; b) 237 to 260; c) 444 to 480; d) 583 to 879; e) 1118 to 1328; f) 1409 to 1542; g) 1619 to 1648; h) 1754 to 1816; i) 2232 to 2256; j) 2300 to 2368; k) 2423 to 2452; l) 2518 to 2726; m) 2860 to 2883; n) 2981 to 3043; o) 3125 to 3239; p) 3298 to 3437; q) 3567 to 3638; r) 3767 to 3913; s) 3985 to 4430; and t) 4490 to 5054, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide reduces the expression of C3 mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45% or 45% to 50%) at a dose of 0.01 nM.

[0262] In some embodiments of the isolated oligonucleotides comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19 to 25 nucleotides between any of the following nucleotide positions starting from the 5'-end of the C3 mRNA sequence according to SEQ ID NO: 1: a) 33 to 53; b) 237 to 260; c) 444 to 480; d) 583 to 879; e) 1118 to 1328; f) 1409 to 1542; g) 1619 to 1648; h) 1754 to 1816; i) 2232 to 2256; j) 2300 to 2368; k) 2423 to 2452; l) 2518 to 2726; m) 2860 to 2883; n) 2981 to 3043; o) 3125 to 3239; p) 3298 to 3437; q) 3567 to 3638; r) 3767 to 3913; s) 3985 to 4430; and t) 4490 to 5054, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide reduces the expression of C3 mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45% or 45% to 50%) at a dose of 0.01 nM, wherein the double-stranded region comprises: i) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 96 (5'UAGAUGACAAAGGCAGUUCCCU 3'), and a sense strand of the nucleic acid sequence according to SEQ ID NO: 261 (5'GGAACUGCCUUUGUCAUCUA3'); ii) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 217 (5'UUUGUAUGAAGCAAUUCUCCUC 3'), and a sense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5'GGAGAAUUGCUUCAUACAAA3'); iii) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 70 (5'UUAGAUGGUCUUGUCUGUCUGG 3'), and a sense strand of the nucleic acid sequence according to SEQ ID NO: 235 (5'AGACAGACAAGACCAUCUAA3'); iv) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 198 (5'UCAUACUUGGAGAUGUAUCUGU 3'), and a sense strand of the nucleic acid sequence according to SEQ ID NO: 363 (5'AGAUACAUCUCCAAGUAUGA3');v) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 (5’UAUCAGGUAGGUGUAGUAGCGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 278 (5’GCUACUACACCUACCUGAUA3’); vi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 (5’UAUUACUGUGACCUCGAAGGGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 291 (5’CCUUCGAGGUCACAGUAAUA3’); vii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 170 (5’UGUAUCUCUGUUCAUUGAGCCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 335 (5’GCUCAAUGAACAGAGAUACA3’); viii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 123 (5’UUUUCAAAAAUAUAUUCAUGAG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 288 (5’CAUGAAUAUAUUUUUGAAAA3’); ix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 226 (5’UGUCAGUUGGGGCACCCAAAGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 391 (5’UUUGGGUGCCCCAACUGACA3’); x) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5’UCUGUCUGGAUGAAGAGGUACC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 232 (5’UACCUCUUCAUCCAGACAGA3’); xi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 172 (5’UUAGUAUCUCUGUUCAUUGAGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 337 (5’UCAAUGAACAGAGAUACUAA3’); xii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 74 (5’UGACAAGGAGUCCUGCUUGACC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 239 (5’UCAAGCAGGACUCCUUGUCA3’); xiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5’UUUUUUGCCUGGGAAGUCGUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 229 (5’ACGACUUCCCAGGCAAAAAA3’);(xiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 181 (5’UUUCCUUCAGCUGUGACUGUGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 346 (5’ACAGUCACAGCUGAAGGAAA3’); (xv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 131 (5’UGAACAACAGAGUAGGGUAGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 296 (5’CUACCCUACUCUGUUGUUCA3’); (xvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 196 (5’UUACUUGGAGAUGUAUCUGUCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 361 (5’ACAGAUACAUCUCCAAGUAA 3’); (xvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 129 (5’UGAAGAAGUCCUGCAUUACUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 294 (5’AGUAAUGCAGGACUUCUUCA3’); (xviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 212 (5’UGUAAUAGGCGUAGACCUUGAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 377 (5’CAAGGUCUACGCCUAUUACA3’); (xix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 93 (5’UAGUAGAAUUUCUCUGUAGGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 258 (5’CCUACAGAGAAAUUCUACUA3’); (xx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 194 (5’UUAGACAUAGUGGCAUCCUGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 359 (5’CAGGAUGCCACUAUGUCUAA3’); (xxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 154 (5’UAAGACCUUGACCACGUAGGCG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 319 (5’CCUACGUGGUCAAGGUCUUA3’); (xxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 108 (5’UGAGAUGCAGGUAAUUGUUGGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 273 (5’CAACAAUUACCUGCAUCUCA3’);(xxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:72 (5’UUGUAGAUGGUCUUGUCUGUCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:237 (5’ACAGACAAGACCAUCUACAA3’); (xxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:78 (5’UUUGACGAGUUCCGGAAUGUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:243 (5’ACAUUCCGGAACUCGUCAAA3’); (xxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:211 (5’UCAUCCUCAGAGUGUGAGACCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:376 (5’GUCUCACACUCUGAGGAUGA3’); (xxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:188 (5’UGUUUUAUGGUGACCUUGAGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:353 (5’CUCAAGGUCACCAUAAAACA3’); (xxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:124 (5’UCUUUCAAAAAUAUAUUCAUGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:289 (5’AUGAAUAUAUUUUUGAAAGA3’); (xxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:159 (5’UAAGGAAGUCUCCUGCUUUAGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:324 (5’UAAAGCAGGAGACUUCCUUA3’); (xxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:208 (5’UCUUGUCCAGGUAGAUGAUGAG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:373 (5’CAUCAUCUACCUGGACAAGA3’); (xxx) The antisense strand of the nucleic acid sequence according to SEQ ID NO:137 (5’UGUAGUUCCACCCUCACCUUGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:302 (5’AAGGUGAGGGUGGAACUACA3’); (xxxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:122 (5’UUUCAAAAAUAUAUUCAUGAGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:287 (5’UCAUGAAUAUAUUUUUGAAA3’);(xxxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5’UUUUUGCCUGGGAAGUCGUGGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 228 (5’CACGACUUCCCAGGCAAAAA3’); (xxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 219 (5’UUACACAUAGUCCACUCCUGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5’CAGGAGUGGACUAUGUGUAA3’); (xxxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 195 (5’UCAGUCAUCAUGGAUAUGUCCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 360 (5’GACAUAUCCAUGAUGACUGA3’); (xxxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5’UGUUAUAGAUGUAGUAGAAUUU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 260 (5’AUUCUACUACAUCUAUAACA3’); (xxxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 146 (5’UGAAUUCUGGUCUCAGACUCGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 311 (5’GAGUCUGAGACCAGAAUUCA3’); (xxxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 220 (5’UGUACACAUAGUCCACUCCUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5’AGGAGUGGACUAUGUGUACA3’); (xxxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 151 (5’UUUCUUGAUGAGCUCCAAGGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 316 (5’CCUUGGAGCUCAUCAAGAAA3’); (xxxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 118 (5’UUAUCUUCAGGGUCAUCUGCUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 283 (5’GCAGAUGACCCUGAAGAUAA3’);xL) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 180 (5’UUUCAGCUGUGACUGUGAAACC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 345 (5’UUUCACAGUCACAGCUGAAA3’); xLi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 210 (5’UCUCAGAGUGUGAGACCUUGUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5’CAAGGUCUCACACUCUGAGA3’); xLii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 187 (5’UUUUUAUGGUGACCUUGAGGUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 352 (5’CCUCAAGGUCACCAUAAAAA3’); xLiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 162 (5’UAUCUCUGUAGGUUCAUGUAGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 327 (5’UACAUGAACCUACAGAGAUA3’); xLiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 145 (5’UAAUUCUGGUCUCAGACUCGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 310 (5’CGAGUCUGAGACCAGAAUUA3’); xLv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 201 (5’UCUUUGUCCAGCUCAUACUUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 366 (5’AAGUAUGAGCUGGACAAAGA3’); xLvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5’UCAUAGUAGGCUCGGAUCUUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 246 (5’AAGAUCCGAGCCUACUAUGA3’); xLvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 206 (5’UGAUGAUGAGGGUGUUCCUAUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5’UAGGAACACCCUCAUCAUCA3’); xLviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 215 (5’UUGUUCAGCUUUCCAUCCUCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 380 (5’GAGGAUGGAAAGCUGAACAA3’);xLix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 213 (5’UGUUGUAAUAGGCGUAGACCUU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 378 (5’GGUCUACGCCUAUUACAACA3’); L) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 189 (5’UCUGUUUCCGGUGCUGGUUUUA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 354 (5’AAACCAGCACCGGAAACAGA3’); Li) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 207 (5’UGUAGAUGAUGAGGGUGUUCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 372 (5’GAACACCCUCAUCAUCUACA3’); Lii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 139 (5’UGGAUUGUGGAGUAGUUCCACC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 304 (5’UGGAACUACUCCACAAUCCA3’); Liii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 143 (5’UUUGUUCAUUCUGAUUCCUUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 308 (5’AAGGAAUCAGAAUGAACAAA3’); Liv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 178 (5’UCAUUUUCCUUGGUCUCUUCUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 343 (5’GAAGAGACCAAGGAAAAUGA3’); Lv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 128 (5’UGAAGUCCUGCAUUACUGUGAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 293 (5’CACAGUAAUGCAGGACUUCA3’); Lvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 160 (5’UUUCAUGUAGUUGGCUUCAAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 325 (5’UUGAAGCCAACUACAUGAAA3’); Lvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 176 (5’UUUUUCCUUGGUCUCUUCUGAU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 341 (5’CAGAAGAGACCAAGGAAAAA3’);(Lviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:80 (5’UCUUCCACUGGCCCAUGUUGAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:245 (5’CAACAUGGGCCAGUGGAAGA3’); (Lix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:203 (5’UUUCCUAUCGGAGAAGGCUUUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:368 (5’AAGCCUUCUCCGAUAGGAAA3’); (Lx) The antisense strand of the nucleic acid sequence according to SEQ ID NO:87 (5’UGUACUCCUUCACCUCAAACUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:252 (5’GUUUGAGGUGAAGGAGUACA3’); (Lxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:104 (5’UGUGUUGAUGCUGAGUUUGGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:269 (5’CCAAACUCAGCAUCAACACA3’); (Lxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:69 (5’UUUGUCUGUCUGGAUGAAGAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:234 (5’UCUUCAUCCAGACAGACAAA3’); (Lxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:197 (5’UAUACUUGGAGAUGUAUCUGUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:362 (5’CAGAUACAUCUCCAAGUAUA3’); (Lxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:223 (5’UAUGAUGUACUCGUCAAAGUCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:388 (5’ACUUUGACGAGUACAUCAUA3’); (Lxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:142 (5’UGGAUGGUUACGGUCUGCUGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:307 (5’CAGCAGACCGUAACCAUCCA3’); (Lxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:138 (5’UGAUUGUGGAGUAGUUCCACCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:303 (5’GUGGAACUACUCCACAAUCA3’);(Lxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:75 (5’UAAGACAAGGAGUCCUGCUUGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:240 (5’AAGCAGGACUCCUUGUCUUA3’); (Lxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:163 (5’UCAGUGUAGGAUCUCUGUAGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:328 (5’CUACAGAGAUCCUACACUGA3’); (Lxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:116 (5’UUUCUGACUGGCCGCUUUUUAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:281 (5’AAAAAGCGGCCAGUCAGAAA3’); (Lxx) The antisense strand of the nucleic acid sequence according to SEQ ID NO:112 (5’UGUGUAGUAGCGGAUCUUGGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:277 (5’CCAAGAUCCGCUACUACACA3’); (Lxxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:204 (5’UGUGUUCCUAUCGGAGAAGGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:369 (5’CCUUCUCCGAUAGGAACACA3’); (Lxxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:169 (5’UCACAAAGUCAAAGUCUUUUAG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:334 (5’AAAAGACUUUGACUUUGUGA3’); (Lxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:99 (5’UGUCUUGGUGAAGUGGAUCUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:264 (5’AGAUCCACUUCACCAAGACA3’); (Lxxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:140 (5’UCUGGAUUGUGGAGUAGUUCCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:305 (5’GAACUACUCCACAAUCCAGA3’); (Lxxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:130 (5’UGAUGAAGAAGUCCUGCAUUAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:295 (5’AAUGCAGGACUUCUUCAUCA3’);The antisense strand of the nucleic acid sequence according to SEQ ID NO:68 (5’UGUCUGUCUGGAUGAAGAGGUA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:233 (5’CCUCUUCAUCCAGACAGACA3’); Lxxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:73 (5’UGUGUAGAUGGUCUUGUCUGUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:238 (5’CAGACAAGACCAUCUACACA3’); Lxxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:100 (5’UGAGGUCAAAGGGCAUUCCUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:265 (5’AGGAAUGCCCUUUGACCUCA 3’); Lxxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:205 (5’UAUGAUGAGGGUGUUCCUAUCG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:370 (5’AUAGGAACACCCUCAUCAUA3’); Lxxx) The antisense strand of the nucleic acid sequence according to SEQ ID NO:119 (5’UAUGUAGUUGCAGCAGUCCAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:284 (5’UGGACUGCUGCAACUACAUA3’); Lxxxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:82 (5’UUUCAUAGUAGGCUCGGAUCUU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:247 (5’GAUCCGAGCCUACUAUGAAA3’); Lxxxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:79 (5’UGUUGACGAGUUCCGGAAUGUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:244 (5’CAUUCCGGAACUCGUCAACA3’); Lxxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:171 (5’UAGUAUCUCUGUUCAUUGAGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:336 (5’CUCAAUGAACAGAGAUACUA3’);The antisense strand of the nucleic acid sequence according to SEQ ID NO: 182 (5’UUUUUCCUUCAGCUGUGACUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 347 (5’AGUCACAGCUGAAGGAAAAA3’); Lxxxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 153 (5’UUGAAGGCCAGCUGCUGGGUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 318 (5’ACCCAGCAGCUGGCCUUCAA3’); Lxxxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 186 (5’UUUUAUGGUGACCUUGAGGUCG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 351 (5’ACCUCAAGGUCACCAUAAAA3’); Lxxxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 191 (5’UAUCAUAGUGUUCUUGGCAUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 356 (5’AUGCCAAGAACACUAUGAUA3’); Lxxxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 141 (5’UCUGCAGAAGGCUGGAUUGUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 306 (5’ACAAUCCAGCCUUCUGCAGA3’); Lxxxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 144 (5’UGUUUUGUUCAUUCUGAUUCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 309 (5’GAAUCAGAAUGAACAAAACA3’); XC) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 200 (5’UUUUGUCCAGCUCAUACUUGGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 365 (5’CAAGUAUGAGCUGGACAAAA3’); XCi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 89 (5’UCUAUGACCUCGAAACUGGGCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 254 (5’CCCAGUUUCGAGGUCAUAGA3’);The antisense strand of the nucleic acid sequence according to SEQ ID NO: 120 (5’UGUGAUGUAGUUGCAGCAGUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 285 (5’ACUGCUGCAACUACAUCACA3’); XCiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 86 (5’UUACUCCUUCACCUCAAACUCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 251 (5’AGUUUGAGGUGAAGGAGUAA 3’); XCiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 166 (5’UUCUUUUAGCUGCAGUAGGGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 331 (5’CCCUACUGCAGCUAAAAGAA3’); XCv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 101 (5’UAACACCAUGAGGUCAAAGGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 266 (5’CCUUUGACCUCAUGGUGUUA3’); XCvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 161 (5’UUGUAGGUUCAUGUAGUUGGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 326 (5’CCAACUACAUGAACCUACAA3’); XCvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 175 (5’UCAGAUUCCCAGUGGAUACGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 340 (5’CGUAUCCACUGGGAAUCUGA3’); XCviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 149 (5’UUUCAUCCAGGUAAUGCACAGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 314 (5’UGUGCAUUACCUGGAUGAAA3’); XCix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 214 (5’UGGUUGUAAUAGGCGUAGACCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5’GUCUACGCCUAUUACAACCA3’); or C) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5’UGACAGUGCAGGGUCAGAGGGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 227 (5’CCUCUGACCCUGCACUGUCA3’).;

[0263] In some embodiments of the isolated oligonucleotides comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19 - 25 nucleotides between any of the following nucleotide positions starting from the 5' end of the C3 mRNA sequence according to SEQ ID NO:1: a) 33 to 53; b) 237 to 260; c) 444 to 480; d) 583 to 879; e) 1118 to 1328; f) 1409 to 1542; g) 1619 to 1648; h) 1754 to 1816; i) 2232 to 2256; j) 2300 to 2368; k) 2423 to 2452; l) 2518 to 2726; m) 2860 to 2883; n) 2981 to 3043; o) 3125 to 3239; p) 3298 to 3437; q) 3567 to 3638; r) 3767 to 3913; s) 3985 to 4430; and t) 4490 to 5054, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates the expression of C3 mRNA by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95% or 95% to 100%) at a dose of 0.01 nM.

[0264] In some embodiments of the isolated oligonucleotides comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19 - 25 nucleotides between any of the following nucleotide positions starting from the 5' end of the C3 mRNA sequence according to SEQ ID NO:1: a) 33 to 53; b) 237 to 260; c) 444 to 480; d) 583 to 879; e) 1118 to 1328; f) 1409 to 1542; g) 1619 to 1648; h) 1754 to 1816; i) 2232 to 2256; j) 2300 to 2368; k) 2423 to 2452; l) 2518 to 2726; m) 2860 to 2883; n) 2981 to 3043; o) 3125 to 3239; p) 3298 to 3437; q) 3567 to 3638; r) 3767 to 3913; s) 3985 to 4430; and t) 4490 to 5054, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide reduces the expression of C3 mRNA by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95% or 95% to 100%) at a dose of 0.01 nM, wherein the double-stranded region comprises: i) an antisense strand with the nucleic acid sequence according to SEQ ID NO:94 (5’UUAGAUGUAGUAGAAUUUCUCU 3’), and a sense strand with the nucleic acid sequence according to SEQ ID NO:259 (5’AGAAAUUCUACUACAUCUAA3’); or ii) an antisense strand with the nucleic acid sequence according to SEQ ID NO:216 (5’UGAAGCAAUUCUCCUCAGCACA3’), and a sense strand with the nucleic acid sequence according to SEQ ID NO:381 (5’UGCUGAGGAGAAUUGCUUCA3’).

[0265] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any of the following: SEQ ID NO:3, 4, 5, 7, 29 or 31.

[0266] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence according to any of the following: SEQ ID NO:33, 34, 35, 37, 59 or 61.

[0267] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NO: 3, 4, 5, 7, 29, or 31; and the sense strand comprises a nucleotide sequence according to any one of SEQ ID NO: 33, 34, 35, 37, 59, or 61, wherein the antisense and sense strand sequences have sufficient complementarity to allow for the formation of a double-stranded region between the antisense and sense strands.

[0268] In some embodiments of the isolated oligonucleotides of the present disclosure, the isolated oligonucleotide comprises: (a) a sense strand comprising X1 nucleotides, wherein at least one nucleotide is modified with a first modification and each of the remaining nucleotides is independently modified with a second modification, and X1 is an integer selected from 13 - 36, wherein the first modification and the second modification are different; and (b) an antisense strand comprising X2 nucleotides, wherein at least one nucleotide is modified with a third modification and each of the remaining nucleotides is independently modified with a fourth modification, and X2 is an integer selected from 18 - 31, wherein the third modification and the fourth modification are different.

[0269] In some embodiments, the X1 nucleotides of the sense strand of the isolated oligonucleotides of the present disclosure are 18 - 21, and the X2 nucleotides of the antisense strand of the isolated oligonucleotides of the present disclosure are 20 - 23. In some embodiments, the X1 nucleotides of the sense strand of the isolated oligonucleotides of the present disclosure are 20 or 21, and the X2 nucleotides of the antisense strand of the isolated oligonucleotides of the present disclosure are 22 or 23. In some embodiments, the X2 nucleotides of the antisense strand of the isolated oligonucleotides of the present disclosure are equal to the X1 nucleotides of the sense strand of the isolated oligonucleotides of the present disclosure plus 2. In some embodiments, the X1 nucleotides of the sense strand of the isolated oligonucleotides of the present disclosure are 21, and the X2 nucleotides of the antisense strand of the isolated oligonucleotides of the present disclosure are 23. In some embodiments, the X1 nucleotides of the sense strand of the isolated oligonucleotides of the present disclosure are 20, and the X2 nucleotides of the antisense strand of the isolated oligonucleotides of the present disclosure are 22.

[0270] In some embodiments of the isolated oligonucleotides of the present disclosure, the isolated oligonucleotide comprises: (a) a sense strand comprising 20 nucleotides, wherein at least one nucleotide is modified with a first modification and each of the remaining nucleotides is independently modified with a second modification, wherein the first modification and the second modification are the same or different; and (b) an antisense strand comprising 22 nucleotides, wherein at least one nucleotide is modified with a third modification and each of the remaining nucleotides is independently modified with a fourth modification, wherein the third modification and the fourth modification are the same or different.

[0271] In some embodiments, the sense strand of the isolated oligonucleotide of the present disclosure comprises at least one nucleotide having a modified phosphate backbone. In some embodiments, the antisense strand of the isolated oligonucleotide of the present disclosure comprises at least one nucleotide having a modified phosphate backbone. In some embodiments, in the sense strand or the antisense strand, or both the sense strand and the antisense strand, of the isolated oligonucleotide of the present disclosure, the modified phosphate backbone comprises a modified phosphodiester bond. In some embodiments, the modified phosphodiester bond is modified by replacing one or more oxygen atoms with a moiety, wherein a carbon, nitrogen, or sulfur atom in the moiety is bonded to the phosphorus atom in the phosphodiester bond, or is modified by forming a 2'-5' bond. In some embodiments, the modified phosphodiester bond comprises a phosphorothioate, a dithiophosphate, a methylphosphonate, an aminophosphonate diester, a mesylamino phosphonate, or a phosphonoacetate.

[0272] In some embodiments, the isolated oligonucleotide of the present disclosure comprises one or more nucleotides containing non-natural bases, locked nucleic acids, or abasic nucleotides. In some embodiments, the terminal nucleotide at the 5'-end of the isolated oligonucleotide of the present disclosure comprises a phosphate mimetic. In some embodiments, the 5'-phosphate mimetic is an ethylphosphonate, a vinylphosphonate, or an analogue thereof.

[0273] In some embodiments, the antisense strand of the isolated oligonucleotide of the present disclosure comprises at least two single-stranded nucleotides at the 3'-end. In some embodiments, the antisense strand of the isolated oligonucleotide of the present disclosure comprises two single-stranded nucleotides at the 3'-end.

[0274] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 774 and 792 starting from the 5'-end of the C3 mRNA sequence according to SEQ ID NO:1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO:3 (5'UUAGUAGAAUUUCUCUGUAGGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:33 (5'CUACAGAGAAAUUCUACUAA 3').

[0275] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 775 and 793 starting from the 5'-end of the C3 mRNA sequence according to SEQ ID NO:1, the double-stranded region comprises an antisense strand having a nucleic acid sequence according to SEQ ID NO:4 (5’UGUAGUAGAAUUUCUCUGUAGG 3’), and a sense strand having a nucleic acid sequence according to SEQ ID NO:34 (5’UACAGAGAAAUUCUACUACA 3’).

[0276] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 777 and 795 starting from the 5'-end of the C3 mRNA sequence according to SEQ ID NO:1, the double-stranded region comprises an antisense strand having a nucleic acid sequence according to SEQ ID NO:5 (5’UAUGUAGUAGAAUUUCUCUGUA3’), and a sense strand having a nucleic acid sequence according to SEQ ID NO:35 (5’CAGAGAAAUUCUACUACAUA3’).

[0277] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 781 and 799 starting from the 5'-end of the C3 mRNA sequence according to SEQ ID NO:1, the double-stranded region comprises an antisense strand having a nucleic acid sequence according to SEQ ID NO:7 (5’UAUAGAUGUAGUAGAAUUUCUC 3’), and a sense strand having a nucleic acid sequence according to SEQ ID NO:37 (5’GAAAUUCUACUACAUCUAUA 3’).

[0278] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 4602 and 4620 starting from the 5'-end of the C3 mRNA sequence according to SEQ ID NO:1, the double-stranded region comprises an antisense strand having a nucleic acid sequence according to SEQ ID NO:29 (5’UAUGAAGCAAUUCUCCUCAGCA3’), and a sense strand having a nucleic acid sequence according to SEQ ID NO:59 (5’CUGAGGAGAAUUGCUUCAUA 3’).

[0279] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 4607 and 4625 starting from the 5'-end of the C3 mRNA sequence according to SEQ ID NO:1, the double-stranded region comprises an antisense strand of the nucleic acid sequence according to SEQ ID NO:31 (5'UUUUGUAUGAAGCAAUUCUCCU 3'), and a sense strand of the nucleic acid sequence according to SEQ ID NO:61 (5'GAGAAUUGCUUCAUACAAAA 3').

[0280] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between any one of the following nucleotide positions starting from the 5'-end of the C3 mRNA sequence according to SEQ ID NO:1: a) 774 to 799; and b) 4602 to 4625, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide reduces the expression of C3 mRNA by 20% to 50% (e.g., between 20% and 25%, between 25% and 30%, between 30% and 35%, between 35% and 40%, between 40% and 45%, or between 45% and 50%) at a dose of 0.01 nM.

[0281] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between any of the following nucleotide positions starting from the 5'-end of the C3 mRNA sequence according to SEQ ID NO: 1: a) 774 to 799; and b) 4602 to 4625, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the expression of C3 mRNA is attenuated by 20% to 50% at a dose of 0.01 nM. The double-stranded region comprises: i) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UUAGUAGAAUUUCUCUGUAGGC 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5'CUACAGAGAAAUUCUACUAA3'); ii) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5'UGUAGUAGAAUUUCUCUGUAGG 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UACAGAGAAAUUCUACUACA3'); iii) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UAUGUAGUAGAAUUUCUCUGUA3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'CAGAGAAAUUCUACUACAUA3'); iv) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5'UAUAGAUGUAGUAGAAUUUCUC 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'GAAAUUCUACUACAUCUAUA3'); v) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5'UAUGAAGCAAUUCUCCUCAGCA3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'CUGAGGAGAAUUGCUUCAUA3'); or vi) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5'UUUUGUAUGAAGCAAUUCUCCU 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5'GAGAAUUGCUUCAUACAAAA3').

[0282] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between any of the following nucleotide positions starting from the 5'-end of the C3 mRNA sequence according to SEQ ID NO: 1: a) 774 to 799; and b) 4602 to 4625, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide reduces the expression of C3 mRNA by at least 50% (e.g., between 50% and 55%, between 55% and 60%, between 60% and 65%, between 65% and 70%, between 70% and 75%, between 75% and 80%, between 80% and 85%, between 85% and 90%, between 90% and 95%, or between 95% and 100%) at a dose of 0.1 nM.

[0283] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between any of the following nucleotide positions starting from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1: a) 774 to 799; and b) 4602 to 4625, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region that reduces the expression of C3 mRNA by at least 50% at a dose of 0.1 nM. The double-stranded region comprises: i) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UUAGUAGAAUUUCUCUGUAGGC 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5'CUACAGAGAAAUUCUACUAA3'); ii) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5'UGUAGUAGAAUUUCUCUGUAGG 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UACAGAGAAAUUCUACUACA 3'); iii) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UAUGUAGUAGAAUUUCUCUGUA 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'CAGAGAAAUUCUACUACAUA3'); iv) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5'UAUAGAUGUAGUAGAAUUUCUC 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'GAAAUUCUACUACAUCUAUA3'); v) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5'UAUGAAGCAAUUCUCCUCAGCA 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'CUGAGGAGAAUUGCUUCAUA3'); or vi) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5'UUUUGUAUGAAGCAAUUCUCCU 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5'GAGAAUUGCUUCAUACAAAA3').

[0284] In some embodiments, the isolated oligonucleotides of the present disclosure can include a linker, sometimes referred to as a loop. siRNAs that include a linker or loop are sometimes referred to as short hairpin RNAs (shRNAs). In some embodiments, both the sense and antisense regions of the siRNA are encoded by a single strand of RNA. In these embodiments, the antisense and sense regions hybridize to form a duplex region. The sense and antisense regions are joined by a linker sequence, forming a "hairpin" or "stem-loop" structure. The siRNA can have complementary sense and antisense regions at opposite ends of the single-stranded molecule such that the molecule can form a duplex region with the complementary sequence portions and the strands are joined by a linker at one end of the duplex region. The linker can be a nucleotide linker, a non-nucleotide linker, or a combination thereof. The linker can interact with the first strand and optionally the second strand by covalent bonds or non-covalent interactions.

[0285] Any suitable nucleotide linker sequence is contemplated to be within the scope of the present disclosure. The siRNAs of the present disclosure can include nucleotide, non-nucleotide, or mixed nucleotide / non-nucleotide linkers that join the sense region of a nucleic acid to the antisense region of the nucleic acid. The nucleotide linker can be a linker of length ≥2 nucleotides, such as a linker of length about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 nucleotides.

[0286] Examples of non-nucleotide linkers include abasic nucleotides, polyethers, polyamines, polyamides, peptides, carbohydrates, lipids, polyhydrocarbons, or other polymeric agents such as polyethylene glycols, such as those having from 2 to 100 ethylene glycol units. Some examples are described in Seela et al., Nucleic Acids Research, 1987, Vol. 15, pp. 3113-3129; Cload et al., J. Am. Chem. Soc, 1991, Vol. 113, pp. 6324-6326; Jaeschke et al., Tetrahedron Lett., 1993, Vol. 34, pp. 301; Arnold et al., WO 1989 / 002439; Usman et al., WO 1995 / 006731; Dudycz et al., WO 1995 / 011910, and Ferentz et al., J. Am. Chem. Soc, 1991, Vol. 113, pp. 4000-4002.

[0287] Examples of nucleotide linker sequences include, but are not limited to, AUG, CCC, UUCG, CCACC, AAGCAA, CCACACC, and UUCAAGAGA.

[0288] In some embodiments, the isolated oligonucleotides of the present disclosure are siRNAs, which can be dsRNAs of a length suitable as Dicer substrates and can be processed to generate RISC-active siRNA molecules. See, e.g., Rossi et al., US2005 / 0244858.

[0289] Dicer substrate double-stranded RNA (dsRNA) can have a length sufficient to be processed by Dicer to produce active siRNA and can further include one or more of the following properties: (i) the Dicer substrate dsRNA can be asymmetric, e.g., having a 3' overhang on the antisense strand, (ii) the Dicer substrate dsRNA can have a modified 3' end on the sense strand to direct the orientation of Dicer binding and the processing of the dsRNA into active siRNA, e.g., having the incorporation of one or more DNA nucleotides, and (iii) the lengths of the first and second strands of the Dicer substrate dsRNA can range from 19 bp to 30 bp.

[0290] In some embodiments, the isolated oligonucleotides of the present disclosure contain at least one modified nucleotide. In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand or the antisense strand or both contain one or more modified nucleotides. In some embodiments, only the sense strand contains one or more modified nucleotides. In some embodiments, only the antisense strand contains one or more modified nucleotides. In some embodiments, both the sense strand and the antisense strand contain one or more modified nucleotides. In some embodiments, the isolated oligonucleotides are partially chemically modified. In some embodiments, the isolated oligonucleotides are fully chemically modified.

[0291] In some embodiments, the isolated oligonucleotide comprises at least two modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least three modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least four modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least five modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least six modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least seven modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least eight modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least nine modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least ten modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least eleven modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least twelve modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least thirteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least fourteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least fifteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least sixteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least seventeen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least eighteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least nineteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least twenty modified nucleotides. In some embodiments, the isolated oligonucleotide comprises more than twenty modified nucleotides. In some embodiments, the isolated oligonucleotide comprises between twenty and thirty modified nucleotides. In some embodiments, the isolated oligonucleotide comprises between thirty and forty modified nucleotides. In some embodiments, the isolated oligonucleotide comprises between forty and fifty modified nucleotides.

[0292] In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least one modified nucleotide. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least two modified nucleotides. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least three modified nucleotides. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least four modified nucleotides. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least five modified nucleotides. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least six modified nucleotides. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least seven modified nucleotides. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least eight modified nucleotides. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least nine modified nucleotides. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least ten modified nucleotides. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least eleven modified nucleotides. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least twelve modified nucleotides. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least thirteen modified nucleotides. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least fourteen modified nucleotides. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least fifteen modified nucleotides. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least sixteen modified nucleotides. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least seventeen modified nucleotides. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least eighteen modified nucleotides. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least nineteen modified nucleotides. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least twenty modified nucleotides.

[0293] In some embodiments, where the isolated oligonucleotide comprises more than one modified nucleotide, at least a first nucleotide comprises a first modification and at least a second nucleotide comprises a second modification. In some embodiments, the first modification and the second modification are different. In some embodiments, at least the first nucleotide and at least the second nucleotide are on different strands of the isolated oligonucleotide. In some embodiments, at least the first nucleotide and at least the second nucleotide are on the same strand of the isolated oligonucleotide.

[0294] In some embodiments of the isolated oligonucleotide, where the isolated oligonucleotide comprises more than one modified nucleotide, at least a first modified nucleotide comprises a first modification, and at least a second modified nucleotide comprises a second modification, and at least a third nucleotide comprises a third modification. In some embodiments, the isolated oligonucleotide comprises a first modification, a second modification, a third modification, and a fourth modification. In some embodiments, the isolated oligonucleotide comprises more than four modifications. In some embodiments, all the modifications are on the sense strand. In some embodiments, all the modifications are on the antisense strand. Any combination of the positions of the modifications between the sense strand and the antisense strand is contemplated within the isolated oligonucleotides of the present disclosure.

[0295] In some embodiments, the modified nucleotides are located continuously on the sense strand or the antisense strand or both. In some embodiments, some but not all of the modified nucleotides are located continuously on the sense strand or the antisense strand or both. In some embodiments, the modified nucleotides are not located continuously on the sense strand or the antisense strand or both.

[0296] Contemplated within the present disclosure are isolated oligonucleotides in which any nucleotide on the sense strand or the antisense strand can be modified. In some embodiments, any nucleotide on the antisense strand can be modified. In some embodiments, any nucleotide on the antisense strand can be modified.

[0297] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand or the antisense strand or both comprise one or more modified nucleotides. In some embodiments, only the sense strand comprises one modified nucleotide. In some embodiments, only the sense strand comprises one or more modified nucleotides. In some embodiments, only the antisense strand comprises one modified nucleotide. In some embodiments, only the antisense strand comprises one or more modified nucleotides.

[0298] In some embodiments, the isolated oligonucleotides of the present disclosure comprise at least one modified nucleotide. In some embodiments, one or more modified nucleotides increase the stability or potency or both of the isolated oligonucleotide. In some embodiments, one or more modified nucleotides increase the stability of RNA duplexes and siRNAs.

[0299] Modifications that increase RNA stability include, but are not limited to, locked nucleic acids. As used herein, the term "locked nucleic acid" or "LNA" includes, but is not limited to, modified RNA nucleotides in which the ribose moiety contains a methylene bridge connecting the 2'-oxygen and 4'-carbon. This methylene bridge locks the ribose in the 3'-endo conformation, also known as the northern conformation, which is the conformation found in A-form RNA duplexes. The term inaccessible RNA can be used interchangeably with LNA. LNAs with 2'-4' cyclic linkages are described in International Patent Applications WO99 / 14226, WO 00 / 56746, WO 00 / 56748, and WO 00 / 66604, the contents of which are incorporated herein by reference.

[0300] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand or the antisense strand or both contain at least one nucleotide having a modified phosphate backbone. In some embodiments, the sense strand of the isolated oligonucleotide contains at least one nucleotide having a modified phosphate backbone. In some embodiments, the antisense strand of the isolated oligonucleotide contains at least one nucleotide having a modified phosphate backbone. In some embodiments, wherein the isolated oligonucleotide of the present disclosure contains a modified phosphate backbone, the modified phosphate backbone contains a modified phosphodiester bond. In some embodiments, the modified phosphodiester bond is modified by replacing one or more oxygen atoms with a moiety, wherein the moiety has a carbon, nitrogen, or sulfur atom in the moiety bonded to the phosphorus atom in the phosphodiester bond, or is modified by forming a 2'-5' bond. In some embodiments, the modified phosphodiester bond comprises phosphorothioate, dithiophosphorate, methylphosphonate, aminophosphonate diester, mesylamino phosphonate, or phosphonoacetate.

[0301] In some embodiments, the isolated oligonucleotides of the present disclosure contain one or more nucleotides, locked nucleotides, or abasic nucleotides containing unnatural bases. In some embodiments, one or more of the modified nucleotides comprise phosphorothioate derivatives or acridine-substituted nucleotides. In some embodiments, the isolated oligonucleotides of the present disclosure contain a phospho-mimetic at the 5'-end of the antisense strand, including but not limited to vinyl phosphonate or other phospho-analogs. In some embodiments, the 5'-phospho-mimetic is ethyl phosphonate, vinyl phosphonate, or an analog thereof.

[0302] In some embodiments, modified nucleotides include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queuosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, methyl uracil-5-oxyacetate, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, or 2,6-diaminopurine.

[0303] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand or the antisense strand or both comprise terminal or internal nucleotides linked to one or more targeting ligands. In some embodiments, the terminal or internal nucleotides are directly linked to one or more targeting ligands. In some embodiments, the terminal or internal nucleotides are indirectly linked to one or more targeting ligands through a linker. In some embodiments, one or more targeting ligands directly or indirectly linked to the terminal or internal nucleotides may further comprise a PK modulator. In some embodiments, the PK modulator is a competitive modulator, a positive allosteric modulator, a negative allosteric modulator, or a neutral allosteric modulator. In some embodiments, the targeting ligand is selected from one or more of sugars, peptides, lipids, antibodies or fragments thereof, aptamers, albumin, fibrinogen, and folic acid.

[0304] Modification of Nucleotides

[0305] The present disclosure provides isolated oligonucleotides comprising: (a) a sense strand comprising X1 nucleotides, wherein at least one nucleotide is modified with a first modification and each of the remaining nucleotides is independently modified with a second modification, and X1 is an integer selected from 13 - 36, wherein the first modification and the second modification are different; and (b) an antisense strand comprising X2 nucleotides, wherein at least one nucleotide is modified with a third modification and each of the remaining nucleotides is independently modified with a fourth modification, and X2 is an integer selected from 18 - 31, wherein the third modification and the fourth modification are different.

[0306] In some embodiments, the X1 nucleotides of the sense strand of the isolated oligonucleotides of the present disclosure are 18 - 21, and the X2 nucleotides of the antisense strand of the isolated oligonucleotides of the present disclosure are 20 - 23. In some embodiments, the X1 nucleotides of the sense strand of the isolated oligonucleotides of the present disclosure are 20 or 21, and the X2 nucleotides of the antisense strand of the isolated oligonucleotides of the present disclosure are 22 or 23. In some embodiments, the X2 nucleotides of the antisense strand of the isolated oligonucleotides of the present disclosure are equal to the X1 nucleotides of the sense strand of the isolated oligonucleotides of the present disclosure plus 2. In some embodiments, the X1 nucleotides of the sense strand of the isolated oligonucleotides of the present disclosure are 21, and the X2 nucleotides of the antisense strand of the isolated oligonucleotides of the present disclosure are 23. In some embodiments, the X1 nucleotides of the sense strand of the isolated oligonucleotides of the present disclosure are 20, and the X2 nucleotides of the antisense strand of the isolated oligonucleotides of the present disclosure are 22.

[0307] In some embodiments of the isolated oligonucleotides of the present disclosure, the isolated oligonucleotides comprise: (a) a sense strand comprising 20 nucleotides, wherein at least one nucleotide is modified with a first modification and each of the remaining nucleotides is independently modified with a second modification, wherein the first modification and the second modification are the same or different; and (b) an antisense strand comprising 22 nucleotides, wherein at least one nucleotide is modified with a third modification and each of the remaining nucleotides is independently modified with a fourth modification, wherein the third modification and the fourth modification are the same or different.

[0308] In some embodiments, the first modification is a modification selected from 2'-F modification, 2'-CN modification, 2'-N3 modification, 2'-deoxy modification and their equivalents, and combinations thereof, at the 2'-position of the sugar moiety of at least one nucleotide. In some embodiments, the first modification is 2'-F modification, 2'-CN modification, 2'-N3 modification or 2'-deoxy modification or its stereoisomers. In some embodiments, the first modification is 2'-F modification, 2'-CN modification or 2'-N3 modification or its stereoisomers. In some embodiments, the first modification is 2'-F modification or its stereoisomers.

[0309] In some embodiments, the second modification is a modification selected from 2'-C1-C6 alkyl, 2'-OR modification, 2'-amino and morpholino substitution, and their equivalents and combinations thereof, at the 2'-position of the sugar moiety of one or more remaining nucleotides. In the 2'-OR modification, R is a C1-C6 alkyl optionally substituted with: C1-C6 alkoxy, acetamide, phenyl, or a heteroaryl containing a 5- or 6-membered ring and one or two heteroatoms selected from N, O, and S. In some embodiments, the second modification is a 2'-OR modification, or a morpholino substitution, or a combination thereof. In some embodiments, the second modification is a 2'-OR modification. In some embodiments, the second modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the second modification is a 2'-O-methyl modification. In some embodiments, the second modification is a morpholino substitution.

[0310] In some embodiments, the first modification is a 2'-F modification or a stereoisomer thereof, and the second modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the first modification is a 2'-F modification or a stereoisomer thereof, and the second modification is a 2'-O-methyl modification.

[0311] In some embodiments, the third modification is a modification selected from 2'-F modification, 2'-CN modification, 2'-N3 modification, 2'-deoxy modification, and their equivalents and combinations thereof, at the 2'-position of the sugar moiety of at least one nucleotide. In some embodiments, the third modification is a 2'-F modification, 2'-CN modification, 2'-N3 modification, or 2'-deoxy modification, or a stereoisomer thereof. In some embodiments, the third modification is a 2'-F modification, 2'-CN modification, or 2'-N3 modification, or a stereoisomer thereof. In some embodiments, the third modification is a 2'-F modification or a stereoisomer thereof.

[0312] In some embodiments, the fourth modification is a modification selected from 2'-C1-C6 alkyl, 2'-OR modification, 2'-amino and morpholino substitution, and their equivalents and combinations thereof, at the 2'-position of the sugar moiety of one or more remaining nucleotides. In the 2'-OR modification, R is a C1-C6 alkyl optionally substituted with: C1-C6 alkoxy, acetamide, phenyl, or a heteroaryl containing a 5- or 6-membered ring and one or two heteroatoms selected from N, O, and S. In some embodiments, the fourth modification is a 2'-OR modification, or a morpholino substitution, or a combination thereof. In some embodiments, the fourth modification is a 2'-OR modification. In some embodiments, the fourth modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the fourth modification is a 2'-O-methyl modification. In some embodiments, the fourth modification is a morpholino substitution.

[0313] In some embodiments, the third modification is a 2'-F modification or a stereoisomer thereof, and the fourth modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the third modification is a 2'-F modification or a stereoisomer thereof, and the fourth modification is a 2'-O-methyl modification.

[0314] Sense strand

[0315] In some embodiments of the isolated oligonucleotides of the present disclosure comprising a sense strand and an antisense strand, in the sense strand of the isolated oligonucleotides of the present disclosure, at least three nucleotides are modified with a first modification. In some embodiments, at least two of the at least three nucleotides modified with the first modification are consecutively positioned in the sense strand of the isolated oligonucleotides of the present disclosure. In some embodiments, at least three of the at least three nucleotides modified with the first modification are consecutively positioned in the sense strand of the isolated oligonucleotides of the present disclosure.

[0316] In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, at least four nucleotides are modified with the first modification. In some embodiments, at least three of the at least four nucleotides modified with the first modification are consecutively positioned in the sense strand of the isolated oligonucleotides of the present disclosure. In some embodiments, at least four of the at least four nucleotides modified with the first modification are consecutively positioned in the sense strand of the isolated oligonucleotides of the present disclosure.

[0317] In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, at least five nucleotides are modified with the first modification. In some embodiments, at least three of the at least five nucleotides modified with the first modification are consecutively positioned in the sense strand of the isolated oligonucleotides of the present disclosure. In some embodiments, at least four of the at least five nucleotides modified with the first modification are consecutively positioned in the sense strand of the isolated oligonucleotides of the present disclosure.

[0318] In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, at least three, at least four, or at least five nucleotides modified with the first modification are located at positions 10 to 15 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand.

[0319] In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, two of the at least three nucleotides modified with the first modification are located at positions 10, 11, 12, and 13 selected from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, three of the at least three nucleotides modified with the first modification are located at positions 10, 11, 12, and 13 selected from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, one of the at least three nucleotides modified with the first modification is located at position 11 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand.

[0320] In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, three of the at least three nucleotides modified with the first modification are located at positions 11, 12, and 13 selected from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, three of the at least three nucleotides modified with the first modification are located at positions 12, 13, and 14 selected from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, three of the at least three nucleotides modified with the first modification are located at positions 10, 11, and 12 selected from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand.

[0321] In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, one of at least four nucleotides modified with a first modification is located at position 10 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, one of at least four nucleotides modified with a first modification is located at position 11 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, one of at least four nucleotides modified with a first modification is located at position 12 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, one of at least four nucleotides modified with a first modification is located at position 13 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, one of at least four nucleotides modified with a first modification is located at position 14 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, one of at least four nucleotides modified with a first modification is located at position 15 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.

[0322] In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, at least four nucleotides modified with a first modification are located at positions 10, 11, 12, and 13 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.

[0323] In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, at least five nucleotides modified with a first modification are located at positions 10, 11, 12, 13, and 15 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.

[0324] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises five nucleotides modified with a first modification, wherein the five nucleotides modified with a first modification are located at positions 10, 11, 12, 13, and 15 of the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.

[0325] In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, at least three nucleotides, at least four nucleotides, or at least five nucleotides modified with a first modification are not all located consecutively. In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, the at least three nucleotides, the at least four nucleotides, or the at least five nucleotides are modified with a 2'-F modification.

[0326] In some embodiments, the sense strand of the isolated oligonucleotide of the present disclosure comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', where M is a nucleotide modified with a 2'-O-methyl modification, F is a nucleotide modified with a 2'-F modification, and a, b, c, d, e, f, and g are any one of 0-16, and where the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3'.

[0327] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', where M is a nucleotide modified with a 2'-O-methyl modification, F is a nucleotide modified with a 2'-F modification, and a, b, c, d, e, f, and g are any one of 0-16, and where the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93'.

[0328] In some embodiments of the isolated oligonucleotide of the present disclosure, where the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3', where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and where the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand contains a nucleotide sequence according to any one of: SEQ ID NO:33, 34, 35, 36, 37, 59, or 61.

[0329] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand of the isolated oligonucleotide contains nucleotides modified with 2'-F modification ("F") and nucleotides modified with 2'-O-methyl modification ("M") according to the following formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and where the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand contains a nucleotide sequence according to SEQ ID NO:33.

[0330] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand of the isolated oligonucleotide contains nucleotides modified with 2'-F modification ("F") and nucleotides modified with 2'-O-methyl modification ("M") according to the following formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and where the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand contains a nucleotide sequence according to SEQ ID NO:33, and the antisense strand contains a nucleotide sequence according to SEQ ID NO:3.

[0331] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand of the isolated oligonucleotide contains nucleotides modified with 2'-F modification ("F") and nucleotides modified with 2'-O-methyl modification ("M") according to the following formula: 5'(M)g (F) f (M) e (F) d (M) c (F) b (M) a 3', where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and where the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand contains the nucleotide sequence according to SEQ ID NO:34.

[0332] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand of the isolated oligonucleotide contains nucleotides modified with 2'-F modification ("F") and nucleotides modified with 2'-O-methyl modification ("M") according to the following formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and where the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand contains the nucleotide sequence according to SEQ ID NO:34, and the antisense strand contains the nucleotide sequence according to SEQ ID NO:4.

[0333] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand of the isolated oligonucleotide contains nucleotides modified with 2'-F modification ("F") and nucleotides modified with 2'-O-methyl modification ("M") according to the following formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and where the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand contains the nucleotide sequence according to SEQ ID NO:35.

[0334] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', where M is a nucleotide modified with a 2'-O-methyl modification, F is a nucleotide modified with a 2'-F modification, and a, b, c, d, e, f, and g are any one of 0-16, and where the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises the nucleotide sequence according to SEQ ID NO:35, and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:5.

[0335] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', where M is a nucleotide modified with a 2'-O-methyl modification, F is a nucleotide modified with a 2'-F modification, and a, b, c, d, e, f, and g are any one of 0-16, and where the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises the nucleotide sequence according to SEQ ID NO:37.

[0336] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3', where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 - 16, and where the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand contains the nucleotide sequence according to SEQ ID NO:37, and the antisense strand contains the nucleotide sequence according to SEQ ID NO:7.

[0337] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand of the isolated oligonucleotide contains nucleotides modified with 2'-F modification ("F") and nucleotides modified with 2'-O-methyl modification ("M") according to the following formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 - 16, and where the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand contains the nucleotide sequence according to SEQ ID NO:59.

[0338] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand of the isolated oligonucleotide contains nucleotides modified with 2'-F modification ("F") and nucleotides modified with 2'-O-methyl modification ("M") according to the following formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 - 16, and where the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand contains the nucleotide sequence according to SEQ ID NO:59, and the antisense strand contains the nucleotide sequence according to SEQ ID NO:29.

[0339] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand of the isolated oligonucleotide contains nucleotides modified with 2'-F modification ("F") and nucleotides modified with 2'-O-methyl modification ("M") according to the following formula: 5'(M)g (F) f (M) e (F) d (M) c (F) b (M) a 3', where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 - 16, and where the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand contains the nucleotide sequence according to SEQ ID NO:61.

[0340] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand of the isolated oligonucleotide contains nucleotides modified with 2'-F modification ("F") and nucleotides modified with 2'-O-methyl modification ("M") according to the following formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 - 16, and where the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand contains the nucleotide sequence according to SEQ ID NO:61, and the antisense strand contains the nucleotide sequence according to SEQ ID NO:31.

[0341] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand contains the same nucleotide sequence as the region between nucleotide positions 774 and 792 starting from the 5'-end of the C3 mRNA sequence according to SEQ ID NO:1, the double-stranded region contains the antisense strand of the nucleic acid sequence according to SEQ ID NO:3 (5'UUAGUAGAAUUUCUCUGUAGGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:33 (5'CUACAGAGAAAUUCUACUAA 3').

[0342] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 775 and 793 starting from the 5'-end of the C3 mRNA sequence according to SEQ ID NO:1, the double-stranded region comprises an antisense strand having the nucleic acid sequence according to SEQ ID NO:4 (5’UGUAGUAGAAUUUCUCUGUAGG 3’), and a sense strand having the nucleic acid sequence according to SEQ ID NO:34 (5’UACAGAGAAAUUCUACUACA 3’).

[0343] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 777 and 795 starting from the 5'-end of the C3 mRNA sequence according to SEQ ID NO:1, the double-stranded region comprises an antisense strand having the nucleic acid sequence according to SEQ ID NO:5 (5’UAUGUAGUAGAAUUUCUCUGUA3’), and a sense strand having the nucleic acid sequence according to SEQ ID NO:35 (5’CAGAGAAAUUCUACUACAUA 3’).

[0344] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 781 and 799 starting from the 5'-end of the C3 mRNA sequence according to SEQ ID NO:1, the double-stranded region comprises an antisense strand having the nucleic acid sequence according to SEQ ID NO:7 (5’UAUAGAUGUAGUAGAAUUUCUC 3’), and a sense strand having the nucleic acid sequence according to SEQ ID NO:37 (5’GAAAUUCUACUACAUCUAUA 3’).

[0345] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 4602 and 4620 starting from the 5'-end of the C3 mRNA sequence according to SEQ ID NO:1, the double-stranded region comprises an antisense strand having the nucleic acid sequence according to SEQ ID NO:29 (5’UAUGAAGCAAUUCUCCUCAGCA3’), and a sense strand having the nucleic acid sequence according to SEQ ID NO:59 (5’CUGAGGAGAAUUGCUUCAUA 3’).

[0346] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 4607 and 4625 starting from the 5' end of the C3 mRNA sequence according to SEQ ID NO:1, the double-stranded region comprises an antisense strand of the nucleic acid sequence according to SEQ ID NO:31 (5’UUUUGUAUGAAGCAAUUCUCCU 3’), and a sense strand of the nucleic acid sequence according to SEQ ID NO:61 (5’GAGAAUUGCUUCAUACAAAA 3’).

[0347] Antisense strand

[0348] In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, at most seven nucleotides are modified with a third modification.

[0349] In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, at most four of the at most seven nucleotides modified with the third modification are located at positions 2 to 8 starting from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, at least one of the at most seven nucleotides modified with the third modification is located at position 2 starting from the first nucleotide at the 5' end of the antisense strand.

[0350] In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, at most two of the at most seven nucleotides modified with the third modification are consecutively positioned. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, the at most two consecutively positioned nucleotides among the at most seven nucleotides modified with the third modification are located at positions 2 and 3 starting from the first nucleotide at the 5' end of the antisense strand.

[0351] In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, at least one of up to seven nucleotides modified with a third modification is located at position 14 starting from the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, two or three of up to seven nucleotides modified with a third modification are located at positions 2, 3, 5, and 6 selected from the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, three of up to seven nucleotides modified with a third modification are located at positions 2, 3, 5, and 6 selected from the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, two of up to seven nucleotides modified with a third modification are located at positions 2 and 5 starting from the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, two of up to seven nucleotides modified with a third modification are located at positions 2 and 3 starting from the first nucleotide at the 5'-end of the antisense strand.

[0352] In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, three of up to seven nucleotides modified with a third modification are located at positions 2, 3, and 5 starting from the first nucleotide at the 5'-end of the antisense strand.

[0353] In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, one or two of up to seven nucleotides modified with a third modification are located at positions 14 and 16 selected from the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, two of up to seven nucleotides modified with a third modification are located at positions 14 and 16 starting from the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, the up to seven nucleotides are modified with 2'-F modification. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, one of up to seven nucleotides modified with a third modification is located at position 14 starting from the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, two of up to seven nucleotides modified with a third modification are located at positions 14 and 16 starting from the first nucleotide at the 5'-end of the antisense strand.

[0354] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises up to seven nucleotides modified with a third modification, and the up to seven nucleotides are modified with a 2'-F modification. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 2 starting from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 3 starting from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 5 starting from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 7 starting from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 10 starting from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 14 starting from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 16 starting from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, the up to seven nucleotides modified with the third modification are located at positions 2, 3, 5, 7, 10, 14, and 16 starting from the first nucleotide at the 5' end of the antisense strand.

[0355] In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, the antisense strand comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M)o 5', where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 - 16, and the antisense strand is any one of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5'.

[0356] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand of the isolated oligonucleotide comprises nucleotides modified with 2'-F modification ("F") and nucleotides modified with 2'-O-methyl modification ("M") according to the following formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 - 16, and the antisense strand is any one of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NO:3, 4, 5, 7, 29, or 31.

[0357] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand of the isolated oligonucleotide comprises nucleotides modified with 2'-F modification ("F"), and nucleotides modified with 2'-O-methyl modification ("M") according to the following formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M)k (F) l (M) m (F) n (M) o 5', where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 - 16, and the antisense strand is any one of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand contains the nucleotide sequence according to SEQ ID NO:3.

[0358] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand of the isolated oligonucleotide contains nucleotides modified with 2'-F modification ("F") and nucleotides modified with 2'-O-methyl modification ("M") according to the following formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 - 16, and the antisense strand is any one of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand contains the nucleotide sequence according to SEQ ID NO:3, and the sense strand contains the nucleotide sequence according to SEQ ID NO:33.

[0359] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand of the isolated oligonucleotide contains nucleotides modified with 2'-F modification ("F") and nucleotides modified with 2'-O-methyl modification ("M") according to the following formula: 3'(M) a (F) b (M) c (F) d (M)e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0-16, wherein the antisense strand is any one of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand contains the nucleotide sequence according to SEQ ID NO:4.

[0360] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the antisense strand of the isolated oligonucleotide contains nucleotides modified with 2'-F modification ("F") and nucleotides modified with 2'-O-methyl modification ("M") according to the following formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0-16, wherein the antisense strand is any one of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand contains the nucleotide sequence according to SEQ ID NO:4, and the sense strand contains the nucleotide sequence according to SEQ ID NO:34.

[0361] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', where M is a nucleotide modified with a 2'-O-methyl modification, F is a nucleotide modified with a 2'-F modification, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0-16, where the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:5.

[0362] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o5', where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 - 16, wherein the antisense strand is any one of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand contains the nucleotide sequence according to SEQ ID NO:5, and the sense strand contains the nucleotide sequence according to SEQ ID NO:35.

[0363] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the antisense strand of the isolated oligonucleotide contains nucleotides modified with 2'-F modification ("F") and nucleotides modified with 2'-O-methyl modification ("M") according to the following formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 - 16, wherein the antisense strand is any one of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand contains the nucleotide sequence according to SEQ ID NO:7.

[0364] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the antisense strand of the isolated oligonucleotide contains nucleotides modified with 2'-F modification ("F") and nucleotides modified with 2'-O-methyl modification ("M") according to the following formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i(F) j (M) k (F) l (M) m (F) n (M) o 5', where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 - 16, and the antisense strand is any one of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand contains the nucleotide sequence according to SEQ ID NO:7, and the sense strand contains the nucleotide sequence according to SEQ ID NO:37.

[0365] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand of the isolated oligonucleotide contains nucleotides modified with 2'-F modification ("F") and nucleotides modified with 2'-O-methyl modification ("M") according to the following formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 - 16, and the antisense strand is any one of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand contains the nucleotide sequence according to SEQ ID NO:29.

[0366] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand of the isolated oligonucleotide contains nucleotides modified with 2'-F modification ("F") and nucleotides modified with 2'-O-methyl modification ("M") according to the following formula: 3'(M) a (F) b (M) c(F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0-16, wherein the antisense strand is any one of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand contains the nucleotide sequence according to SEQ ID NO:29, and the sense strand contains the nucleotide sequence according to SEQ ID NO:59.

[0367] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the antisense strand of the isolated oligonucleotide contains nucleotides modified with 2'-F modification ("F") and nucleotides modified with 2'-O-methyl modification ("M") according to the following formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0-16, wherein the antisense strand is any one of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand contains the nucleotide sequence according to SEQ ID NO:31.

[0368] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', where M is a nucleotide modified with a 2'-O-methyl modification, F is a nucleotide modified with a 2'-F modification, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any of 0-16, where the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO:31, and the sense strand comprises a nucleotide sequence according to SEQ ID NO:61.

[0369] Targeting ligand

[0370] In some embodiments, in the sense strand or the antisense strand or both of the isolated oligonucleotides of the present disclosure, a terminal or internal nucleotide is linked to a targeting ligand. In some embodiments, the targeting ligand is attached to one or more nucleotides at the 5'-end of the sense strand of the isolated oligonucleotides of the present disclosure. In some embodiments, the targeting ligand is attached to one or more nucleotides at the 3'-end of the sense strand of the isolated oligonucleotides of the present disclosure. In some embodiments, the targeting ligand is attached to one or more nucleotides at the 5'-end of the antisense strand of the isolated oligonucleotides of the present disclosure. In some embodiments, the targeting ligand is attached to one or more nucleotides at the 3'-end of the antisense strand of the isolated oligonucleotides of the present disclosure. In some embodiments, the targeting ligand is attached to one or more nucleotides of at least two single-stranded nucleotides at the 3'-end of the antisense strand of the isolated oligonucleotides of the present disclosure.

[0371] In some embodiments, the targeting ligand is selected from one or more of carbohydrates, peptides, lipids, antibodies or fragments thereof, aptamers, albumin, fibrinogen, and folic acid. In some embodiments, the targeting ligand binds to a surface protein on a cell that expresses the target mRNA of the isolated oligonucleotide of the present disclosure. In some embodiments, the targeting ligand mediates entry of the isolated oligonucleotide of the present disclosure into a cell that expresses the target mRNA of the isolated oligonucleotide of the present disclosure.

[0372] In some embodiments, the targeting ligand is a therapeutic ligand. In some embodiments, the targeting ligand is a therapeutic antibody.

[0373] In some embodiments, the targeting ligand is attached to the isolated oligonucleotide of the present disclosure via a linker. In some embodiments, the linker is any one of a protein, DNA, RNA, or a compound. In some embodiments, the isolated oligonucleotide, linker, and targeting ligand of the present disclosure form a scaffold. As used herein, the term "scaffold" refers to a compound or complex that includes the linker of the present disclosure, wherein the linker is covalently attached to a ligand or an isolated oligonucleotide or both.

[0374] In some embodiments, the isolated oligonucleotide, linker, and targeting ligand of the present disclosure form a conjugate. As used herein, the term "conjugate" refers to a compound or complex that includes an isolated oligonucleotide covalently attached to a ligand via the linker of the present disclosure.

[0375] As used herein, the term "targeting ligand" or "ligand" refers to a moiety that, when covalently attached to an oligonucleotide, is capable of mediating its entry into, or facilitating or allowing its delivery to, a target site (e.g., a target cell or tissue). In some embodiments, the targeting ligand includes a sugar ligand moiety (e.g., N-acetylgalactosamine (GalNAc)), which can direct oligonucleotide uptake into the liver.

[0376] In some embodiments, the targeting ligand binds to the asialoglycoprotein receptor (ASGPR). In some embodiments, the targeting ligand binds to the liver, such as the parenchymal cells of the liver (e.g., via the ASGPR).

[0377] Suitable targeting ligands include, but are not limited to, those disclosed in Winkler (Ther. Deliv., 2013, 4(7):791 - 809), PCT Patent Application Publication Nos. WO / 2016 / 100401, WO / 2012 / 089352, and WO / 2009 / 082607, and U.S. Patent Application Publication Nos. 2009 / 0239814, 2012 / 0136042, 2013 / 0158824, and 2009 / 0247608, each of which is incorporated by reference.

[0378] In some embodiments, the targeting ligand comprises a saccharide moiety.

[0379] As used herein, "saccharide moiety" refers to a moiety comprising one or more monosaccharide units, each monosaccharide unit having at least six carbon atoms (which can be linear, branched, or cyclic), wherein oxygen, nitrogen, or sulfur atoms are bonded to each carbon atom. In some embodiments, the saccharide moiety comprises a monosaccharide, disaccharide, trisaccharide, or tetrasaccharide. In some embodiments, the saccharide moiety comprises an oligosaccharide containing from about 4 to about 9 monosaccharide units. In some embodiments, the saccharide moiety comprises a polysaccharide (e.g., starch, glycogen, cellulose, or gellan gum).

[0380] In some embodiments, the saccharide moiety comprises a monosaccharide, disaccharide, trisaccharide, or tetrasaccharide. In some embodiments, the saccharide moiety comprises an oligosaccharide (e.g., containing from about 4 to about 9 monosaccharide units). In some embodiments, the saccharide moiety comprises a polysaccharide (e.g., starch, glycogen, cellulose, or gellan gum).

[0381] In some embodiments, the ligand is capable of binding to the human asialoglycoprotein receptor (ASGPR), e.g., the human asialoglycoprotein receptor 2 (ASGPR2).

[0382] In some embodiments, the saccharide moiety comprises a sugar (e.g., one, two, or three sugars). In some embodiments, the saccharide moiety comprises galactose or a derivative thereof (e.g., one, two, or three galactose or a derivative thereof). In some embodiments, the saccharide moiety comprises N-acetylgalactosamine or a derivative thereof (e.g., one, two, or three N-acetylgalactosamine or a derivative thereof). In some embodiments, the saccharide moiety comprises N-acetyl-D-galactosamine or a derivative thereof (e.g., one, two, or three N-acetyl-D-galactosamine or a derivative thereof).

[0383] In some embodiments, the saccharide moiety comprises N-acetylgalactosamine (e.g., one, two, or three N-acetylgalactosamine). In some embodiments, the saccharide moiety comprises N-acetyl-D-galactosamine (e.g., one, two, or three N-acetyl-D-galactosamine).

[0384] In some embodiments, the saccharide moiety comprises mannose or a derivative thereof (e.g., mannose-6-phosphate). In some embodiments, the saccharide moiety further comprises a linking moiety that links one or more sugars (e.g., N-acetyl-D-galactosamine) to the linker.

[0385] In some embodiments, the linker comprises a thioether (e.g., succinimidyl thioester or a hydrolyzed analogue thereof), a disulfide, a triazole, a thiophosphate, a phosphodiester, an ester, an amide, or any combination thereof. In some embodiments, the linker is a three-branched linking moiety. Suitable targeting ligands include, but are not limited to, the ligands disclosed in PCT application publications WO / 2015 / 006740, WO / 2016 / 100401, WO / 2017 / 214112, WO / 2018 / 039364, and WO / 2018 / 045317, each of which is incorporated herein by reference.

[0386] In some embodiments, the targeting ligand comprises a lipid or a lipid moiety (e.g., one, two, or three lipid moieties). In some embodiments, the lipid moiety comprises (e.g., one, two, or three) C8-C24 fatty acids, cholesterol, a vitamin, a sterol, a phospholipid, or any combination thereof.

[0387] In some embodiments, the targeting ligand comprises a peptide or a peptide moiety (e.g., one, two, or three peptide moieties). In some embodiments, the peptide moiety comprises (e.g., one, two, or three) integrin, insulin, glucagon-like peptide, or any combination thereof. In some embodiments, the targeting ligand comprises an antibody or an antibody moiety (e.g., transferrin). In some embodiments, the targeting ligand comprises one, two, or three antibody moieties (e.g., transferrin).

[0388] In some embodiments, the targeting ligand comprises an oligonucleotide (e.g., an aptamer or CpG). In some embodiments, the targeting ligand comprises one, two, or three oligonucleotides (e.g., an aptamer or CpG).

[0389] In some embodiments, the ligand comprises: one, two, or three sugars (e.g., N-acetyl-D-galactosamine); one, two, or three lipid moieties; one, two, or three peptide moieties; one, two, or three antibody moieties; one, two, or three oligonucleotides; or any combination thereof.

[0390] In some embodiments, the linker is attached to the isolated oligonucleotide of the present disclosure via a phosphate group or an analogue of a phosphate group in an isolated oligonucleotide.

[0391] In some embodiments, the ligand comprises a sugar ligand moiety (e.g., N-acetylgalactosamine (GalNAc)), which can direct oligonucleotide uptake into the liver.

[0392] In some embodiments, the ligand comprises GalNAc or a derivative thereof. In some embodiments, the ligand comprises the GalNAc G1b structure shown below.

[0393]

[0394] In some embodiments, the ligand comprises three GalNAc moieties or three derivatives thereof. In some embodiments, the ligand comprises three GalNAc G1b moieties. In some embodiments, wherein the ligand comprises three GalNAc G1b moieties, the GalNAc G1b moieties are located contiguously. In some embodiments, the contiguously located GalNAc G1b moieties are located at the 3' end of the sense strand. In some embodiments, wherein the ligand comprises three contiguously located GalNAc G1b ("G1b") moieties, the first G1b moiety is linked to the second G1b moiety, and the second G1b is linked to the third G1b moiety. In some embodiments, the first GalNAc G1b moiety is linked to the sense strand of the isolated oligonucleotide of the present disclosure.

[0395] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the ligand comprises three GalNAc G1b ("G1b") moieties, wherein the first GalNAc G1b moiety is linked to the sense strand of the isolated oligonucleotide, the first GalNAc G1b moiety is further linked to the second GalNAc G1b moiety, and the second G1b is linked to the third G1b moiety. In some embodiments, wherein the ligand comprises three GalNAc G1b moieties, the three GalNAc G1b moieties are located contiguously at the 3' end of the sense strand.

[0396] In some embodiments of the isolated oligonucleotide of the present disclosure, the isolated oligonucleotide is linked to a ligand (e.g., GalNAc G1b or three GalNAc G1b moieties). In some embodiments, the isolated oligonucleotide is linked to the ligand via an internal or terminal nucleotide of the isolated oligonucleotide. In some embodiments, the isolated oligonucleotide is linked to the ligand via a ligand linker. In some embodiments, the

[0397] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the isolated oligonucleotide comprises a sense strand and an antisense strand, and wherein the ligand comprises three GalNAc G1b moieties, and the three GalNAc G1b moieties are located contiguously at the 3' end of the sense strand, the ligand is linked to the terminal nucleotide on the sense strand of the isolated oligonucleotide. In some embodiments, the ligand is linked to the terminal nucleotide on the sense strand via a ligand linker. In some embodiments, the ligand linker is a monovalent linker. In some embodiments, the ligand linker is a divalent linker. In some embodiments, the ligand linker is a trivalent linker.

[0398] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between any one of the following nucleotide positions starting from the 5’ end of the C3 mRNA sequence according to SEQ ID NO:1: a) 774 to 799; and b) 4602 to 4625, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and a targeting ligand is attached to the 3’ end of the sense strand. In some embodiments, the targeting ligand comprises three GalNAc G1b moieties.

[0399] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between any one of the following nucleotide positions starting from the 5’ end of the C3 mRNA sequence according to SEQ ID NO:1: a) 774 to 799; and b) 4602 to 4625, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, wherein the targeting ligand comprises three GalNAc Glb moieties attached to the 3’ end of the sense strand, and the sense strand comprises a nucleic acid sequence according to SEQ ID NO:33 (5’CUACAGAGAAAUUCUACUAA 3’); SEQ ID NO:34 (5’UACAGAGAAAUUCUACUACA 3’); SEQ ID NO:35 (5’CAGAGAAAUUCUACUACAUA 3’); SEQ ID NO:37 (5’GAAAUUCUACUACAUCUAUA 3’); SEQ ID NO:59 (5’CUGAGGAGAAUUGCUUCAUA3’); or SEQ ID NO:61 (5’GAGAAUUGCUUCAUACAAAA 3’).

[0400] The linkage at the 3’ end of the isolated oligonucleotides of the present disclosure can be directly via the 5’, 3’ or 2’ hydroxyl group, or indirectly via a non-nucleotide linker or a nucleoside (utilizing the 2’ or 3’ hydroxyl position of the nucleoside). The linkage can also utilize a functionalized sugar or nucleobase of the 3’ terminal nucleotide. In some embodiments, the ligands described herein can be attached to the isolated oligonucleotides of the present disclosure through various ligand linkers, which can be cleavable or non-cleavable.

[0401] Modification of phosphate groups

[0402] Modified terminal phosphate group

[0403] The present disclosure also provides oligonucleotides and conjugates containing modified phosphate groups (also referred to as phosphomimetics or phosphate derivatives) for nucleic acid delivery. The present disclosure also relates to the use of oligonucleotides and conjugates containing modified phosphate groups, for example, in the delivery of nucleic acids and / or the treatment or prevention of diseases.

[0404] In some embodiments, the present disclosure provides phosphomimetics of 5'-terminal nucleotides. Without wishing to be bound by theory, it is understood that when incorporated into an oligonucleotide (e.g., at the 5'-terminus of an antisense strand), the phosphomimetic can improve Ago2 binding / loading and enhance the metabolic stability of the oligonucleotide, thereby enhancing the potency and duration of the isolated oligonucleotide (e.g., dsRNA or siRNA).

[0405] In some embodiments of the isolated oligonucleotides of the present disclosure, the oligonucleotide comprises a 5'-terminal nucleotide modification. In some embodiments, the 5'-terminal modification provides a functional effect of a phosphate group but is more stable in the environmental conditions to which the oligonucleotide will be exposed when administered to a subject. In some embodiments, the isolated oligonucleotide comprises a phosphomimetic that is more resistant to phosphatases and other enzymes while minimizing any negative impact on the function of the oligonucleotide (e.g., minimizing any reduction in gene target knockdown when used as an RNAi inhibitor molecule).

[0406] In some embodiments, the 5'-terminal modification is a chemical modification. In some embodiments, the chemical modification enhances the stability against nucleases or other enzymes that degrade or interfere with the structure or activity of the isolated oligonucleotide.

[0407] In some embodiments, the sense or antisense strand of the isolated oligonucleotide of the present disclosure comprises a 5'-terminal phosphate group. In some embodiments, the 5'-terminal phosphate group comprises an unmodified phosphate having the formula: -O-P(=O)(OH)OH. In some embodiments, the 5'-terminal phosphate group comprises a modified phosphate. In some embodiments, the 5'-terminal phosphate group comprises a modified phosphate having the formula -CH2-P(=X)(OR 1 )OR 2 wherein X is O or S, R 1 is H or C1-C6 alkyl, and R 2 is H or C1-C6 alkyl. In some embodiments, the modified phosphate is referred to as a "phosphomimetic".

[0408] As used herein, the term "halo" or "halogen" refers to fluorine, chlorine, bromine, and iodine.

[0409] As used herein, the term "aryl" includes groups having aromaticity (including "conjugation") or polycyclic systems having one or more aromatic rings and containing no heteroatoms in the ring structure. The term aryl includes both monovalent and divalent species. Examples of aryl groups include, but are not limited to, phenyl, biphenyl, naphthyl, etc. Conveniently, aryl is phenyl.

[0410] As used herein, the term "alkyl" or "C1-C6 alkyl" is intended to include C1, C2, C3, C4, C5 or C6 straight-chain (linear) saturated aliphatic hydrocarbon groups and C3, C4, C5 or C6 branched-chain saturated aliphatic hydrocarbon groups. For example, C1-C6 alkyl is intended to include C1, C2, C3, C4, C5 and C6 alkyl groups. Examples of alkyl include moieties having from 1 to 6 carbon atoms, such as, but not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, tert-butyl, n-pentyl, isopentyl or n-hexyl. In some embodiments, the straight-chain or branched-chain alkyl has six or fewer carbon atoms (e.g., C1-C6 for straight-chain and C3-C6 for branched-chain), and in another embodiment, the straight-chain or branched-chain alkyl has four or fewer carbon atoms. In some embodiments, the straight-chain alkyl has one carbon atom. In some embodiments, the straight-chain alkyl has two carbon atoms.

[0411] In some embodiments, the phosphomimetic is attached to the 5' end of a separated oligonucleotide (e.g., siRNA) as shown in the following formula:

[0412]

[0413] Where:

[0414] B is H or a nucleobase moiety;

[0415] X is O or S;

[0416] R 1 is H or C1-C6 alkyl;

[0417] R 2 is H or C1-C6 alkyl;

[0418] Y 1 is O or S;

[0419] Y 2 is O or S;

[0420] Z is H, halogen or -OR Z ;

[0421] R Z is H, C1-C6 alkyl or -(C1-C6 alkyl)-(C6-C 10(aryl), wherein the C1-C6 alkyl or -(C1-C6 alkyl)-(C6-C 10 (aryl) is optionally substituted with one or more R Za substituents;

[0422] Each R Za is independently halogen, C1-C6 alkyl, or -O-(C1-C6 alkyl), wherein the C1-C6 alkyl or -O-(C1-C6 alkyl) is optionally substituted with one or more halogens; and

[0423] indicates attachment to a nucleotide of a separated oligonucleotide (e.g., siRNA).

[0424] In some embodiments, a phosphomimetic is attached to the 5'-end of a separated oligonucleotide (e.g., siRNA), as shown in the following formula:

[0425]

[0426] Wherein:

[0427] B is H or a nucleobase moiety;

[0428] X is O or S;

[0429] R 1 is H or C1-C6 alkyl;

[0430] R 2 is H or C1-C6 alkyl;

[0431] Y 1 is O or S;

[0432] Y 2 is O or S; and

[0433] indicates attachment to a nucleotide of a separated oligonucleotide (e.g., siRNA).

[0434] In some embodiments, a phosphomimetic is attached to the 5'-end of a separated oligonucleotide (e.g., siRNA), as shown in the following formula:

[0435]

[0436] Wherein:

[0437] B is H or a nucleobase moiety;

[0438] X is O or S;

[0439] R 1 is H or C1-C6 alkyl;

[0440] R 2 is H or a C1-C6 alkyl group; and

[0441] indicates attachment to a nucleotide of a separated oligonucleotide (e.g., siRNA).

[0442] In some embodiments, X is O.

[0443] In some embodiments, X is S.

[0444] In some embodiments, R 1 is H.

[0445] In some embodiments, R 1 is a C1-C6 alkyl group (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl).

[0446] In some embodiments, R 1 is methyl.

[0447] In some embodiments, R 2 is H.

[0448] In some embodiments, R 2 is a C1-C6 alkyl group (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl).

[0449] In some embodiments, R 2 is methyl.

[0450] In some embodiments, Y 1 is O.

[0451] In some embodiments, Y 1 is S.

[0452] In some embodiments, Y 2 is O.

[0453] In some embodiments, Y 2 is S.

[0454] In some embodiments, Z is H.

[0455] In some embodiments, Z is not H.

[0456] In some embodiments, Z is a halogen (e.g., F, Cl, Br or I).

[0457] In some embodiments, Z is F or Cl.

[0458] In some embodiments, Z is F.

[0459] In some embodiments, Z is -OR Z .

[0460] In some embodiments, Z is -OH.

[0461] In some embodiments, Z is not -OH.

[0462] In some embodiments, Z is -O-(C1-C6 alkyl) (e.g., where the C1-C6 alkyl is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, or hexyl).

[0463] In some embodiments, Z is -OCH3.

[0464] In some embodiments, Z is -O-(C1-C6 alkyl)-O-(C1-C6 alkyl) (e.g., where the C1-C6 alkyl is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, or hexyl).

[0465] In some embodiments, Z is -OCH2CH2OCH3.

[0466] In some embodiments, Z is optionally substituted with one or more R Za -O-(C1-C6 alkyl)-(C6-C 10 aryl).

[0467] In some embodiments, Z is -O-(C1-C6 alkyl)-(C6-C 10 aryl).

[0468] In some embodiments, Z is

[0469] In some embodiments, Z is optionally substituted with one or more R Za substituted

[0470] In some embodiments, Z is optionally substituted with one or more halogens

[0471] In some embodiments, Z is optionally substituted with one or more C1-C6 alkyl or -O-(C1-C6 alkyl) where the C1-C6 alkyl or -O-(C1-C6 alkyl) is optionally substituted with one or more halogens.

[0472] In some embodiments, R Z is H.

[0473] In some embodiments, R Z is not H.

[0474] In some embodiments, R Z is an optionally C1-C6 alkyl substituted with one or more R Za (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, or hexyl).

[0475] In some embodiments, R Z is an optionally C1-C6 alkyl substituted with one or more halogens (e.g., F, Cl, Br, or I) (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, or hexyl), or an -O-(C1-C6 alkyl) optionally substituted with one or more halogens (e.g., where the C1-C6 alkyl is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, or hexyl).

[0476] In some embodiments, R Z is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, or hexyl).

[0477] In some embodiments, R Z is methyl, ethyl, or propyl.

[0478] In some embodiments, R Z is methyl.

[0479] In some embodiments, R Z is a C1-C6 alkyl substituted with one or more halogens (e.g., F, Cl, Br, or I) (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, or hexyl).

[0480] In some embodiments, R Z is a C1-C6 alkyl substituted with one or more -O-(C1-C6 alkyl) (e.g., where the C1-C6 alkyl is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, or hexyl), where the -O-(C1-C6 alkyl) is optionally substituted with one or more halogens.

[0481] In some embodiments, R Z is an optionally C1-C6 alkyl substituted with one or more R Za substituted -(C1-C6 alkyl)-(C6-C 10 aryl).

[0482] In some embodiments, R Z is -(C1-C6 alkyl)-(C6-C 10 aryl), C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl), or -O-(C1-C6 alkyl) (e.g., where the C1-C6 alkyl is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl), wherein the C1-C6 alkyl or -O-(C1-C6 alkyl) is optionally substituted with one or more halogens.

[0483] In some embodiments, R Z is -(C1-C6 alkyl)-(C6-C 10 aryl).

[0484] In some embodiments, at least one R Za is a halogen (e.g., F, Cl, Br or I).

[0485] In some embodiments, at least one R Za is F or Cl.

[0486] In some embodiments, at least one R Za is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl) optionally substituted with one or more halogens (e.g., F, Cl, Br or I).

[0487] In some embodiments, at least one R Za is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl).

[0488] In some embodiments, at least one R Za is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl) substituted with one or more halogens (e.g., F, Cl, Br or I).

[0489] In some embodiments, at least one R Za is -O-(C1-C6 alkyl) optionally substituted with one or more halogens (e.g., F, Cl, Br or I).

[0490] In some embodiments, at least one R Za is -O-(C1-C6 alkyl).

[0491] In some embodiments, at least one R Za is -O-(C1-C6 alkyl) substituted with one or more halogens (e.g., F, Cl, Br, or I).

[0492] In some embodiments, B is H.

[0493] In some embodiments, B is a nucleobase moiety.

[0494] As used herein, the term "nucleobase moiety" refers to a nucleobase attached, e.g., via an atom of the nucleobase or a functional group thereof, to the remainder of an isolated oligonucleotide (e.g., dsRNA or siRNA) of the present disclosure.

[0495] In some embodiments, the nucleobase moiety is adenine (A), cytosine (C), guanine (G), thymine (T), or uracil (U).

[0496] In some embodiments, the nucleobase moiety is uracil (U).

[0497] In some embodiments, a phosphorous mimetic is attached to the 5'-end of the isolated oligonucleotide, as shown in the following formula:

[0498]

[0499] wherein:

[0500] B is a nucleobase moiety, wherein the nucleobase moiety is uracil (U), wherein the uracil is at position 1 starting from the 5'-end of the sense strand or at position 1 starting from the 5'-end of the antisense strand;

[0501] X is O;

[0502] R 1 is C1 alkyl;

[0503] R 2 is H; and

[0504] indicates attachment to a nucleotide of the isolated oligonucleotide (e.g., siRNA).

[0505] In some embodiments of the isolated oligonucleotides of the present disclosure, the phosphorous mimetic is attached to the 5'-end of the antisense strand of the isolated oligonucleotide.

[0506] In some embodiments, the phosphorous mimetic is attached to the 5'-end uridine of the antisense strand of the isolated oligonucleotide, having the following structure (5'-MeEPmU).

[0507]

[0508] Wherein "mU" is a 2'-O-methyl modified uridine nucleotide and "MeEP" is a monomethyl protected phosphonate mimic.

[0509] In some embodiments, the phosphonate mimic is attached to the 5'-terminal uridine of the antisense strand of the isolated oligonucleotide and has the following structure (5'-MeEPmUs).

[0510]

[0511] Wherein "mU" is a 2'-O-methyl modified uridine nucleotide, "MeEP" is a monomethyl protected phosphonate mimic, and "s" is a phosphorothioate internucleotide linkage.

[0512] In some embodiments, the phosphonate mimic is attached to the 5'-terminal uridine of the antisense strand of the isolated oligonucleotide and has the following structure (5'-EPmUs).

[0513]

[0514] Wherein "mU" is a 2'-O-methyl modified uridine nucleotide, "EP" is a phosphonate mimic, and "s" is a phosphorothioate internucleotide linkage.

[0515] The terms "5'-MeEP", "5'-MeEP" and "5'MeEP" are used interchangeably herein.

[0516] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between any one of the following nucleotide positions starting from the 5'-terminus of the C3 mRNA sequence according to SEQ ID NO: 1: a) 774 to 799; and b) 4602 to 4625, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the antisense strand comprises a monomethyl protected phosphonate mimic (MeEP). In some embodiments, MeEP is linked to the 5'-terminus of the antisense strand (5'-MeEP).

[0517] In some embodiments, wherein MeEP is linked to the 5'-terminus of the antisense strand, the phosphonate mimic is attached to the 5'-terminal uridine of the antisense strand.

[0518] In some embodiments, the 5'-terminal uridine is a 2'-O-methyl modified nucleotide.

[0519] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any of the following nucleotide positions starting from the 5'-end of the C3 mRNA sequence according to SEQ ID NO: 1: a) 774 to 799; and b) 4602 to 4625, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, wherein the antisense strand comprises a 5'-MeEP attached to the 5'-end of the antisense strand, and the antisense strand comprises a nucleic acid sequence according to SEQ ID NO: 3 (5’UUAGUAGAAUUUCUCUGUAGGC 3’); SEQ ID NO: 4 (5’UGUAGUAGAAUUUCUCUGUAGG 3’); SEQ ID NO: 5 (5’UAUGUAGUAGAAUUUCUCUGUA 3’); SEQ ID NO: 7 (5’UAUAGAUGUAGUAGAAUUUCUC 3’); SEQ ID NO: 29 (5’UAUGAAGCAAUUCUCCUCAGCA 3’); or SEQ ID NO: 31 (5’UUUUGUAUGAAGCAAUUCUCCU 3’).

[0520] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any of the following nucleotide positions starting from the 5'-end of the C3 mRNA sequence according to SEQ ID NO: 1: a) 774 to 799; and b) 4602 to 4625, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, wherein the antisense strand comprises a 5'-MeEP attached to the 5'-end of the antisense strand, and the sense strand comprises a targeting ligand that comprises three GalNAc G1b moieties attached to the 3'-end of the sense strand.

[0521] Modified backbone phosphate / phosphodiester bond

[0522] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand or the antisense strand or both comprise at least one nucleotide having a modified phosphate backbone. In some embodiments, the sense strand of the isolated oligonucleotide comprises at least one nucleotide having a modified phosphate backbone. In some embodiments, the antisense strand of the isolated oligonucleotide comprises at least one nucleotide having a modified phosphate backbone. In some embodiments, wherein the isolated oligonucleotide of the present disclosure comprises a modified phosphate backbone, and the modified phosphate backbone comprises a modified phosphodiester bond. The phosphodiester bond comprises a linkage having the following formula: wherein Denotes the attachment of the 3’ carbon of the first nucleotide in an isolated oligonucleotide of the present disclosure; and Denotes the attachment of the 5’ carbon of the second nucleotide in an isolated oligonucleotide of the present disclosure. In some embodiments, the phosphodiester bond is unmodified, where Z 1 is O and Z 2 is OH or O – . In some embodiments, the phosphodiester bond is modified, where Z 1 is O, S, NH, or N(C1-C6 alkyl) and Z 2 is OH, SH, NH2, NH(C1-C6 alkyl), O – , S – , HN – or (C1-C6 alkyl)N – , and where when Z 1 is O, Z 2 is not OH or O – .

[0523] In some embodiments, Z1 is O.

[0524] In some embodiments, Z1 is S.

[0525] In some embodiments, Z1 is NH.

[0526] In some embodiments, Z1 is N(C1-C6 alkyl).

[0527] In some embodiments, Z2 is OH.

[0528] In some embodiments, Z2 is SH.

[0529] In some embodiments, Z2 is NH2.

[0530] In some embodiments, Z2 is NH(C1-C6 alkyl).

[0531] In some embodiments, Z2 is SH, NH2, or NH(C1-C6 alkyl).

[0532] In some embodiments, Z2 is O – .

[0533] In some embodiments, Z2 is S – .

[0534] In some embodiments, Z2 is HN – .

[0535] In some embodiments, Z2 is (C1-C6 alkyl)N – .

[0536] In some embodiments, Z2 is S – , HN – or (C1-C6 alkyl)N – .

[0537] In some embodiments, Z1 is O and Z2 is SH.

[0538] In some embodiments, Z1 is O and Z2 is NH2.

[0539] In some embodiments, Z1 is O and Z2 is NH(C1-C6 alkyl).

[0540] In some embodiments, Z1 is S and Z2 is OH.

[0541] In some embodiments, Z1 is S and Z2 is SH.

[0542] In some embodiments, Z1 is S and Z2 is NH2.

[0543] In some embodiments, Z1 is S and Z2 is NH(C1-C6 alkyl).

[0544] In some embodiments, Z1 is NH and Z2 is OH.

[0545] In some embodiments, Z1 is NH and Z2 is SH.

[0546] In some embodiments, Z1 is NH and Z2 is NH2.

[0547] In some embodiments, Z1 is NH and Z2 is NH(C1-C6 alkyl).

[0548] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is OH.

[0549] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is SH.

[0550] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is NH2.

[0551] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is NH(C1-C6 alkyl).

[0552] In some embodiments, Z1 is O and Z2 is S – .

[0553] In some embodiments, Z1 is O and Z2 is HN – .

[0554] In some embodiments, Z1 is O and Z2 is (C1-C6 alkyl)N – .

[0555] In some embodiments, Z1 is S and Z2 is O – .

[0556] In some embodiments, Z1 is S and Z2 is S – .

[0557] In some embodiments, Z1 is S and Z2 is HN – .

[0558] In some embodiments, Z1 is S and Z2 is (C1-C6 alkyl)N – .

[0559] In some embodiments, Z1 is NH and Z2 is O – .

[0560] In some embodiments, Z1 is NH and Z2 is S – .

[0561] In some embodiments, Z1 is NH and Z2 is HN – .

[0562] In some embodiments, Z1 is NH and Z2 is (C1-C6 alkyl)N – .

[0563] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is O – .

[0564] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is S – .

[0565] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is HN – .

[0566] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is (C1-C6 alkyl)N – .

[0567] In some embodiments, the modified phosphodiester bond comprises a phosphorothioate internucleotide linkage.

[0568] In some embodiments, the modified phosphodiester bond comprises

[0569] wherein Denotes attachment to the 3'-carbon of the first nucleotide in an isolated oligonucleotide of the present disclosure; and Denotes attachment to the 5'-carbon of the second nucleotide in an isolated oligonucleotide of the present disclosure.

[0570] In some embodiments, the modified phosphodiester bond comprises

[0571] wherein Denotes attachment to the 3'-carbon of the first nucleotide in an isolated oligonucleotide of the present disclosure; and Denotes attachment to the 5'-carbon of the second nucleotide in an isolated oligonucleotide of the present disclosure.

[0572] In some embodiments, the modified phosphodiester bond comprises

[0573] wherein Denotes attachment to the 3'-carbon of the first nucleotide in an isolated oligonucleotide of the present disclosure; and Denotes attachment to the 5'-carbon of the second nucleotide in an isolated oligonucleotide of the present disclosure.

[0574] In some embodiments, the isolated oligonucleotide of the present disclosure comprises at least one modified phosphodiester bond. In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand or the antisense strand or both comprise one or more modified phosphodiester bonds. In some embodiments, only the sense strand comprises one or more modified phosphodiester bonds. In some embodiments, only the antisense strand comprises one or more modified phosphodiester bonds. In some embodiments, both the sense strand and the antisense strand comprise one or more modified phosphodiester bonds.

[0575] In some embodiments, the isolated oligonucleotide comprises at least two modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least three modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least four modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least five modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least six modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least seven modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least eight modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least nine modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least ten modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least eleven modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least twelve modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least thirteen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least fourteen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least fifteen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least sixteen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least seventeen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least eighteen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least nineteen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least twenty modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises more than twenty modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises between twenty and thirty modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises between thirty and forty modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises between forty and fifty modified phosphodiester bonds.

[0576] In some embodiments, the isolated oligonucleotide comprises at least two phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least three phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least four phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least five phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least six phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least seven phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least eight phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least nine phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least ten phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least eleven phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least twelve phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least thirteen phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least fourteen phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least fifteen phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least sixteen phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least seventeen phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least eighteen phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least nineteen phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least twenty phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises more than twenty phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises between twenty and thirty phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises between thirty and forty phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises between forty and fifty phosphorothioate internucleotide linkages.

[0577] In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least one modified phosphodiester bond. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least two modified phosphodiester bonds. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least three modified phosphodiester bonds. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least four modified phosphodiester bonds. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least five modified phosphodiester bonds. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least six modified phosphodiester bonds. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least seven modified phosphodiester bonds. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least eight modified phosphodiester bonds. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least nine modified phosphodiester bonds. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least ten modified phosphodiester bonds. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least eleven modified phosphodiester bonds. In some embodiments, the sense strand and / or the antisense strand of the isolated oligonucleotide each comprises at least twelve modified phosphodiester bonds. In some embodiments, the sense strand and / or th...

Claims

1. An isolated oligonucleotide comprising a sense strand and an antisense strand, wherein: the sense strand comprises a nucleotide sequence substantially identical to a region of 19 - 25 nucleotides between any of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.

2. The isolated oligonucleotide according to claim 1, wherein the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95% or at least 99% identical to a region of 19 - 25 nucleotides between any of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625.

3. The isolated oligonucleotide according to claim 1, wherein the sense strand comprises a nucleotide sequence identical to a region of 19 - 25 nucleotides between any of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625.

4. The isolated oligonucleotide according to any one of claims 1 - 3, wherein the sense strand comprises a nucleotide sequence substantially identical to a region between any of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 1281 to 1301; b) 1797 to 1817; c) 2862 to 2882; d) 4402 to 4424; and e) 4520 to 4540.

5. The isolated oligonucleotide according to claim 4, wherein the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95% or at least 99% identical to a region between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 1281 to 1301; b) 1797 to 1817; c) 2862 to 2882; d) 4402 to 4424; and e) 4520 to 4540.

6. The isolated oligonucleotide according to claim 4, wherein the sense strand comprises a nucleotide sequence that is identical to a region between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 1281 to 1301; b) 1797 to 1817; c) 2862 to 2882; d) 4402 to 4424; and e) 4520 to 4540.

7. The isolated oligonucleotide according to any one of claims 1 - 3, wherein the sense strand comprises a nucleotide sequence that is substantially identical to a region of a sequence between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 772 to 801; b) 2424 to 2444; c) 3784 to 3805; d) 4123 to 4169; e) 4438 to 4509; and f) 4558 to 4621.

8. The isolated oligonucleotide according to claim 7, wherein the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95% or at least 99% identical to a region of a sequence between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 772 to 801; b) 2424 to 2444; c) 3784 to 3805; d) 4123 to 4169; e) 4438 to 4509; and f) 4558 to 4621.

9. The isolated oligonucleotide according to claim 7, wherein the sense strand comprises a nucleotide sequence that is identical to a region of a sequence between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 772 to 801; b) 2424 to 2444; c) 3784 to 3805; d) 4123 to 4169; e) 4438 to 4509; and f) 4558 to 4621.

10. The isolated oligonucleotide according to any one of claims 1 - 3, wherein the sense strand comprises a nucleotide sequence that is substantially identical to a region of a sequence between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 588 to 608; b) 773 to 800; c) 2533 to 2585; d) 3778 to 3836; e) 4492 to 4512; and f) 4600 to 4625.

11. The isolated oligonucleotide according to claim 7, wherein the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95% or at least 99% identical to a region of the sequence contained between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 588 to 608; b) 773 to 800; c) 2533 to 2585; d) 3778 to 3836; e) 4492 to 4512; and f) 4600 to 4625.

12. The isolated oligonucleotide according to claim 7, wherein the sense strand comprises a sequence identical to a region of the sequence contained between any one of the following nucleotide positions starting from the 5'-end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 588 to 608; b) 773 to 800; c) 2533 to 2585; d) 3778 to 3836; e) 4492 to 4512; and f) 4600 to 4625.

13. The isolated oligonucleotide according to any one of claims 1-12, wherein the isolated oligonucleotide is capable of inducing degradation of the C3 mRNA.

14. The isolated oligonucleotide according to any one of claims 1-13, wherein the sense strand is a single-stranded RNA molecule.

15. The isolated oligonucleotide according to any one of claims 1-13, wherein the antisense strand is a single-stranded RNA molecule.

16. The isolated oligonucleotide according to any one of claims 1-13, wherein both the sense strand and the antisense strand are single-stranded RNA molecules.

17. The isolated oligonucleotide according to claim 15 or claim 16, wherein the antisense strand comprises a 3'-overhang.

18. The isolated oligonucleotide according to claim 17, wherein the 3'-overhang comprises at least one nucleotide.

19. The isolated oligonucleotide according to claim 18, wherein the 3'-overhang comprises two nucleotides.

20. The isolated oligonucleotide according to claim 19, wherein the 3'-overhang comprises any one of thymidine-thymidine (dTdT), adenine-adenine (AA), cytosine-cytosine (CC), guanine-guanine (GG) or uracil-uracil (UU).

21. The isolated oligonucleotide according to any one of claims 1-20, wherein the sense strand comprises an RNA sequence having a length of at least 20 nucleotides.

22. The isolated oligonucleotide according to claim 21, wherein the sense strand comprises an RNA sequence having a length of 20 nucleotides.

23. The isolated oligonucleotide according to any one of claims 1-22, wherein the antisense strand comprises an RNA sequence having a length of at least 22 nucleotides.

24. The isolated oligonucleotide according to claim 23, wherein the antisense strand comprises an RNA sequence having a length of 22 nucleotides.

25. The isolated oligonucleotide according to any one of claims 1-24, wherein the length of the double-stranded region is between 19 and 21 nucleotides.

26. The isolated oligonucleotide according to claim 25, wherein the length of the double-stranded region is 20 nucleotides.

27. The isolated oligonucleotide according to any one of claims 1-26, wherein the antisense strand comprises a nucleotide sequence according to any one of the following: SEQ ID NO: 2-31.

28. The isolated oligonucleotide according to any one of claims 1-24, wherein the sense strand comprises a nucleotide sequence according to any one of the following: SEQ ID NO: 32-61.

29. The isolated oligonucleotide according to claim 6, wherein the double-stranded region comprises: i) an antisense strand having a nucleic acid sequence according to SEQ ID NO: 10 (5’UGUGUGUUGAUGCUGAGUUUGG 3’), and a sense strand having a nucleic acid sequence according to SEQ ID NO: 40 (5’AAACUCAGCAUCAACACACA3’); ii) an antisense strand having a nucleic acid sequence according to SEQ ID NO: 11 (5’UCUAUCUUCAGGGUCAUCUGCU 3’), and a sense strand having a nucleic acid sequence according to SEQ ID NO: 41 (5’CAGAUGACCCUGAAGAUAGA3’); iii) an antisense strand having a nucleic acid sequence according to SEQ ID NO: 15 (5’UUUUUGUUCAUUCUGAUUCCUU 3’), and a sense strand having a nucleic acid sequence according to SEQ ID NO: 45 (5’GGAAUCAGAAUGAACAAAAA3’); iv) an antisense strand having a nucleic acid sequence according to SEQ ID NO: 22 (5’UGAGUGUGAGACCUUGUCCAGG 3’), and a sense strand having a nucleic acid sequence according to SEQ ID NO: 52 (5’UGGACAAGGUCUCACACUCA 3’); v) an antisense strand having a nucleic acid sequence according to SEQ ID NO: 23 (5’UCAGAGUGUGAGACCUUGUCCA 3’), and a sense strand having a nucleic acid sequence according to SEQ ID NO: 53 (5’GACAAGGUCUCACACUCUGA3’); or vi) an antisense strand having a nucleic acid sequence according to SEQ ID NO: 27 (5’UGUAGAACCGGGUACAGCUUUC 3’), and a sense strand having a nucleic acid sequence according to SEQ ID NO: 57 (5’AAGCUGUACCCGGUUCUACA3’).

30. The isolated oligonucleotide according to claim 9, wherein the double-stranded region comprises: i) The antisense strand of the nucleic acid sequence according to SEQ ID NO:3 (5’UUAGUAGAAUUUCUCUGUAGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:33 (5’CUACAGAGAAAUUCUACUAA3’); ii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:5 (5’UAUGUAGUAGAAUUUCUCUGUA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:35 (5’CAGAGAAAUUCUACUACAUA3’); iii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:6 (5’UGAUGUAGUAGAAUUUCUCUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:36 (5’AGAGAAAUUCUACUACAUCA3’); iv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:9 (5’UUUAUAGAUGUAGUAGAAUUUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:39 (5’AAUUCUACUACAUCUAUAAA 3’); v) The antisense strand of the nucleic acid sequence according to SEQ ID NO:12 (5’UAAAAUAUAUUCAUGAGCUUCG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:42 (5’AAGCUCAUGAAUAUAUUUUA 3’); vi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:17 (5’UAAGUCAAAGUCUUUUAGCUGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:47 (5’AGCUAAAAGACUUUGACUUA3’); vii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:18 (5’UAAAGUCAAAGUCUUUUAGCUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:48 (5’GCUAAAAGACUUUGACUUUA 3’); viii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:20 (5’UAAUUUAUUACAGGUGAGUUGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:50 (5’AACUCACCUGUAAUAAAUUA 3’); ix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:21 (5’UCUGGUUUUAUGGUGACCUUGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:51 (5’AAGGUCACCAUAAAACCAGA 3’); x) The antisense strand of the nucleic acid sequence according to SEQ ID NO:24 (5’UUAUUGGUGAACUUUGAAAGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:54 (5’CUUUCAAAGUUCACCAAUAA3’); xi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:25 (5’UUAAUAGGCGUAGACCUUGACU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:55 (5’UCAAGGUCUACGCCUAUUAA 3’); xii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:28 (5’UCAGAGCUUGUUCAGCUUUCCA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:58 (5’GAAAGCUGAACAAGCUCUGA 3’); or xiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:30 (5’UUAUGAAGCAAUUCUCCUCAGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:60 (5’UGAGGAGAAUUGCUUCAUAA 3’).

31. The isolated oligonucleotide according to claim 12, wherein the double-stranded region comprises: i) The antisense strand of the nucleic acid sequence according to SEQ ID NO:2 (5’UGAGAAGACAAGGAGUCCUGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:32 (5’CAGGACUCCUUGUCUUCUCA3’); ii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:4 (5’UGUAGUAGAAUUUCUCUGUAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:34 (5’UACAGAGAAAUUCUACUACA3’); iii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:7 (5’UAUAGAUGUAGUAGAAUUUCUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:37 (5’GAAAUUCUACUACAUCUAUA 3’); iv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:8 (5’UUAUAGAUGUAGUAGAAUUUCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:38 (5’AAAUUCUACUACAUCUAUAA 3’); v) The antisense strand of the nucleic acid sequence according to SEQ ID NO:13 (5’UAUGAAGAAGUCCUGCAUUACU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:43 (5’UAAUGCAGGACUUCUUCAUA3’); vi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:14 (5’UUUCGAACAACAGAGUAGGGUA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:44 (5’CCCUACUCUGUUGUUCGAAA3’); vii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:16 (5’UAAGUCUUUUAGCUGCAGUAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:46 (5’UACUGCAGCUAAAAGACUUA3’); viii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:19 (5’UGUUCAUUGAGCCAACGCACGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:49 (5’GUGCGUUGGCUCAAUGAACA 3’); ix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:26 (5’UUUGUAAUAGGCGUAGACCUUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:56 (5’AGGUCUACGCCUAUUACAAA 3’); x) The antisense strand of the nucleic acid sequence according to SEQ ID NO:29 (5’UAUGAAGCAAUUCUCCUCAGCA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:59 (5’CUGAGGAGAAUUGCUUCAUA 3’); or xi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:31 (5’UUUUGUAUGAAGCAAUUCUCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:61 (5’GAGAAUUGCUUCAUACAAAA 3’).

32. The isolated oligonucleotide according to any one of claims 1 - 31, wherein the isolated oligonucleotide reduces the expression of C3 mRNA by at least 50% at a dose of 0.1 nM.

33. The isolated oligonucleotide according to claim 32, wherein the double-stranded region comprises: i) The antisense strand of the nucleic acid sequence according to SEQ ID NO:9 (5’UUUAUAGAUGUAGUAGAAUUUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:39 (5’AAUUCUACUACAUCUAUAAA 3’) (87.0); ii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:5 (5’UAUGUAGUAGAAUUUCUCUGUA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:35 (5’CAGAGAAAUUCUACUACAUA3’) (89.2); iii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:3 (5’UUAGUAGAAUUUCUCUGUAGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:33 (5’CUACAGAGAAAUUCUACUAA3’) (88.9); iv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:18 (5’UAAAGUCAAAGUCUUUUAGCUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:48 (5’GCUAAAAGACUUUGACUUUA3’) (87.6); v) The antisense strand of the nucleic acid sequence according to SEQ ID NO:4 (5’UGUAGUAGAAUUUCUCUGUAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:34 (5’UACAGAGAAAUUCUACUACA3’) (87.6); vi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:26 (5’UUUGUAAUAGGCGUAGACCUUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:56 (5’AGGUCUACGCCUAUUACAAA 3’) (85.8); vii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:25 (5’UUAAUAGGCGUAGACCUUGACU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:55 (5’UCAAGGUCUACGCCUAUUAA3’) (85.1); viii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:22 (5’UGAGUGUGAGACCUUGUCCAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:52 (5’UGGACAAGGUCUCACACUCA 3’) (84.2); ix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:7 (5’UAUAGAUGUAGUAGAAUUUCUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:37 (5’GAAAUUCUACUACAUCUAUA 3’) (84.0); x) The antisense strand of the nucleic acid sequence according to SEQ ID NO:8 (5’UUAUAGAUGUAGUAGAAUUUCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:38 (5’AAAUUCUACUACAUCUAUAA 3’) (89.2); xi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5’UCAGAGUGUGAGACCUUGUCCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5’GACAAGGUCUCACACUCUGA 3’) (83.8); xii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5’UGAUGUAGUAGAAUUUCUCUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5’AGAGAAAUUCUACUACAUCA 3’) (83.8); xiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5’UAAGUCAAAGUCUUUUAGCUGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5’AGCUAAAAGACUUUGACUUA 3’) (83.0); xiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5’UCAGAGCUUGUUCAGCUUUCCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5’GAAAGCUGAACAAGCUCUGA3’) (82.8); xv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5’UGUGUGUUGAUGCUGAGUUUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 40 (5’AAACUCAGCAUCAACACACA 3’) (82.0); xvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5’UGAGAAGACAAGGAGUCCUGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5’CAGGACUCCUUGUCUUCUCA3’) (82.0); xvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5’UAAAAUAUAUUCAUGAGCUUCG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5’AAGCUCAUGAAUAUAUUUUA 3’) (81.9); xviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5’UUAUGAAGCAAUUCUCCUCAGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5’UGAGGAGAAUUGCUUCAUAA 3’) (81.8); xix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:29 (5’UAUGAAGCAAUUCUCCUCAGCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:59 (5’CUGAGGAGAAUUGCUUCAUA 3’) (81.3); xx) The antisense strand of the nucleic acid sequence according to SEQ ID NO:13 (5’UAUGAAGAAGUCCUGCAUUACU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:43 (5’UAAUGCAGGACUUCUUCAUA3’) (81.2); xxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:14 (5’UUUCGAACAACAGAGUAGGGUA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:44 (5’CCCUACUCUGUUGUUCGAAA3’) (81.1); xxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:19 (5’UGUUCAUUGAGCCAACGCACGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:49 (5’GUGCGUUGGCUCAAUGAACA 3’) (80.8); xxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:20 (5’UAAUUUAUUACAGGUGAGUUGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:50 (5’AACUCACCUGUAAUAAAUUA 3’) (80.8); xxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:15 (5’UUUUUGUUCAUUCUGAUUCCUU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:45 (5’GGAAUCAGAAUGAACAAAAA 3’) (80.5); xxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:21 (5’UCUGGUUUUAUGGUGACCUUGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:51 (5’AAGGUCACCAUAAAACCAGA3’) (80.2); xxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:31 (5’UUUUGUAUGAAGCAAUUCUCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:61 (5’GAGAAUUGCUUCAUACAAAA3’) (79.2); xxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:11 (5’UCUAUCUUCAGGGUCAUCUGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:41 (5’CAGAUGACCCUGAAGAUAGA 3’) (78.9); xxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:16 (5’UAAGUCUUUUAGCUGCAGUAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:46 (5’UACUGCAGCUAAAAGACUUA 3’) (78.8); xxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:24 (5’UUAUUGGUGAACUUUGAAAGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:54 (5’CUUUCAAAGUUCACCAAUAA3’) (78.6); or xxx) The antisense strand of the nucleic acid sequence according to SEQ ID NO:27 (5’UGUAGAACCGGGUACAGCUUUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:57 (5’AAGCUGUACCCGGUUCUACA3’) (78.4).

34. The isolated oligonucleotide according to any one of claims 1 - 31, wherein the isolated oligonucleotide reduces the expression of C3 mRNA by 20% to 50% at a dose of 0.01 nM.

35. The isolated oligonucleotide according to claim 34, wherein the double-stranded region comprises: i) The antisense strand of the nucleic acid sequence according to SEQ ID NO:11 (5’UCUAUCUUCAGGGUCAUCUGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:41 (5’CAGAUGACCCUGAAGAUAGA3’) (47.9); ii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:24 (5’UUAUUGGUGAACUUUGAAAGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:54 (5’CUUUCAAAGUUCACCAAUAA3’) (46.7); iii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:31 (5’UUUUGUAUGAAGCAAUUCUCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:61 (5’GAGAAUUGCUUCAUACAAAA 3’) (46.6); iv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:16 (5’UAAGUCUUUUAGCUGCAGUAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:46 (5’UACUGCAGCUAAAAGACUUA 3’) (46.6); v) The antisense strand of the nucleic acid sequence according to SEQ ID NO:12 (5’UAAAAUAUAUUCAUGAGCUUCG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:42 (5’AAGCUCAUGAAUAUAUUUUA 3’) (45.7); vi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:15 (5’UUUUUGUUCAUUCUGAUUCCUU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:45 (5’GGAAUCAGAAUGAACAAAAA3’) (45.7); vii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:13 (5’UAUGAAGAAGUCCUGCAUUACU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:43 (5’UAAUGCAGGACUUCUUCAUA3’) (42.4); or viii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:10 (5’UGUGUGUUGAUGCUGAGUUUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:40 (5’AAACUCAGCAUCAACACACA3’) (41.5).

36. The isolated oligonucleotide according to any one of claims 1 - 31, wherein the isolated oligonucleotide reduces the expression of C3 mRNA by at least 50% at a dose of 0.01 nM.

37. The isolated oligonucleotide according to claim 36, wherein the double-stranded region comprises: i) The antisense strand of the nucleic acid sequence according to SEQ ID NO:3 (5’UUAGUAGAAUUUCUCUGUAGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:33 (5’CUACAGAGAAAUUCUACUAA3’) (71.3); ii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:29 (5’UAUGAAGCAAUUCUCCUCAGCA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:59 (5’CUGAGGAGAAUUGCUUCAUA 3’) (68.5); iii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:25 (5’UUAAUAGGCGUAGACCUUGACU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:55 (5’UCAAGGUCUACGCCUAUUAA3’) (67.6); iv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:9 (5’UUUAUAGAUGUAGUAGAAUUUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:39 (5’AAUUCUACUACAUCUAUAAA 3’) (59.1); v) The antisense strand of the nucleic acid sequence according to SEQ ID NO:8 (5’UUAUAGAUGUAGUAGAAUUUCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:38 (5’AAAUUCUACUACAUCUAUAA 3’) (66.9); vi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:26 (5’UUUGUAAUAGGCGUAGACCUUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:56 (5’AGGUCUACGCCUAUUACAAA 3’) (66.8); vii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:5 (5’UAUGUAGUAGAAUUUCUCUGUA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:35 (5’CAGAGAAAUUCUACUACAUA3’) (60.9); viii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:17 (5’UAAGUCAAAGUCUUUUAGCUGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:47 (5’AGCUAAAAGACUUUGACUUA 3’) (59.4); ix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:7 (5’UAUAGAUGUAGUAGAAUUUCUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:37 (5’GAAAUUCUACUACAUCUAUA3’) (59.1); x) The antisense strand of the nucleic acid sequence according to SEQ ID NO:18 (5’UAAAGUCAAAGUCUUUUAGCUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:48 (5’GCUAAAAGACUUUGACUUUA 3’) (58.9); xi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:4 (5’UGUAGUAGAAUUUCUCUGUAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:34 (5’UACAGAGAAAUUCUACUACA3’) (57.2); xii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:28 (5’UCAGAGCUUGUUCAGCUUUCCA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:58 (5’GAAAGCUGAACAAGCUCUGA 3’) (56.8); xiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:22 (5’UGAGUGUGAGACCUUGUCCAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:52 (5’UGGACAAGGUCUCACACUCA 3’) (56.2); xiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:14 (5’UUUCGAACAACAGAGUAGGGUA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:44 (5’CCCUACUCUGUUGUUCGAAA 3’) (56.0); xv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:23 (5’UCAGAGUGUGAGACCUUGUCCA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:53 (5’GACAAGGUCUCACACUCUGA 3’) (55.5); xvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:6 (5’UGAUGUAGUAGAAUUUCUCUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:36 (5’AGAGAAAUUCUACUACAUCA 3’) (55.3); xvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:19 (5’UGUUCAUUGAGCCAACGCACGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:49 (5’GUGCGUUGGCUCAAUGAACA 3’) (53.4); xviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:20 (5’UAAUUUAUUACAGGUGAGUUGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:50 (5’AACUCACCUGUAAUAAAUUA 3’) (53.4); xix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:30 (5’UUAUGAAGCAAUUCUCCUCAGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:60 (5’UGAGGAGAAUUGCUUCAUAA 3’) (52.9); xx) The antisense strand of the nucleic acid sequence according to SEQ ID NO:2 (5’UGAGAAGACAAGGAGUCCUGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:32 (5’CAGGACUCCUUGUCUUCUCA3’) (50.9); xxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:27 (5’UGUAGAACCGGGUACAGCUUUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:57 (5’AAGCUGUACCCGGUUCUACA 3’) (50.9); or xxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:21 (5’UCUGGUUUUAUGGUGACCUUGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:51 (5’AAGGUCACCAUAAAACCAGA 3’) (50.9).

38. An isolated oligonucleotide comprising a sense strand and an antisense strand, wherein: The sense strand comprises a nucleotide sequence substantially identical to a region of 19 - 25 nucleotides between any of the following nucleotide positions starting from the 5’ end of the C3 mRNA sequence included in SEQ ID NO:1: a) 33 to 53; b) 237 to 260; c) 444 to 480; d) 583 to 879; e) 1118 to 1328; f) 1409 to 1542; g) 1619 to 1648; h) 1754 to 1816; i) 2232 to 2256; j) 2300 to 2368; k) 2423 to 2452; l) 2518 to 2726; m) 2860 to 2883; n) 2981 to 3043; o) 3125 to 3239; p) 3298 to 3437; q) 3567 to 3638; r) 3767 to 3913; s) 3985 to 4430; and t) 4490 to 5054, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double - stranded region.

39. The isolated oligonucleotide according to claim 38, wherein the isolated oligonucleotide reduces the expression of C3 mRNA by 20% to 50% at a dose of 0.1 nM.

40. The isolated oligonucleotide according to claim 39, wherein the double - stranded region comprises: i) The antisense strand of the nucleic acid sequence according to SEQ ID NO:71 (5’UGUAGAUGGUCUUGUCUGUCUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:236 (5’GACAGACAAGACCAUCUACA3’) (49.9); ii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:106 (5’UUGAUGCUCAAGGGCUUCUGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:271 (5’CAGAAGCCCUUGAGCAUCAA3’) (49.2); iii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:97 (5’UAAGAUGACAAAGGCAGUUCCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:262 (5’GAACUGCCUUUGUCAUCUUA 3’) (49.1); iv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:168 (5’UCAAAGUCAAAGUCUUUUAGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:333 (5’CUAAAAGACUUUGACUUUGA 3’) (49.1); v) The antisense strand of the nucleic acid sequence according to SEQ ID NO:115 (5’UGAAGGAAGGGAUGAAGUCGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:280 (5’CGACUUCAUCCCUUCCUUCA3’) (48.8); vi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:173 (5’UCUUUUGGUAUUGAGCCAAGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:338 (5’CUUGGCUCAAUACCAAAAGA 3’) (48.2); vii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:116 (5’UUUCUGACUGGCCGCUUUUUAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:281 (5’AAAAAGCGGCCAGUCAGAAA3’) (47.4); viii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:169 (5’UCACAAAGUCAAAGUCUUUUAG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:334 (5’AAAAGACUUUGACUUUGUGA 3’) (47.1); (ix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:66 (5’UGUUUUUUGCCUGGGAAGUCGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:231 (5’GACUUCCCAGGCAAAAAACA 3’) (46.5); (x) The antisense strand of the nucleic acid sequence according to SEQ ID NO:153 (5’UUGAAGGCCAGCUGCUGGGUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:318 (5’ACCCAGCAGCUGGCCUUCAA 3’) (46.3); (xi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:189 (5’UCUGUUUCCGGUGCUGGUUUUA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:354 (5’AAACCAGCACCGGAAACAGA 3’) (45.6); (xii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:103 (5’UUGUUGAUGCUGAGUUUGGCCA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:268 (5’GCCAAACUCAGCAUCAACAA 3’) (45.1); (xiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:225 (5’UGUCCAACCUGCACCUCAUCCG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:390 (5’GAUGAGGUGCAGGUUGGACA 3’) (44.5); (xiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:117 (5’UAUCUUCAGGGUCAUCUGCUGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:282 (5’AGCAGAUGACCCUGAAGAUA 3’) (44.5); (xv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:81 (5’UCAUAGUAGGCUCGGAUCUUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:246 (5’AAGAUCCGAGCCUACUAUGA3’) (44.4); (xvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:133 (5’UGUUUCGAACAACAGAGUAGGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:298 (5’CUACUCUGUUGUUCGAAACA3’) (43.9); xvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 107 (5’UCAGGUAAUUGUUGGAGUUGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 272 (5’CAACUCCAACAAUUACCUGA 3’) (43.0); xviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5’UGUCUGUCUGGAUGAAGAGGUA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 233 (5’CCUCUUCAUCCAGACAGACA 3’) (42.6); xix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 222 (5’UGUACUCGUCAAAGUCAUUGGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 387 (5’CAAUGACUUUGACGAGUACA 3’) (42.5); xx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 139 (5’UGGAUUGUGGAGUAGUUCCACC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 304 (5’UGGAACUACUCCACAAUCCA 3’) (41.8); xxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 158 (5’UGGAAGUCUCCUGCUUUAGUGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 323 (5’ACUAAAGCAGGAGACUUCCA3’) (40.3); xxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 83 (5’UUUUCAUAGUAGGCUCGGAUCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 248 (5’AUCCGAGCCUACUAUGAAAA3’) (40.0); xxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 156 (5’UCAGGAUCAGCCAUUUAACAGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 321 (5’UGUUAAAUGGCUGAUCCUGA3’) (39.9); xxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 208 (5’UCUUGUCCAGGUAGAUGAUGAG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5’CAUCAUCUACCUGGACAAGA3’) (39.4); xxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5’UGACAGUGCAGGGUCAGAGGGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 227 (5’CCUCUGACCCUGCACUGUCA3’) (39.3); xxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 202 (5’UCUAUCGGAGAAGGCUUUGUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 367 (5’ACAAAGCCUUCUCCGAUAGA3’) (39.2); xxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 80 (5’UCUUCCACUGGCCCAUGUUGAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 245 (5’CAACAUGGGCCAGUGGAAGA3’) (39.2); xxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 174 (5’UGAUUCCCAGUGGAUACGGUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 339 (5’ACCGUAUCCACUGGGAAUCA3’) (38.5); xxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5’UUUUUUUGCCUGGGAAGUCGUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 230 (5’CGACUUCCCAGGCAAAAAAA3’) (38.3); xxx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 214 (5’UGGUUGUAAUAGGCGUAGACCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5’GUCUACGCCUAUUACAACCA3’) (38.3); xxxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 141 (5’UCUGCAGAAGGCUGGAUUGUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 306 (5’ACAAUCCAGCCUUCUGCAGA 3’) (37.4); xxxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 91 (5’UCUCUGUAGGCUCCACUAUGAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 256 (5’CAUAGUGGAGCCUACAGAGA3’) (34.8); (xxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:88 (5’UGAAACUGGGCAGCACGUACUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:253 (5’GUACGUGCUGCCCAGUUUCA 3’) (34.5); (xxxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:165 (5’UCUGCAGUAGGGCCAAGAGGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:330 (5’CCUCUUGGCCCUACUGCAGA3’) (33.3); (xxxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:140 (5’UCUGGAUUGUGGAGUAGUUCCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:305 (5’GAACUACUCCACAAUCCAGA 3’) (32.2); (xxxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:183 (5’UCUUUUCCUUCAGCUGUGACUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:348 (5’GUCACAGCUGAAGGAAAAGA 3’) (32.0); (xxxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:179 (5’UCUGUGAAACCCUCAUUUUCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:344 (5’GAAAAUGAGGGUUUCACAGA3’) (31.6); (xxxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:127 (5’UCAUUACUGUGACCUCGAAGGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:292 (5’CUUCGAGGUCACAGUAAUGA 3’) (31.2); (xxxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:185 (5’UGAGGUCGAAUUUAUUACAGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:350 (5’CUGUAAUAAAUUCGACCUCA 3’) (31.1); (xL) The antisense strand of the nucleic acid sequence according to SEQ ID NO:111 (5’UCAUUCGCAGGAGGAAGUUGAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:276 (5’CAACUUCCUCCUGCGAAUGA3’) (30.7); xLi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 157 (5’UGUAUCACGGGCGCAUCCUCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 322 (5’GAGGAUGCGCCCGUGAUACA3’) (29.7); xLii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 164 (5’UCAGCAAUGGCCACAGUGUAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 329 (5’UACACUGUGGCCAUUGCUGA 3’) (28.3); xLiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5’UCACUAUGACCUCGAAACUGGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 255 (5’CAGUUUCGAGGUCAUAGUGA3’) (27.5); xLiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 87 (5’UGUACUCCUUCACCUCAAACUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 252 (5’GUUUGAGGUGAAGGAGUACA3’) (26.9); xLv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 199 (5’UCUCAUACUUGGAGAUGUAUCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 364 (5’AUACAUCUCCAAGUAUGAGA3’) (26.7); xLvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 184 (5’UCUUAGCAUGGUACAUUGUCAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 349 (5’GACAAUGUACCAUGCUAAGA3’) (26.3); xLvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 400 (5’UUGUAGUUGCAGCAGUCCAGGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 426 (5’CUGGACUGCUGCAACUACAA3’) (41.9); xLiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5’UGAGGAAGUUGACGUUGAGGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 275 (5’CCUCAACGUCAACUUCCUCA 3’) (23.4); xLix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 147 (5’UGGCAUCCUCUGUCAUCUGGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 312 (5’CCAGAUGACAGAGGAUGCCA3’) (23.3); L) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 218 (5’UUUUUGUAUGAAGCAAUUCUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 383 (5’AGAAUUGCUUCAUACAAAAA 3’) (22.5); Li) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 138 (5’UGAUUGUGGAGUAGUUCCACCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 303 (5’GUGGAACUACUCCACAAUCA 3’) (22.5); Lii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 114 (5’UGAUGAAGUCGGUGGUGAUGGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 279 (5’CAUCACCACCGACUUCAUCA3’) (21.4); Liii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 85 (5’UCUCCUUCACCUCAAACUCAGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 250 (5’UGAGUUUGAGGUGAAGGAGA3’) (21.3); Liv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 152 (5’UCUUCUUGAUGAGCUCCAAGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 317 (5’CUUGGAGCUCAUCAAGAAGA3’) (20.8); Lv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 402 (5’UCUCAUCCAGGUUACUCCUGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 428 (5’CAGGAGUAACCUGGAUGAGA 3’) (40.4); Lvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 136 (5’UCUUGGUUCUGCCGGUAAUUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 301 (5’AAUUACCGGCAGAACCAAGA3’) (20.7); Lvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 209 (5’UGACCUUGUCCAGGUAGAUGAU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 374 (5’CAUCUACCUGGACAAGGUCA3’) (20.3); or Lviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 412 (5’UCUCUGGGAACUCACUUCGGGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 438 (5’CCGAAGUGAGUUCCCAGAGA3’) (30.4).

41. The isolated nucleotide according to claim 38, wherein the isolated oligonucleotide reduces the expression of C3 mRNA by at least 50% at a dose of 0.1 nM.

42. The isolated oligonucleotide according to claim 41, wherein the double-stranded region comprises: i) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 94 (5’UUAGAUGUAGUAGAAUUUCUCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 259 (5’AGAAAUUCUACUACAUCUAA 3’) (89.3); ii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 74 (5’UGACAAGGAGUCCUGCUUGACC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 239 (5’UCAAGCAGGACUCCUUGUCA3’) (80.4); iii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 70 (5’UUAGAUGGUCUUGUCUGUCUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 235 (5’AGACAGACAAGACCAUCUAA 3’) (79.7); iv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5’UUUUUUGCCUGGGAAGUCGUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 229 (5’ACGACUUCCCAGGCAAAAAA 3’) (78.7); v) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 172 (5’UUAGUAUCUCUGUUCAUUGAGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 337 (5’UCAAUGAACAGAGAUACUAA3’) (78.4); vi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 226 (5’UGUCAGUUGGGGCACCCAAAGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 391 (5’UUUGGGUGCCCCAACUGACA3’) (78.3); vii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 217 (5’UUUGUAUGAAGCAAUUCUCCUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5’GGAGAAUUGCUUCAUACAAA3’) (78.0); viii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 131 (5’UGAACAACAGAGUAGGGUAGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 296 (5’CUACCCUACUCUGUUGUUCA 3’) (77.9); ix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 (5’UAUCAGGUAGGUGUAGUAGCGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 278 (5’GCUACUACACCUACCUGAUA3’) (77.8); x) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 (5’UAUUACUGUGACCUCGAAGGGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 291 (5’CCUUCGAGGUCACAGUAAUA3’) (77.6); xi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 146 (5’UGAAUUCUGGUCUCAGACUCGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 311 (5’GAGUCUGAGACCAGAAUUCA 3’) (77.6); xii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 170 (5’UGUAUCUCUGUUCAUUGAGCCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 335 (5’GCUCAAUGAACAGAGAUACA3’) (76.8); xiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 123 (5’UUUUCAAAAAUAUAUUCAUGAG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 288 (5’CAUGAAUAUAUUUUUGAAAA3’) (76.6); xiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:93 (5’UAGUAGAAUUUCUCUGUAGGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:258 (5’CCUACAGAGAAAUUCUACUA 3’) (76.5); xv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:124 (5’UCUUUCAAAAAUAUAUUCAUGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:289 (5’AUGAAUAUAUUUUUGAAAGA3’) (76.1); xvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:198 (5’UCAUACUUGGAGAUGUAUCUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:363 (5’AGAUACAUCUCCAAGUAUGA 3’) (76.0); xvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:145 (5’UAAUUCUGGUCUCAGACUCGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:310 (5’CGAGUCUGAGACCAGAAUUA 3’) (75.5); xviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:188 (5’UGUUUUAUGGUGACCUUGAGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:353 (5’CUCAAGGUCACCAUAAAACA3’) (75.5); xix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:67 (5’UCUGUCUGGAUGAAGAGGUACC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:232 (5’UACCUCUUCAUCCAGACAGA3’) (75.1); xx) The antisense strand of the nucleic acid sequence according to SEQ ID NO:72 (5’UUGUAGAUGGUCUUGUCUGUCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:237 (5’ACAGACAAGACCAUCUACAA3’) (75.0); xxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:159 (5’UAAGGAAGUCUCCUGCUUUAGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:324 (5’UAAAGCAGGAGACUUCCUUA 3’) (74.7); xxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 181 (5’UUUCCUUCAGCUGUGACUGUGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 346 (5’ACAGUCACAGCUGAAGGAAA 3’) (74.6); xxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 108 (5’UGAGAUGCAGGUAAUUGUUGGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 273 (5’CAACAAUUACCUGCAUCUCA3’) (74.6); xxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 96 (5’UAGAUGACAAAGGCAGUUCCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 261 (5’GGAACUGCCUUUGUCAUCUA 3’) (74.0); xxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 129 (5’UGAAGAAGUCCUGCAUUACUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 294 (5’AGUAAUGCAGGACUUCUUCA 3’) (72.9); xxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 196 (5’UUACUUGGAGAUGUAUCUGUCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 361 (5’ACAGAUACAUCUCCAAGUAA 3’) (72.5); xxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 122 (5’UUUCAAAAAUAUAUUCAUGAGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 287 (5’UCAUGAAUAUAUUUUUGAAA3’) (72.4); xxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 160 (5’UUUCAUGUAGUUGGCUUCAAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 325 (5’UUGAAGCCAACUACAUGAAA3’) (72.2); xxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 162 (5’UAUCUCUGUAGGUUCAUGUAGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 327 (5’UACAUGAACCUACAGAGAUA3’) (71.9); (xxx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 104 (5’UGUGUUGAUGCUGAGUUUGGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 269 (5’CCAAACUCAGCAUCAACACA 3’) (71.7); (xxxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 201 (5’UCUUUGUCCAGCUCAUACUUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 366 (5’AAGUAUGAGCUGGACAAAGA 3’) (71.3); (xxxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5’UUUUUGCCUGGGAAGUCGUGGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 228 (5’CACGACUUCCCAGGCAAAAA3’) (71.1); (xxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 178 (5’UCAUUUUCCUUGGUCUCUUCUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 343 (5’GAAGAGACCAAGGAAAAUGA3’) (71.0); (xxxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 203 (5’UUUCCUAUCGGAGAAGGCUUUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 368 (5’AAGCCUUCUCCGAUAGGAAA3’) (70.9); (xxxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 216 (5’UGAAGCAAUUCUCCUCAGCACA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5’UGCUGAGGAGAAUUGCUUCA3’) (70.9); (xxxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 220 (5’UGUACACAUAGUCCACUCCUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5’AGGAGUGGACUAUGUGUACA 3’) (70.5); (xxxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 118 (5’UUAUCUUCAGGGUCAUCUGCUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 283 (5’GCAGAUGACCCUGAAGAUAA 3’) (70.4); (xxxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 194 (5’UUAGACAUAGUGGCAUCCUGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 359 (5’CAGGAUGCCACUAUGUCUAA3’) (70.3); (xxxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 219 (5’UUACACAUAGUCCACUCCUGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5’CAGGAGUGGACUAUGUGUAA3’) (69.8); (xL) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5’UGUCUUGGUGAAGUGGAUCUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 264 (5’AGAUCCACUUCACCAAGACA 3’) (69.0); (xLi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 154 (5’UAAGACCUUGACCACGUAGGCG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 319 (5’CCUACGUGGUCAAGGUCUUA3’) (68.7); (xLii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 171 (5’UAGUAUCUCUGUUCAUUGAGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 336 (5’CUCAAUGAACAGAGAUACUA3’) (68.7); (xLiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 195 (5’UCAGUCAUCAUGGAUAUGUCCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 360 (5’GACAUAUCCAUGAUGACUGA3’) (68.7); (xLiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 73 (5’UGUGUAGAUGGUCUUGUCUGUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 238 (5’CAGACAAGACCAUCUACACA3’) (68.3); (xLv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 180 (5’UUUCAGCUGUGACUGUGAAACC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 345 (5’UUUCACAGUCACAGCUGAAA 3’) (68.3); xLvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:92 (5’UUUCUCUGUAGGCUCCACUAUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:257 (5’UAGUGGAGCCUACAGAGAAA3’) (67.8); xLvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:75 (5’UAAGACAAGGAGUCCUGCUUGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:240 (5’AAGCAGGACUCCUUGUCUUA 3’) (67.3); xLviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:137 (5’UGUAGUUCCACCCUCACCUUGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:302 (5’AAGGUGAGGGUGGAACUACA 3’) (66.3); xLix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:89 (5’UCUAUGACCUCGAAACUGGGCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:254 (5’CCCAGUUUCGAGGUCAUAGA3’) (66.2); L) The antisense strand of the nucleic acid sequence according to SEQ ID NO:130 (5’UGAUGAAGAAGUCCUGCAUUAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:295 (5’AAUGCAGGACUUCUUCAUCA3’) (66.1); Li) The antisense strand of the nucleic acid sequence according to SEQ ID NO:69 (5’UUUGUCUGUCUGGAUGAAGAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:234 (5’UCUUCAUCCAGACAGACAAA 3’) (66.1); Lii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:176 (5’UUUUUCCUUGGUCUCUUCUGAU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:341 (5’CAGAAGAGACCAAGGAAAAA 3’) (65.9); Liii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:100 (5’UGAGGUCAAAGGGCAUUCCUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:265 (5’AGGAAUGCCCUUUGACCUCA3’) (65.7); (Liv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5’UUUCAUAGUAGGCUCGGAUCUU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 247 (5’GAUCCGAGCCUACUAUGAAA3’) (65.6); (Lv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 212 (5’UGUAAUAGGCGUAGACCUUGAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 377 (5’CAAGGUCUACGCCUAUUACA3’) (65.6); (Lvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 191 (5’UAUCAUAGUGUUCUUGGCAUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 356 (5’AUGCCAAGAACACUAUGAUA 3’) (65.4); (Lvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 161 (5’UUGUAGGUUCAUGUAGUUGGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 326 (5’CCAACUACAUGAACCUACAA3’) (65.4); (Lviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 112 (5’UGUGUAGUAGCGGAUCUUGGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 277 (5’CCAAGAUCCGCUACUACACA3’) (65.2); (Lix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 151 (5’UUUCUUGAUGAGCUCCAAGGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 316 (5’CCUUGGAGCUCAUCAAGAAA 3’) (65.0); (Lx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 213 (5’UGUUGUAAUAGGCGUAGACCUU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 378 (5’GGUCUACGCCUAUUACAACA3’) (64.9); (Lxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 206 (5’UGAUGAUGAGGGUGUUCCUAUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5’UAGGAACACCCUCAUCAUCA3’) (63.8); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 155 (5’UGAGAGAAGACCUUGACCACGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 320 (5’GUGGUCAAGGUCUUCUCUCA3’) (63.5); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 143 (5’UUUGUUCAUUCUGAUUCCUUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 308 (5’AAGGAAUCAGAAUGAACAAA3’) (63.1); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 193 (5’UCAAGGAUCAUAGUGUUCUUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 358 (5’AAGAACACUAUGAUCCUUGA 3’) (63.0); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 163 (5’UCAGUGUAGGAUCUCUGUAGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 328 (5’CUACAGAGAUCCUACACUGA 3’) (62.8); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 149 (5’UUUCAUCCAGGUAAUGCACAGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 314 (5’UGUGCAUUACCUGGAUGAAA3’) (62.4); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 200 (5’UUUUGUCCAGCUCAUACUUGGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 365 (5’CAAGUAUGAGCUGGACAAAA3’) (61.6); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 210 (5’UCUCAGAGUGUGAGACCUUGUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5’CAAGGUCUCACACUCUGAGA3’) (61.5); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 215 (5’UUGUUCAGCUUUCCAUCCUCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 380 (5’GAGGAUGGAAAGCUGAACAA 3’) (61.4); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 98 (5’ UCUUGGUGAAGUGGAUCUGGUA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 263 (5’ CCAGAUCCACUUCACCAAGA 3’) (61.3); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 182 (5’ UUUUUCCUUCAGCUGUGACUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 347 (5’ AGUCACAGCUGAAGGAAAAA 3’) (61.0); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 150 (5’ UGUUUCAUCCAGGUAAUGCACA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 315 (5’ UGCAUUACCUGGAUGAAACA 3’) (61.0); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 223 (5’ UAUGAUGUACUCGUCAAAGUCA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 388 (5’ ACUUUGACGAGUACAUCAUA 3’) (60.9); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 177 (5’ UAUUUUCCUUGGUCUCUUCUGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 342 (5’ AGAAGAGACCAAGGAAAAUA 3’) (60.7); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 128 (5’ UGAAGUCCUGCAUUACUGUGAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 293 (5’ CACAGUAAUGCAGGACUUCA 3’) (60.4); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 224 (5’ UCUCAUCCGAGCCUGACUUGAU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 389 (5’ CAAGUCAGGCUCGGAUGAGA 3’) (59.9); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 205 (5’ UAUGAUGAGGGUGUUCCUAUCG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 370 (5’ AUAGGAACACCCUCAUCAUA 3’) (59.9); Lxxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 186 (5’UUUUAUGGUGACCUUGAGGUCG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 351 (5’ACCUCAAGGUCACCAUAAAA3’) (59.3); Lxxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 77 (5’UGACGAGUUCCGGAAUGUCCCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 242 (5’GGACAUUCCGGAACUCGUCA3’) (59.1); Lxxx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 197 (5’UAUACUUGGAGAUGUAUCUGUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 362 (5’CAGAUACAUCUCCAAGUAUA3’) (59.1); Lxxxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5’UGUUAUAGAUGUAGUAGAAUUU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 260 (5’AUUCUACUACAUCUAUAACA3’) (57.9); Lxxxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 78 (5’UUUGACGAGUUCCGGAAUGUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 243 (5’ACAUUCCGGAACUCGUCAAA3’) (56.6); Lxxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 101 (5’UAACACCAUGAGGUCAAAGGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 266 (5’CCUUUGACCUCAUGGUGUUA3’) (56.2); Lxxxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5’UGUUGACGAGUUCCGGAAUGUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 244 (5’CAUUCCGGAACUCGUCAACA3’) (56.2); Lxxxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 221 (5’UGUCUUGUACACAUAGUCCACU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 386 (5’UGGACUAUGUGUACAAGACA3’) (55.7); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 167 (5’UGUCUUUUAGCUGCAGUAGGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 332 (5’CCUACUGCAGCUAAAAGACA3’) (55.7); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 84 (5’UCAAACUCAGUGGAGAAGACCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 249 (5’GUCUUCUCCACUGAGUUUGA3’) (55.3); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 144 (5’UGUUUUGUUCAUUCUGAUUCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 309 (5’GAAUCAGAAUGAACAAAACA3’) (55.1); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 166 (5’UUCUUUUAGCUGCAGUAGGGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 331 (5’CCCUACUGCAGCUAAAAGAA3’) (54.9); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 76 (5’UUUCUGAGAAGACAAGGAGUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 241 (5’ACUCCUUGUCUUCUCAGAAA 3’) (54.9); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 204 (5’UGUGUUCCUAUCGGAGAAGGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 369 (5’CCUUCUCCGAUAGGAACACA3’) (54.9); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 211 (5’UCAUCCUCAGAGUGUGAGACCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 376 (5’GUCUCACACUCUGAGGAUGA 3’) (54.7); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 132 (5’UUUUCGAACAACAGAGUAGGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 297 (5’CCUACUCUGUUGUUCGAAAA3’) (54.3); xciv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 142 (5’UGGAUGGUUACGGUCUGCUGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 307 (5’CAGCAGACCGUAACCAUCCA3’) (53.9); xcv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 148 (5’UCAGGUAAUGCACAGCGAUGAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 313 (5’CAUCGCUGUGCAUUACCUGA 3’) (53.9); xcvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 207 (5’UGUAGAUGAUGAGGGUGUUCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 372 (5’GAACACCCUCAUCAUCUACA3’) (53.5); xcvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 86 (5’UUACUCCUUCACCUCAAACUCA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 251 (5’AGUUUGAGGUGAAGGAGUAA 3’) (53.2); xcviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 192 (5’UAAGGAUCAUAGUGUUCUUGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 357 (5’CAAGAACACUAUGAUCCUUA3’) (52.6); xcix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 175 (5’UCAGAUUCCCAGUGGAUACGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 340 (5’CGUAUCCACUGGGAAUCUGA 3’) (52.4); c) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 187 (5’UUUUUAUGGUGACCUUGAGGUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 352 (5’CCUCAAGGUCACCAUAAAAA 3’) (52.4); ci) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 109 (5’UCUGAGAGAUGCAGGUAAUUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 274 (5’AAUUACCUGCAUCUCUCAGA 3’) (52.2); cii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 102 (5’UGACUCGGUAGGCUGGAGAGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 267 (5’CUCUCCAGCCUACCGAGUCA3’) (51.9); ciii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 121 (5’UCAAAAAUAUAUUCAUGAGCUU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 286 (5’GCUCAUGAAUAUAUUUUUGA3’) (51.8); civ) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 134 (5’UGAUUUCCACCUGCUCGUUUCG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 299 (5’AAACGAGCAGGUGGAAAUCA 3’) (51.4); cv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 135 (5’UUUGGUUCUGCCGGUAAUUGUA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 300 (5’CAAUUACCGGCAGAACCAAA 3’) (51.0); cvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 105 (5’UGAUGCUCAAGGGCUUCUGGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 270 (5’CCAGAAGCCCUUGAGCAUCA 3’) (50.7); cvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 125 (5’UGUCUUUCAAAAAUAUAUUCAU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 290 (5’GAAUAUAUUUUUGAAAGACA3’) (50.3); cviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 190 (5’UGUGUUCUUGGCAUCCUGAGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 355 (5’CUCAGGAUGCCAAGAACACA3’) (50.2); cix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 119 (5’UAUGUAGUUGCAGCAGUCCAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 284 (5’UGGACUGCUGCAACUACAUA 3’) (70.4); (cx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 120 (5’UGUGAUGUAGUUGCAGCAGUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 285 (5’ACUGCUGCAACUACAUCACA 3’) (67.2); or (cxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 394 (5’UAAAUAUAUUCAUGAGCUUCGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 420 (5’GAAGCUCAUGAAUAUAUUUA3’) (50.6).

43. The isolated oligonucleotide according to any one of claims 38 - 42, wherein the isolated oligonucleotide reduces the expression of C3 mRNA by 20% to 50% at a dose of 0.01 nM.

44. The isolated oligonucleotide according to claim 43, wherein the double-stranded region comprises: (i) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 96 (5’UAGAUGACAAAGGCAGUUCCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 261 (5’GGAACUGCCUUUGUCAUCUA3’) (45.5); (ii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 217 (5’UUUGUAUGAAGCAAUUCUCCUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5’GGAGAAUUGCUUCAUACAAA3’) (45.3); (iii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 70 (5’UUAGAUGGUCUUGUCUGUCUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 235 (5’AGACAGACAAGACCAUCUAA3’) (44.9); (iv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 198 (5’UCAUACUUGGAGAUGUAUCUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 363 (5’AGAUACAUCUCCAAGUAUGA 3’) (44.7); (v) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 (5’UAUCAGGUAGGUGUAGUAGCGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 278 (5’GCUACUACACCUACCUGAUA3’) (42.9); (vi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 (5’UAUUACUGUGACCUCGAAGGGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 291 (5’CCUUCGAGGUCACAGUAAUA3’) (42.3); (vii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 170 (5’UGUAUCUCUGUUCAUUGAGCCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 335 (5’GCUCAAUGAACAGAGAUACA3’) (42.0); (viii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 123 (5’UUUUCAAAAAUAUAUUCAUGAG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 288 (5’CAUGAAUAUAUUUUUGAAAA3’) (41.7); (ix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 226 (5’UGUCAGUUGGGGCACCCAAAGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 391 (5’UUUGGGUGCCCCAACUGACA3’) (41.5); (x) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5’UCUGUCUGGAUGAAGAGGUACC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 232 (5’UACCUCUUCAUCCAGACAGA3’) (41.1); (xi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 172 (5’UUAGUAUCUCUGUUCAUUGAGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 337 (5’UCAAUGAACAGAGAUACUAA3’) (41.0); (xii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 74 (5’UGACAAGGAGUCCUGCUUGACC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 239 (5’UCAAGCAGGACUCCUUGUCA3’) (40.6); (xiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5’UUUUUUGCCUGGGAAGUCGUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 229 (5’ACGACUUCCCAGGCAAAAAA 3’) (39.5); (xiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 181 (5’UUUCCUUCAGCUGUGACUGUGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 346 (5’ACAGUCACAGCUGAAGGAAA3’) (39.2); (xv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 131 (5’UGAACAACAGAGUAGGGUAGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 296 (5’CUACCCUACUCUGUUGUUCA 3’) (39.1); (xvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 196 (5’UUACUUGGAGAUGUAUCUGUCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 361 (5’ACAGAUACAUCUCCAAGUAA 3’) (38.8); (xvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 129 (5’UGAAGAAGUCCUGCAUUACUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 294 (5’AGUAAUGCAGGACUUCUUCA3’) (38.5); (xviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 212 (5’UGUAAUAGGCGUAGACCUUGAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 377 (5’CAAGGUCUACGCCUAUUACA3’) (37.7); (xix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 93 (5’UAGUAGAAUUUCUCUGUAGGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 258 (5’CCUACAGAGAAAUUCUACUA 3’) (37.2); (xx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 194 (5’UUAGACAUAGUGGCAUCCUGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 359 (5’CAGGAUGCCACUAUGUCUAA 3’) (37.1); (xxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 154 (5’UAAGACCUUGACCACGUAGGCG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 319 (5’CCUACGUGGUCAAGGUCUUA 3’) (36.6); xxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 108 (5’UGAGAUGCAGGUAAUUGUUGGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 273 (5’CAACAAUUACCUGCAUCUCA3’) (36.6); xxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 72 (5’UUGUAGAUGGUCUUGUCUGUCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 237 (5’ACAGACAAGACCAUCUACAA3’) (36.4); xxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 78 (5’UUUGACGAGUUCCGGAAUGUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 243 (5’ACAUUCCGGAACUCGUCAAA 3’) (36.3); xxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 211 (5’UCAUCCUCAGAGUGUGAGACCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 376 (5’GUCUCACACUCUGAGGAUGA3’) (35.6); xxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 188 (5’UGUUUUAUGGUGACCUUGAGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 353 (5’CUCAAGGUCACCAUAAAACA3’) (35.6); xxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 124 (5’UCUUUCAAAAAUAUAUUCAUGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 289 (5’AUGAAUAUAUUUUUGAAAGA 3’) (35.5); xxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 159 (5’UAAGGAAGUCUCCUGCUUUAGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 324 (5’UAAAGCAGGAGACUUCCUUA 3’) (35.5); xxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 208 (5’UCUUGUCCAGGUAGAUGAUGAG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5’CAUCAUCUACCUGGACAAGA3’) (33.9); (xxx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 137 (5’UGUAGUUCCACCCUCACCUUGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 302 (5’AAGGUGAGGGUGGAACUACA3’) (33.6); (xxxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 122 (5’UUUCAAAAAUAUAUUCAUGAGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 287 (5’UCAUGAAUAUAUUUUUGAAA3’) (33.4); (xxxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5’UUUUUGCCUGGGAAGUCGUGGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 228 (5’CACGACUUCCCAGGCAAAAA3’) (33.2); (xxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 219 (5’UUACACAUAGUCCACUCCUGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5’CAGGAGUGGACUAUGUGUAA3’) (32.9); (xxxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 195 (5’UCAGUCAUCAUGGAUAUGUCCA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 360 (5’GACAUAUCCAUGAUGACUGA3’) (32.5); (xxxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5’UGUUAUAGAUGUAGUAGAAUUU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 260 (5’AUUCUACUACAUCUAUAACA3’) (32.3); (xxxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 146 (5’UGAAUUCUGGUCUCAGACUCGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 311 (5’GAGUCUGAGACCAGAAUUCA3’) (32.2); (xxxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 220 (5’UGUACACAUAGUCCACUCCUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5’AGGAGUGGACUAUGUGUACA3’) (32.1); (xxxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 151 (5’UUUCUUGAUGAGCUCCAAGGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 316 (5’CCUUGGAGCUCAUCAAGAAA3’) (31.9); (xxxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 118 (5’UUAUCUUCAGGGUCAUCUGCUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 283 (5’GCAGAUGACCCUGAAGAUAA 3’) (31.9); (xL) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 180 (5’UUUCAGCUGUGACUGUGAAACC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 345 (5’UUUCACAGUCACAGCUGAAA3’) (31.8); (xLi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 210 (5’UCUCAGAGUGUGAGACCUUGUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5’CAAGGUCUCACACUCUGAGA3’) (31.7); (xLii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 187 (5’UUUUUAUGGUGACCUUGAGGUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 352 (5’CCUCAAGGUCACCAUAAAAA3’) (31.7); (xLiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 162 (5’UAUCUCUGUAGGUUCAUGUAGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 327 (5’UACAUGAACCUACAGAGAUA 3’) (31.3); (xLiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 145 (5’UAAUUCUGGUCUCAGACUCGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 310 (5’CGAGUCUGAGACCAGAAUUA 3’) (30.9); (xLv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 201 (5’UCUUUGUCCAGCUCAUACUUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 366 (5’AAGUAUGAGCUGGACAAAGA3’) (30.3); xLvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:81 (5’UCAUAGUAGGCUCGGAUCUUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:246 (5’AAGAUCCGAGCCUACUAUGA 3’) (29.9); xLvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:206 (5’UGAUGAUGAGGGUGUUCCUAUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:371 (5’UAGGAACACCCUCAUCAUCA3’) (29.7); xLviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:215 (5’UUGUUCAGCUUUCCAUCCUCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:380 (5’GAGGAUGGAAAGCUGAACAA3’) (29.5); xLix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:213 (5’UGUUGUAAUAGGCGUAGACCUU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:378 (5’GGUCUACGCCUAUUACAACA3’) (29.3); L) The antisense strand of the nucleic acid sequence according to SEQ ID NO:189 (5’UCUGUUUCCGGUGCUGGUUUUA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:354 (5’AAACCAGCACCGGAAACAGA3’) (28.9); Li) The antisense strand of the nucleic acid sequence according to SEQ ID NO:207 (5’UGUAGAUGAUGAGGGUGUUCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:372 (5’GAACACCCUCAUCAUCUACA 3’) (28.3); Lii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:139 (5’UGGAUUGUGGAGUAGUUCCACC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:304 (5’UGGAACUACUCCACAAUCCA3’) (27.5); Liii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:143 (5’UUUGUUCAUUCUGAUUCCUUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:308 (5’AAGGAAUCAGAAUGAACAAA3’) (27.4); (Liv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 178 (5’UCAUUUUCCUUGGUCUCUUCUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 343 (5’GAAGAGACCAAGGAAAAUGA3’) (27.4); (Lv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 128 (5’UGAAGUCCUGCAUUACUGUGAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 293 (5’CACAGUAAUGCAGGACUUCA 3’) (27.3); (Lvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 160 (5’UUUCAUGUAGUUGGCUUCAAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 325 (5’UUGAAGCCAACUACAUGAAA 3’) (27.3); (Lvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 176 (5’UUUUUCCUUGGUCUCUUCUGAU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 341 (5’CAGAAGAGACCAAGGAAAAA3’) (27.2); (Lviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 80 (5’UCUUCCACUGGCCCAUGUUGAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 245 (5’CAACAUGGGCCAGUGGAAGA3’) (27.0); (Lix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 203 (5’UUUCCUAUCGGAGAAGGCUUUG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 368 (5’AAGCCUUCUCCGAUAGGAAA 3’) (26.9); (Lx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 87 (5’UGUACUCCUUCACCUCAAACUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 252 (5’GUUUGAGGUGAAGGAGUACA 3’) (26.3); (Lxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 104 (5’UGUGUUGAUGCUGAGUUUGGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 269 (5’CCAAACUCAGCAUCAACACA3’) (26.1); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5’UUUGUCUGUCUGGAUGAAGAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 234 (5’UCUUCAUCCAGACAGACAAA3’) (25.9); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 197 (5’UAUACUUGGAGAUGUAUCUGUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 362 (5’CAGAUACAUCUCCAAGUAUA 3’) (25.9); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 223 (5’UAUGAUGUACUCGUCAAAGUCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 388 (5’ACUUUGACGAGUACAUCAUA3’) (25.8); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 142 (5’UGGAUGGUUACGGUCUGCUGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 307 (5’CAGCAGACCGUAACCAUCCA 3’) (25.5); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 138 (5’UGAUUGUGGAGUAGUUCCACCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 303 (5’GUGGAACUACUCCACAAUCA3’) (25.4); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 75 (5’UAAGACAAGGAGUCCUGCUUGA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 240 (5’AAGCAGGACUCCUUGUCUUA3’) (25.2); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 163 (5’UCAGUGUAGGAUCUCUGUAGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 328 (5’CUACAGAGAUCCUACACUGA3’) (24.6); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 116 (5’UUUCUGACUGGCCGCUUUUUAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 281 (5’AAAAAGCGGCCAGUCAGAAA3’) (24.6); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 112 (5’UGUGUAGUAGCGGAUCUUGGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 277 (5’CCAAGAUCCGCUACUACACA3’) (24.4); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 204 (5’UGUGUUCCUAUCGGAGAAGGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 369 (5’CCUUCUCCGAUAGGAACACA3’) (24.4); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 169 (5’UCACAAAGUCAAAGUCUUUUAG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 334 (5’AAAAGACUUUGACUUUGUGA3’) (24.4); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5’UGUCUUGGUGAAGUGGAUCUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 264 (5’AGAUCCACUUCACCAAGACA 3’) (24.4); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 140 (5’UCUGGAUUGUGGAGUAGUUCCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 305 (5’GAACUACUCCACAAUCCAGA3’) (24.4); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 130 (5’UGAUGAAGAAGUCCUGCAUUAC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 295 (5’AAUGCAGGACUUCUUCAUCA3’) (24.3); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5’UGUCUGUCUGGAUGAAGAGGUA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 233 (5’CCUCUUCAUCCAGACAGACA3’) (24.2); The antisense strand of the nucleic acid sequence according to SEQ ID NO: 73 (5’UGUGUAGAUGGUCUUGUCUGUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 238 (5’CAGACAAGACCAUCUACACA3’) (23.9); Lxxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 100 (5’UGAGGUCAAAGGGCAUUCCUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 265 (5’AGGAAUGCCCUUUGACCUCA3’) (23.9); Lxxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 205 (5’UAUGAUGAGGGUGUUCCUAUCG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 370 (5’AUAGGAACACCCUCAUCAUA3’) (23.9); Lxxx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 119 (5’UAUGUAGUUGCAGCAGUCCAGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 284 (5’UGGACUGCUGCAACUACAUA 3’) (23.8); Lxxxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5’UUUCAUAGUAGGCUCGGAUCUU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 247 (5’GAUCCGAGCCUACUAUGAAA3’) (23.5); Lxxxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5’UGUUGACGAGUUCCGGAAUGUC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 244 (5’CAUUCCGGAACUCGUCAACA3’) (23.2); Lxxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 171 (5’UAGUAUCUCUGUUCAUUGAGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 336 (5’CUCAAUGAACAGAGAUACUA3’) (23.1); Lxxxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 182 (5’UUUUUCCUUCAGCUGUGACUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 347 (5’AGUCACAGCUGAAGGAAAAA 3’) (23.1); Lxxxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 153 (5’UUGAAGGCCAGCUGCUGGGUGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 318 (5’ACCCAGCAGCUGGCCUUCAA3’) (22.9); Lxxxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 186 (5’UUUUAUGGUGACCUUGAGGUCG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 351 (5’ACCUCAAGGUCACCAUAAAA3’) (22.9); Lxxxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 191 (5’UAUCAUAGUGUUCUUGGCAUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 356 (5’AUGCCAAGAACACUAUGAUA3’) (22.4); Lxxxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 141 (5’UCUGCAGAAGGCUGGAUUGUGG 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 306 (5’ACAAUCCAGCCUUCUGCAGA3’) (21.7); Lxxxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 144 (5’UGUUUUGUUCAUUCUGAUUCCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 309 (5’GAAUCAGAAUGAACAAAACA3’) (21.5); XC) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 200 (5’UUUUGUCCAGCUCAUACUUGGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 365 (5’CAAGUAUGAGCUGGACAAAA 3’) (21.1); XCi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 89 (5’UCUAUGACCUCGAAACUGGGCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 254 (5’CCCAGUUUCGAGGUCAUAGA 3’) (20.8); XCii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 120 (5’UGUGAUGUAGUUGCAGCAGUCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 285 (5’ACUGCUGCAACUACAUCACA3’) (20.8); XCiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 86 (5’UUACUCCUUCACCUCAAACUCA3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 251 (5’AGUUUGAGGUGAAGGAGUAA3’) (20.8); XCiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 166 (5’ UUCUUUUAGCUGCAGUAGGGCC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 331 (5’ CCCUACUGCAGCUAAAAGAA 3’) (20.6); XCv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 101 (5’ UAACACCAUGAGGUCAAAGGGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 266 (5’ CCUUUGACCUCAUGGUGUUA 3’) (20.6); XCvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 161 (5’ UUGUAGGUUCAUGUAGUUGGCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 326 (5’ CCAACUACAUGAACCUACAA 3’) (20.4); XCvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 175 (5’ UCAGAUUCCCAGUGGAUACGGU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 340 (5’ CGUAUCCACUGGGAAUCUGA 3’) (20.3); XCviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 149 (5’ UUUCAUCCAGGUAAUGCACAGC 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 314 (5’ UGUGCAUUACCUGGAUGAAA 3’) (20.2); XCix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 214 (5’ UGGUUGUAAUAGGCGUAGACCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5’ GUCUACGCCUAUUACAACCA 3’) (20.2); or C) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5’ UGACAGUGCAGGGUCAGAGGGA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 227 (5’ CCUCUGACCCUGCACUGUCA 3’) (19.9).

45. The isolated oligonucleotide according to any one of claims 38 - 42, wherein the isolated oligonucleotide reduces the expression of C3 mRNA by at least 50% at a dose of 0.01 nM.

46. The isolated oligonucleotide according to claim 45, wherein the double-stranded region comprises: i) The antisense strand of the nucleic acid sequence according to SEQ ID NO:94 (5’UUAGAUGUAGUAGAAUUUCUCU 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:259 (5’AGAAAUUCUACUACAUCUAA3’) (79.3); or ii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:216 (5’UGAAGCAAUUCUCCUCAGCACA 3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:381 (5’UGCUGAGGAGAAUUGCUUCA 3’) (51.6).

47. The isolated oligonucleotide according to any one of claims 1 - 46, wherein the sense strand or the antisense strand or both contain one or more modified nucleotides.

48. The isolated oligonucleotide according to claim 47, wherein the antisense strand contains a monomethyl protected phosphoramidate (5’-MeEP).

49. The isolated oligonucleotide according to any one of claims 1 - 48, wherein in the sense strand or the antisense strand or both, the terminal nucleotide or internal nucleotides are linked to a targeting ligand.

50. The isolated oligonucleotide according to claim 49, wherein the targeting ligand contains at least one GalNAcG1b moiety.

51. The isolated oligonucleotide according to any one of claims 1 - 50, wherein the antisense strand contains nucleotides modified with 2’-F modification and nucleotides modified with 2’-O-methyl modification according to the following formula: 3’(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5’.

52. The isolated oligonucleotide according to any one of claims 1 - 51, wherein the sense strand contains nucleotides modified with 2’-F modification and nucleotides modified with 2’-O-methyl modification according to the following formula: 5’(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3’.

53. The isolated oligonucleotide according to any one of claims 1 - 52, wherein the antisense strand contains any one of the following: i) The antisense strand of the nucleic acid sequence according to SEQ ID NO:451 (5’[mUs][fUs][fA][mG][fU][mA][fG][mA][mA][fU][mU][mU][mC][fU][mC][fU][mG][mU][mA][m Gs][mGs][mC]3’); ii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:452 (5’[mUs][fGs][fU][mA][fG][mU][fA][mG][mA][fA][mU][mU][mU][fC][mU][fC][mU][mG][mU][m As][mGs][mG]3’); iii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:453 (5’[mUs][fAs][fU][mG][fU][mA][fG][mU][mA][fG][mA][mA][mU][fU][mU][fC][mU][mC][mU][m Gs][mUs][mA]3’), iv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:454 (5’[mUs][fAs][fU][mA][fG][mA][fU][mG][mU][fA][mG][mU][mA][fG][mA][fA][mU][mU][mU][m Cs][mUs][mC]3’); v) The antisense strand of the nucleic acid sequence according to SEQ ID NO:455 (5’[mUs][fAs][fU][mG][fA][mA][fG][mC][mA][fA][mU][mU][mC][fU][mC][fC][mU][mC][mA][m Gs][mCs][mA]3’); vi) The antisense strand of the nucleic acid sequence according to SEQ ID NO:456 (5’[mUs][fUs][fU][mU][fG][mU][fA][mU][mG][fA][mA][mG][mC][fA][mA][fU][mU][mC][mU][m Cs][mCs][mU]3’), vii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:457 (5’[MeEPmUs][fUs][fA][mG][fU][mA][fG][mA][mA][fU][mU][mU][mC][fU][mC][fU][mG][mU][m A][mGs][mGs][mC]3’); viii) The antisense strand of the nucleic acid sequence according to SEQ ID NO:458 (5’[MeEPmUs][fGs][fU][mA][fG][mU][fA][mG][mA][fA][mU][mU][mU][fC][mU][fC][mU][mG][m U][mAs][mGs][mG]3’); or ix) The antisense strand of the nucleic acid sequence according to SEQ ID NO:459 (5’[MeEPmUs][fAs][fU][mG][fU][mA][fG][mU][mA][fG][mA][mA][mU][fU][mU][fC][mU][mC][m U][mGs][mUs][mA]3’), where "m" is a 2’-O-methyl modified nucleotide, "f" is a 2’-F modified nucleotide, "s" is a phosphorothioate nucleotide internucleoside linkage, and "MeEP" is a monomethyl protected phosphate mimic.

54. The isolated oligonucleotide according to any one of claims 1-53, wherein the sense strand comprises any of the following: i) The sense strand of the nucleic acid sequence according to SEQ ID NO:444 (5’[mCs][mUs][mA][mC][mA][fG][mA][fG][fA][fA][fA][mU][mU][mC][mU][mA][mC][mUs][mAs][mA][G1b][G1b][G1b]3’); ii) The sense strand of the nucleic acid sequence according to SEQ ID NO:445 (5’[mUs][mAs][mC][mA][mG][fA][mG][fA][fA][fA][fU][mU][mC][mU][mA][mC][mU][mAs][mCs][mA][G1b][G1b][G1b]3’); iii) The sense strand of the nucleic acid sequence according to SEQ ID NO:446 (5’[mCs][mAs][mG][mA][mG][fA][mA][fA][fU][fU][fC][mU][mA][mC][mU][mA][mC][mAs][mUs][mA][G1b][G1b][G1b]3’), iv) The sense strand of the nucleic acid sequence according to SEQ ID NO:447 (5’[mGs][mAs][mA][mA][mU][fU][mC][fU][fA][fC][fU][mA][mC][mA][mU][mC][mU][mAs][mUs][mA][G1b][G1b][G1b]3’); v) The sense strand of the nucleic acid sequence according to SEQ ID NO:448 (5’[mCs][mUs][mG][mA][mG][fG][mA][fG][fA][fA][fU][mU][mG][mC][mU][mU][mC][mAs][mUs][mA][G1b][G1b][G1b]3’); or vi) The sense strand of the nucleic acid sequence according to SEQ ID NO:449 (5’[mGs][mAs][mG][mA][mA][fU][mU][fG][fC][fU][fU][mC][mA][mU][mA][mC][mA][mAs][mAs][mA][G1b][G1b][G1b]3’), wherein "m" is a 2’-O-methyl modified nucleotide, "f" is a 2’-F modified nucleotide, "s" is a phosphorothioate nucleotide internucleoside linkage, and "G1b" is a GalNac G1b moiety.

55. The isolated oligonucleotide according to claim 45, wherein the double-stranded region comprises: i) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 451 (5’[mUs][fUs][fA][mG][fU][mA][fG][mA][mA][fU][mU][mU][mC][fU][mC][fU][mG][mU][mA][mGs][mGs][mC]3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 444 (5’[mCs][mUs][mA][mC][mA][fG][mA][fG][fA][fA][fA][mU][mU][mC][mU][mA][mC][mUs][mAs][mA][G1b][G1b][G1b]3’); ii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 453 (5’[mUs][fAs][fU][mG][fU][mA][fG][mU][mA][fG][mA][mA][mU][fU][mU][fC][mU][mC][mU][mGs][mUs][mA]3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 446 (5’[mCs][mAs][mG][mA][mG][fA][mA][fA][fU][fU][fC][mU][mA][mC][mU][mA][mC][mAs][mUs][mA][G1b][G1b][G1b]3’); iii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 457 (5’[MeEPmUs][fUs][fA][mG][fU][mA][fG][mA][mA][fU][mU][mU][mC][fU][mC][fU][mG][mU][mA][mGs][mGs][mC]3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 444 (5’[mCs][mUs][mA][mC][mA][fG][mA][fG][fA][fA][fA][mU][mU][mC][mU][mA][mC][mUs][mAs][mA][G1b][G1b][G1b]3’); or iv) The antisense strand of the nucleic acid sequence according to SEQ ID NO:459 (5’ [MeEPmUs][fAs][fU][mG][fU][mA][fG][mU][mA][fG][mA][mA][mU][fU][mU][fC][mU][mC][m U][mGs][mUs][mA]3’), and the sense strand of the nucleic acid sequence according to SEQ ID NO:446 (5’ [mCs][mAs][mG][mA][mG][fA][mA][fA][fU][fU][fC][mU][mA][mC][mU][mA][mC][mAs][mUs][mA][G1b][G1b][G1b]3’).

56. A vector encoding the isolated oligonucleotide according to any one of claims 1 - 55.

57. A delivery system comprising the isolated oligonucleotide according to any one of claims 1 - 55 or the vector according to claim 56.

58. A pharmaceutical composition comprising at least one isolated oligonucleotide according to any one of claims 1 - 55, the vector according to claim 56, the delivery system according to claim 57, and a pharmaceutically acceptable carrier, diluent or excipient.

59. A kit comprising at least one isolated oligonucleotide according to any one of claims 1 - 55, the vector according to claim 56, the delivery system according to claim 57, or the pharmaceutical composition according to claim 58.

60. A method for inhibiting or down - regulating the expression or level of C3 in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of at least one isolated oligonucleotide according to any one of claims 1 - 55, the vector according to claim 56, the delivery system according to claim 57, or the pharmaceutical composition according to claim 58.

61. A method for treating or preventing a disease or disorder associated with abnormal or increased expression or activity of C3, or a disease or disorder in which C3 plays a role, in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of at least one isolated oligonucleotide according to any one of claims 1 - 55, the vector according to claim 56, the delivery system according to claim 57, or the pharmaceutical composition according to claim 58.

Images