Single-chain antibody for resisting pathogenic leptospira, preparation method and application

By constructing a rabbit-source immune library to screen high-affinity scFv, the problem of diagnosis and treatment of leukobody disease is solved, and efficient diagnosis and treatment of leukobody disease is achieved.

CN120271701AActive Publication Date: 2025-07-08JILIN UNIVERSITY
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510773377.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-11
Publication Date
2025-07-08
Estimated Expiration
2045-06-11

AI Technical Summary

Technical Problem

The existing diagnosis methods for leptophytic disease have low sensitivity, high cross-reaction rate, limited treatment methods, and problems with biosafety risks and the increase in drug-resistant strains, and lack effective antibody technology applications.

Method used

Rabbit-derived immune library was constructed through phage display technology, and high-affinity single-chain antibodies (scFv) were screened for accurate diagnosis and targeted treatment of leprosy disease.

Benefits of technology

It significantly improves the diagnostic sensitivity and therapeutic effect of leukopathy, reduces the pathogen load of infected animals, improves survival rate, and provides a basis for the diagnostic reagents and treatment of leukopathy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120271701A_ABST
    Figure CN120271701A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biology, and particularly relates to an anti-pathogenic leptospira single-chain antibody as well as a preparation method and application thereof.A phage display technology is adopted, an immune library is constructed through a leptospira immune rabbit spleen, and the specific single-chain antibody is screened out through five-round antigen concentration decreasing solid-phase panning, ELISA identification and sequencing analysis, so that the anti-pathogenic leptospira single-chain antibody is obtained. A host bacterium switching expression process is optimized to realize efficient preparation of the soluble single-chain antibody, and the antibody is high in sensitivity in sandwich ELISA detection and does not have cross reaction with common pathogens; in animal model treatment, the cocktail combination can significantly improve the survival rate of the infected golden hamster and reduce the kidney hook body load, and an innovative solution is provided for hook body disease diagnosis reagent development, antigen epitope identification and targeted treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, specifically relates to genetic engineering antibody technology, and particularly relates to single-chain antibodies against pathogenic Leptospira, preparation methods and applications thereof. Background Art

[0002] Pathogenic Leptospira (hereinafter referred to as "Leptospira") is a pathogen that causes leptospirosis, which can infect humans and animals. Leptospirosis caused by it is classified as a Class B infectious disease in China. This pathogen is transmitted through contact with contaminated water sources or animal urine, and can cause multi-organ damage. The mortality rate of severe patients is as high as 30% (WHO, 2022). Although there are about one million new cases of leptospirosis and 60,000 deaths globally each year, its early symptoms lack specificity (such as fever, muscle pain), and the serotypes are complex (more than 300 serotypes have been identified), resulting in great challenges in clinical diagnosis and treatment.

[0003] The main hosts of Leptospira are rodents, livestock, bats, etc. Among rodents, rats (such as Apodemus agrarius, Rattus flavipectus) are the main natural hosts, with a high carrier rate for several months to several years, and their urine continuously contaminates the environment. Among livestock, pigs, dogs, cattle, etc. are important sources of infection. In particular, the bacterial flora carried by pigs is highly consistent with the human epidemic strain, with a large urine volume and a wide pollution range. More than 90% of leptospirosis cases are infected through contact with rice fields, floods or stagnant water contaminated by animal urine. Transmission can also occur through handling infected animal tissues, mating or bites. Pregnant women can transmit the infection to the fetus vertically through the placenta.

[0004] In the prior art, microscopic agglutination test (MAT) for leptospirosis diagnosis, as the gold standard for diagnosis, requires live bacteria operation and has low sensitivity (<50% early positive rate), and there are biosafety risks (Costa et al., 2015).

[0005] In ELISA detection, most existing kits rely on whole-bacteria antigens or traditional monoclonal antibodies (such as anti-LipL32 monoclonal antibody), but the cross-reaction rate is high (especially with non-pathogenic Leptospira), and it is impossible to distinguish active infection from past exposure (Haake et al., 2020). The treatment methods for leptospirosis are insufficient. Penicillin or doxycycline is the first choice of drug, but it is prone to cause Jarisch-Herxheimer reaction, and the number of drug-resistant strains increases year by year (Suepaul et al., 2016), showing antibiotic dependence. The development of vaccines lags behind. Inactivated vaccines are only effective against homologous serotypes, and the protection period is short (<1 year), and they cannot cope with the epidemic of multiple serotypes (Adler, 2020).

[0006] There is a blank in the application of leptospirosis antibody technology. Regarding monoclonal antibodies (mAbs), murine mAbs against leptospiral membrane proteins (such as LipL32) have been reported in previous studies. However, due to their large molecular weight (150 kDa) and poor tissue penetration, they are difficult to be used for targeted therapy (Narayanavari et al., 2017). Single chain fragment variable (scFv) is a type of genetically engineered antibody. In recent years, it has been widely used in multiple fields such as immunoassay, anti-virus, and targeted therapy due to its small molecular weight, strong penetrability, and easy genetic engineering manipulation. scFv is mainly obtained through phage display technology, which does not require cell fusion. The scFv gene can be amplified by simple PCR and can be fused with the phage coat protein gene for expression and display on the phage surface, reducing the operation difficulty. scFv (with a molecular weight of about 27 kDa) has been applied in the field of anti-Ebola virus and other areas. Existing phage display libraries mostly target bacterial toxins (such as anthrax toxin PA) and use mouse or human antibodies. There is no report on screening leptospira-specific scFv based on rabbit-derived libraries (Li et al., 2019).

[0007] Therefore, antibody drugs for leptospirosis and rapid and convenient diagnostic reagents for non-disease diagnosis and / or treatment purposes are urgently needed to be developed. Summary of the Invention

[0008] The present invention aims to construct a rabbit-derived immune library through phage display technology to screen high-affinity scFv, providing an innovative solution for the precise diagnosis and targeted therapy of leptospirosis.

[0009] To achieve the above object, the present invention adopts the following technical solutions: In the first aspect, the present invention provides single chain antibodies against pathogenic leptospira, and the amino acid sequences thereof are any one or more of the following: (a) The amino acid sequence shown in SEQ ID NO:1; (b) The amino acid sequence shown in SEQ ID NO:2; (c) The amino acid sequence shown in SEQ ID NO:3.

[0010] In the second aspect, the present invention also provides nucleic acids encoding the single chain antibodies against pathogenic leptospira: The nucleic acid encodes a single chain antibody against pathogenic leptospira shown in SEQ ID NO:1, and the nucleotide sequence is shown in SEQ ID NO:4; The nucleic acid encodes a single chain antibody against pathogenic leptospira shown in SEQ ID NO:2, and the nucleotide sequence is shown in SEQ ID NO:5; The nucleic acid encodes a single-chain antibody against pathogenic Leptospira as shown in SEQ ID NO:3, and the nucleotide sequence is as shown in SEQ ID NO:6.

[0011] In a third aspect, the present invention also provides a recombinant expression vector comprising any one of the above nucleic acids.

[0012] Furthermore, the backbone of the recombinant expression vector is a plasmid, cosmid, phage or viral vector.

[0013] In a fourth aspect, the present invention also provides a transformant, which comprises the recombinant expression vector in a host cell.

[0014] Furthermore, the host cell is selected from yeast cells, mammalian cells or other cells suitable for preparing antibodies.

[0015] In a fifth aspect, the present invention also provides a method for preparing the single-chain antibody against pathogenic Leptospira, the method comprising culturing the transformant and obtaining the single-chain antibody against pathogenic Leptospira from the culture.

[0016] In a sixth aspect, the present invention also provides a pharmaceutical composition, which comprises one or more of the single-chain antibodies as shown in SEQ ID NO:1, the single-chain antibody as shown in SEQ ID NO:2 and the single-chain antibody as shown in SEQ ID NO:3, and a pharmaceutically acceptable carrier.

[0017] Furthermore, the pharmaceutical composition comprises the single-chain antibody as shown in SEQ ID NO:1, the single-chain antibody as shown in SEQ ID NO:2 and the single-chain antibody as shown in SEQ ID NO:3.

[0018] Furthermore, the molar ratio of the single-chain antibody as shown in SEQ ID NO:1, the single-chain antibody as shown in SEQ ID NO:2 and the single-chain antibody as shown in SEQ ID NO:3 is 1:1:1.

[0019] Furthermore, the pharmaceutical composition is administered by intraperitoneal injection, and the single-dose administration is 10 mg / kg - 20 mg / kg body weight.

[0020] Furthermore, the pharmaceutical composition is used to reduce the Leptospira load in the kidneys of infected animals, and the survival rate is increased to more than 80%.

[0021] In a seventh aspect, the present invention also provides a kit, which comprises the single-chain antibody, the nucleic acid, the recombinant expression vector, the transformant or the pharmaceutical composition.

[0022] Further, the kit further includes a reagent for detecting the binding of the single-chain antibody to pathogenic Leptospira.

[0023] Further, the kit is an ELISA detection kit.

[0024] In an eighth aspect, the present invention also provides the use of the single-chain antibody, the nucleic acid, the recombinant expression vector, the transformant, the pharmaceutical composition or the kit in the preparation of a drug for diagnosing, preventing and / or treating leptospirosis.

[0025] More preferably, the leptospirosis is caused by Leptospira icterohemorrhagiae.

[0026] In a ninth aspect, the present invention also provides a method for detecting pathogenic Leptospira in a sample. The single-chain antibody is contacted with the sample to be detected, and ELISA or immunofluorescence is used to determine the binding situation between the single-chain antibody and the sample to be detected, so as to obtain whether there is pathogenic Leptospira in the sample. This method is for non-disease diagnosis and / or treatment purposes.

[0027] Beneficial effects: The present invention constructs a rabbit-derived immune library through phage display technology, and obtains 3 scFvs with high affinity against pathogenic Leptospira through 3 to 5 rounds of solid-phase panning. The amino acid sequences are shown in SEQ ID NO: 1-3. It also covers the application of the above scFvs in sandwich ELISA for detecting Leptospira pathogens, as well as the method of treating infected animal models with a cocktail combination of scFv antibodies, which significantly reduces the Leptospira burden in the kidneys and improves the survival rate. The main body of the scFv antibody is composed of a heavy-chain variable region, a light-chain variable region and a linker region. In addition, a protein tag is added to assist in subsequent purification and other applications. The scFv can bind to Leptospira with high affinity, providing materials for the development of leptospirosis diagnostic reagents, ideas for identifying Leptospira antigenic epitopes and vaccine design, and also providing a drug basis for the treatment of leptospirosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments recorded in the present invention, and those of ordinary skill in the art can also obtain other drawings based on these drawings.

[0029] Figure 1 It is a flowchart for constructing a library and screening for the expression of specific scFv.

[0030] Figure 2 It is a phage-ELISA detection result diagram of the specificity of scFv phage to Leptospira in Example 1.

[0031] Figure 3Comparison diagram of 3 scFv sequences in Example 1.

[0032] Figure 4 SDS-PAGE diagram of 3 scFvs in Example 2. Among them, 1. Whole cell lysate of scFv-1; 2. Periplasmic expression solution of scFv-1; 3. Supernatant expression solution of scFv-1; 4. Whole cell lysate of scFv-6; 5. Periplasmic expression solution of scFv-6; 6. Supernatant expression solution of scFv-6; 7. Whole cell lysate of scFv-36; 8. Periplasmic expression solution of scFv-36; 9. Supernatant expression solution of scF-36.

[0033] Figure 5 WB identification diagram of the purification of 3 scFvs in Example 2.

[0034] Figure 6 ELISA detection result diagram of the affinity of soluble scFv antibody to leptospira in Example 2.

[0035] Figure 7 Result diagram of establishing sandwich ELISA to detect leptospira using scFv antibody in Example 3.

[0036] Figure 8 Result diagram of the survival rate of golden hamsters infected with leptospira improved by scFv cocktail in Case 1 of Example 4.

[0037] Figure 9 Result diagram of pathological section in Case 1 of Example 4.

[0038] Figure 10 Result diagram of pathological score in Case 1 of Example 4.

[0039] Figure 11 Result diagram of the survival rate of golden hamsters infected with leptospira improved by scFv in Case 2 of Example 4. Specific implementation mode

[0040] The present invention will be further described in detail below in combination with specific implementation modes. The given examples are only for clarifying the present invention, rather than limiting the scope of the present invention. The experimental methods and functional elements in the following examples are all conventional methods and conventional schemes in the art unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified. The following biological materials are all stored in our laboratory and can be distributed to the public for verification experiments.

[0041] New Zealand white rabbits and Syrian golden hamsters were both purchased from Liaoning Changsheng Biotechnology Co., Ltd. Leptospira interrogans serovar icterohaemorrhagiae was long-term preserved in our laboratory; the phage vector pComb3XSS, the host bacterium XL1-blue, and the expression bacterium HB2151 were purchased from Beijing Baokewi Food Safety Biotechnology Co., Ltd.; the HRP-anti M13 enzyme-labeled antibody was purchased from Beijing Sino Biological Inc.; the HR-His monoclonal antibody was purchased from Wuhan Sanying Biotechnology Co., Ltd.

[0042] The following examples include constructing a rabbit-derived immune library through phage display technology, screening to obtain high-affinity scFvs specifically targeting pathogenic Leptospira; developing a rapid detection method for Leptospira pathogens based on sandwich ELISA using the scFvs; reducing the pathogen load in infected hosts and improving the survival rate through scFv cocktail combination therapy. It covers the amino acid sequences (SEQ ID NO: 1-3), encoding genes (SEQ ID NO: 4-6), library construction process of the antibodies, and their medical uses in the prevention and control of leptospirosis.

[0043] Example 1: Through five rounds of panning of the rabbit-derived phage library, scFvs of SEQ ID NO: 1-3 were obtained.

[0044] 1. Construction method of a phage display library against pathogenic Leptospira, including the following steps: (a) Immunize New Zealand white rabbits with Leptospira interrogans serovar icterohaemorrhagiae, extract total spleen RNA and reverse transcribe it into cDNA; (b) Using the cDNA as a template, amplify the variable region of the heavy chain (VH) and variable region of the light chain (VL) of the antibody by PCR, and splice them into scFv gene fragments using the flexible linker peptide (Gly4Ser)3; (c) Ligate the scFv target fragment with the pComb3XSS phagemid to obtain pComb3XSS-scFvs; Electrotransform pComb3XSS-scFvs into competent cells to construct an scFv immune library against pathogenic Leptospira; The restriction enzyme site is sfiI.

[0045] 2. Screening of the scFv immune library.

[0046] Amplify the scFv immune library, and use VCSM13 helper phage to superinfect to obtain the primary phage scFv library; The fragmented protein of Leptospira coated on the solid-phase carrier is used as an antigen to enrich the library through five rounds of solid-phase screening; After each round of panning, detect the phage binding signal by phage-ELISA to screen and enrich the library; Pick single colonies from the output plate of the last round of panning and preparation of phage antibody supernatant, using HRP-anti M13 as the enzyme-labeled secondary antibody, and select the top 10 for sequencing by phage-ELISA identification. The results are as follows Figure 2As shown in the figure; 10 scFvs were sent to the company for sequencing. They were successfully translated by SnapGene software and analyzed by Blast through IGMT. Combining the phage-ELISA results, M13-1, M13-6, and M13-36 were finally selected for subsequent expression studies. The sequence alignment results of the 3 strains are as Figure 3 shown; Three scFv gene sequences were obtained: The amino acid sequence of the scFv-1 antibody is shown in SEQ ID NO:1, the amino acid sequence of the scFv-6 antibody is shown in SEQ ID NO:2, the amino acid sequence of the scFv-36 antibody is shown in SEQ ID NO:3, and the linker peptide sequence in the scFv is shown in SEQ ID NO:9. The nucleotide sequence encoding the scFv-1 antibody is shown in SEQ ID NO:4. The nucleotide sequence encoding the scFv-6 antibody is shown in SEQ ID NO:5. The nucleotide sequence encoding the scFv-36 antibody is shown in SEQ ID NO:6.

[0047] Example 2: Expression of scFv antibody.

[0048] The identified antibody gene was expressed in the Escherichia coli strain HB2151 by host replacement to prepare whole cell lysate, periplasmic expression solution and supernatant expression solution; The soluble antibody expression abundance in different parts was identified by ELISA method. Specifically: 1. Transfer the phage vector carrying the scFv gene to the Escherichia coli strain HB2151 for soluble expression, and prepare whole cell lysate, periplasmic expression solution and supernatant expression solution. The specific operations are as follows: Find the corresponding prepared phage antibody supernatant, pipette 10 μL and add it to 990 μL of the prepared HB2151 host bacteria, and make a mark; At 37 °C, gently shake intermittently for 1 h to help the phage infect the host bacteria; Inoculate the culture solution on a SOBG-AN (containing 100 μg / mL amp, 100 μg / mL N, 2% glucose) plate by streaking, and culture at 30 °C overnight; Pick 3-5 single colonies and inoculate them into 6 mL of 2×YT-AN liquid medium, shake culture at 250 rpm and 37 °C for 3 h, take 1 μL of the bacterial liquid for bacterial liquid PCR, and shake the remaining bacterial liquid overnight; Primer sequences: The pComb3XSS-F1 sequence is shown in SEQ ID NO:7: AAGACAGCTATCGCGATTGCAG; The pComb3XSS-R1 sequence is shown in SEQ ID NO:8: GCCCCCTTATTAGCGTTTGCCATC.

[0049] Inoculate 5 mL of the overnight bacterial liquid that has successfully infected with the correct PCR band size into 50 mL of 2×YT-AG medium (containing 100 μg / mL amp and 2% glucose), culture it at 37°C with shaking at 250 rpm until OD600 = 0.8 (about 1 h), add IPTG inducer to make its final concentration 0.2 mM, and culture it overnight with shaking at 180 rpm in a constant temperature shaker at 16°C.

[0050] The next day, divide the culture solution into two parts, centrifuge at 3000 g at room temperature for 20 min, collect the supernatant of the two centrifugations respectively. This is the expression supernatant. Obtain the supernatant expression solution by the method of covering with PEG-20000, and store it in a -80°C refrigerator for later use.

[0051] Prepare the periplasmic soluble antibody from one of the bacterial precipitates by the method of gentle osmosis with TES, and store it in a -80°C refrigerator for later use.

[0052] Take another bacterial precipitate, resuspend it with 1 mL of PBS buffer, and obtain the whole cell lysate by ultrasonic fragmentation, and store it in a -80°C refrigerator for later use.

[0053] Respectively pipette 15 μL from the obtained supernatant expression solution, periplasmic expression solution and whole cell lysate and load them onto a 12% SDS-PAGE gel. After separating the proteins by electrophoresis, stain the gel with Coomassie Brilliant Blue staining solution to preliminarily judge whether the solution contains the target protein and evaluate its approximate content. The SDS-PAGE results are as Figure 4 shown.

[0054] 2. Using HRP-anti His as the enzyme-labeled secondary antibody, the expression abundance of soluble antibodies in different parts was identified by the ELISA method, as Figure 6 shown.

[0055] 3. Determine the expression site according to the ELISA results and SDS-PAGE results, then perform large-scale expression of the target protein, purify the target protein through a purification kit, and perform routine Western Blot identification through the His tag, as Figure 5 shown.

[0056] Example 3: Preliminary application of scFv in sandwich ELISA for detecting Leptospira.

[0057] 1. Coating protein: Dilute the scFv antibody solution with carbonate coating solution to 100 μg / mL, coat 100 μL per well, set up negative control and blank control, and incubate overnight at 4°C.

[0058] 2. Blocking: Wash 3 times and pat dry, add blocking solution (PBS containing 3% BSA), 250 μL per well, and block at 37°C for 2 h.

[0059] 3. Add the leptospira to be detected: Wash 3 times and pat dry, then add inactivated leptospira and dilute it in a gradient of 10 8 / mL to 10 2 / mL for detection, 100 μL / well, and conduct a binding reaction at 37°C for 2 h.

[0060] 4. Add the detection antibody: Wash 3 times and pat dry, then add the positive serum of golden hamsters at a ratio of 1:8000, 100 μL / well, and incubate at 37°C for 1 h.

[0061] 5. Add the enzyme-labeled antibody: Wash 3 times and pat dry, dilute different concentrations of HRP-goat anti-hamster at 1:4000 and mix evenly, 100 μL / well, and incubate at 37°C for 1 h.

[0062] 6. Color development: Wash 3 times and pat dry, add 100 μL of TMB color development solution to each well, and incubate at 37°C in the dark for color development for about 15 min.

[0063] 7. Termination: Use 1M H2SO4 as the termination solution, 100 μL / well to terminate color development, and read the value at 450 nm. Judge the sensitivity of the ELISA established using scFv according to the detection results.

[0064] The ELISA results are as Figure 7 shown. It can be seen that all 3 kinds of scFv can specifically bind to leptospira with high affinity. Among them, the ELISA established with scFv-6 has higher sensitivity.

[0065] Example 4. Preliminary evaluation of the protective effect of scFv.

[0066] 1. Group and raise golden hamsters. According to the infection model established in the early stage of the laboratory, each hamster is challenged by intraperitoneal injection with 1×10 6 leptospira.

[0067] Case 1. Mix scFv-1, scFv-6, and scFv-36 prepared in Example 1 at a molar ratio of 1:1:1 to obtain the therapeutic scFvs, and verify the protective effect of the combined use of scFv-1, scFv-6, and scFv-36 using the cocktail antibody therapy. Set up a control group (normal saline), a 20 mg / kg scFvs treatment group, and a 10 mg / kg scFvs treatment group, with 10 in each group.

[0068] Case 2. Verify the protective effect of the individual use of scFv-1, scFv-6, and scFv-36. Set up a control group, a 20 mg / kg scFv-1 treatment group, a 20 mg / kg scFv-6 treatment group, and a 20 mg / kg scFv-36 treatment group, with 10 in each group.

[0069] 2. At 48 h after infection with Leptospira interrogans serovar icterohaemorrhagiae, the control group was injected with normal saline, and the experimental group was injected with the antibodies in the two cases at the corresponding doses for 5 consecutive days. After challenge, the hamsters were observed for 28 days, and the death time of the golden hamsters was recorded. After the 28-day observation period, pathological section detection was performed on the golden hamsters that did not die.

[0070] The survival rate results of Case 1 are as Figure 8 shown. After 48 h of Leptospira infection, specific scFvs treatment was carried out. During the 28-day observation period, the survival rate of the 20 mg / kg group in the treatment group increased to 100%, which improved the survival rate of golden hamsters compared with the control group.

[0071] The survival rate results of Case 2 are as Figure 11 shown. After 48 h of Leptospira infection, specific scFv treatment was carried out. During the 28-day observation period, the survival rate of the 20 mg / kg group of scFv-1 increased to 80%, the survival rate of the 20 mg / kg group of scFv-6 increased to 91%, and the survival rate of the 20 mg / kg group of scFv-36 increased to 80%, which improved the survival rate of golden hamsters compared with the control group.

[0072] Representative photos of the pathological section results of Case 1 are as Figure 9 shown. The scale bar is 200 μm. The results of HE sections of the control group showed local hemorrhage in the kidney, more inflammatory cell infiltration in the liver tissue, and lung consolidation with alveolar congestion in the lung tissue.

[0073] The pathological grading score results of Case 1 are as Figure 10 shown. Compared with the control group, specific scFvs treatment significantly alleviated the kidney, liver and lung injuries caused by Leptospira infection.

[0074] The scFv antibody prepared by the present invention can bind to Leptospira with high affinity, provide materials for the development of diagnostic reagents for leptospirosis, provide ideas for identifying Leptospira antigenic epitopes, and provide a drug basis for the treatment of leptospirosis. The sequence was analyzed by IGBLAST, and the results showed that the scFv gene sequence was basically consistent with the variable region sequence of rabbit-derived antibodies, proving that the constructed scFv gene sequence was correct.

[0075] The above-described embodiments are merely specific implementation manners of the present application, used to illustrate the technical solutions of the present application, rather than limiting it. The protection scope of the present application is not limited thereto. Although the present application has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: any person skilled in the technical field, within the technical scope disclosed by the present application, can still modify the technical solutions recorded in the foregoing embodiments or can easily think of changes, or perform equivalent replacements on some of the technical features; and these modifications, changes or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application. All should be covered within the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the protection scope of the claims.

Claims

1. Single-chain antibody against pathogenic Leptospira, characterized in that: Its amino acid sequence is selected from any one or more of the following: (a) The amino acid sequence shown in SEQ ID NO: 1; (b) The amino acid sequence shown in SEQ ID NO: 2; (c) The amino acid sequence shown in SEQ ID NO:

3.

2. The nucleic acid encoding the single-chain antibody as claimed in claim 1, characterized in that: The nucleic acid encodes the single-chain antibody shown in SEQ ID NO: 1, and the sequence is as shown in SEQ ID NO: 4; The nucleic acid encodes the single-chain antibody shown in SEQ ID NO: 2, and the sequence is as shown in SEQ ID NO: 5; The nucleic acid encodes the single-chain antibody shown in SEQ ID NO: 3, and the sequence is as shown in SEQ ID NO:

6.

3. A recombinant expression vector, characterized in that, Comprising one of the nucleic acids as claimed in claim 2.

4. A transformant, characterized in that, Comprising the recombinant expression vector as claimed in claim 3.

5. A method for preparing a single-chain antibody against pathogenic Leptospira, characterized in that, The method comprises culturing the transformant as claimed in claim 4 and obtaining the single-chain antibody against pathogenic Leptospira from the culture.

6. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises one or more of the single-chain antibody shown in SEQ ID NO: 1, the single-chain antibody shown in SEQ ID NO: 2, and the single-chain antibody shown in SEQ ID NO: 3, and a pharmaceutically acceptable carrier.

7. The pharmaceutical composition according to claim 6, wherein: The pharmaceutical composition comprises the single-chain antibody shown in SEQ ID NO: 1, the single-chain antibody shown in SEQ ID NO: 2, and the single-chain antibody shown in SEQ ID NO:

3.

8. A kit, characterized in that: The kit comprises the single-chain antibody as claimed in claim 1, the nucleic acid as claimed in claim 2, the recombinant expression vector as claimed in claim 3, the transformant as claimed in claim 4, or the pharmaceutical composition as claimed in claim 6.

9. Use of the single-chain antibody as claimed in claim 1, the nucleic acid as claimed in claim 2, the recombinant expression vector as claimed in claim 3, the transformant as claimed in claim 4, the pharmaceutical composition as claimed in claim 6, or the kit as claimed in claim 8 in the preparation of a medicament for diagnosing, preventing and / or treating leptospirosis.

10. A method for detecting pathogenic Leptospira in a sample for non-disease diagnosis and / or treatment purposes, characterized in that: The method is sandwich ELISA, using the single-chain antibodies shown in SEQ ID NOs: 1 to 3 as the capture antibody and the detection antibody.

Citation Information

Patent Citations

  • Anti-leptospira egg yolk antibody as well as preparation method and application thereof

    CN115477700A

  • Antibodies for detecting leptospira antigens for use in diagnosis of leptospirosis

    JP2018127442A

  • Use of a leptospire protein preventing and / or diagnosing and / or treating animal or human leptospirosis

    US20030124567A1

  • Diagnosis of leptospirosis by monoclonal antibody based-antigen detection

    WO2001064753A1