A subunit vaccine against chicken infectious anemia virus
Through the recombinant fusion of the B-cell epitope of the chicken infectious anemia virus VP1 protein and Salmonella typhimurium flagellin, the problem of insufficient expression of VP1 full-length protein in E. coli was solved, and efficient immune protection effect was achieved, which was suitable for the preparation of vaccines for chicken infectious anemia virus.
Patent Information
- Application Number
- CN202411771957.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-04
- Publication Date
- 2025-07-18
- Estimated Expiration
- 2044-12-04
AI Technical Summary
In the prior art, the full-length protein of the chicken infectious anemia virus VP1 is low in the E. coli expression system, and the immunogenicity is insufficient, which cannot meet the needs of industrial application.
By recombinantly fusing the B-cell epitope of chicken infectious anemia virus VP1 protein with S. typhimurium flagellin, its expression in E. coli is optimized, and the host's innate immune system is activated by using the TLR5 and NLRC4 signaling pathways of S. typhimurium flagellin to activate the host's innate immune system to enhance the immune effect.
It has achieved efficient expression of the B cell epitope of the chicken infectious anemia virus VP1 protein in E. coli, and can induce high levels of specific IgG antibodies after immunization. The immunized chicken flock has a 70% protective effect on the strong strain of the chicken infectious anemia virus.
Smart Images

Figure CN119613568B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of animal disease vaccines, and particularly to a subunit vaccine against chicken infectious anemia virus, and more particularly to the application of a recombinant Salmonella typhimurium flagellin fused with the VP1 B-cell epitope of chicken infectious anemia virus. Background Art
[0002] Chicken infectious anemia is an infectious disease caused by Chicken Infectious Anemia Virus (CIAV), characterized by aplastic anemia in chicks, atrophy of the whole lymphoid tissue, and subcutaneous and muscle hemorrhage. Chickens are the only natural hosts of CIAV, and chickens of all ages are susceptible. As the age increases, the susceptibility, morbidity and mortality of chickens gradually decrease.
[0003] The genome of CIAV consists of a coding region and a non-coding region, and contains a total of 3 open reading frames, encoding three proteins, VP1, VP2 and VP3 respectively. Among them, VP1 is encoded by ORF3, about 51KDa, which is the only structural protein of CIAV and also the protein with the best immunogenicity among the three proteins of CIAV. However, some studies have shown that the full gene of CIAV VP1 cannot be efficiently expressed in the host of Escherichia coli engineering bacteria. Therefore, it is necessary to further optimize the CIAV VP1 gene sequence to improve its expression level and enhance its protective efficacy through other means.
[0004] CN116731204A discloses a genetic engineering subunit vaccine against chicken infectious anemia virus and its preparation and application, which solves the problems that the full gene of chicken infectious anemia virus VP1 cannot be expressed in the Escherichia coli expression system and the immunization effect of VP1 protein vaccination is poor by fusing an expression tag. However, this technology still has the problems that the expression level of the full-length VP1 protein is relatively low and it cannot be applied industrially. In addition, the immunogenicity of the full-length VP1 protein expressed by this technology is relatively low, and a relatively high immunization dose is required to reach the protection level. Summary of the Invention
[0005] [Technical Problem]
[0006] The technical problem to be solved by the present invention is to improve the expression level and immunogenicity of the key antigenic epitope of the protective protein VP1 of chicken infectious anemia virus.
[0007] [Technical Solution]
[0008] The present invention provides a subunit vaccine against chicken infectious anemia virus, and the active ingredient is a recombinant fusion protein of the VP1 protein B-cell epitope of chicken infectious anemia virus and Salmonella typhimurium flagellin.
[0009] The B-cell epitope of chicken infectious anemia virus VP1 protein is obtained by linking the B-cell antigen epitopes contained in chicken infectious anemia virus VP1 protein with a linker peptide (GPGPG). Preferably, the amino acid sequence of the B-cell epitope of chicken infectious anemia virus VP1 protein is as shown in SEQ ID NO.1.
[0010] The truncated flagellin of Salmonella typhimurium is obtained by removing the amino acids at positions 144 - 408 in the full-length FliC protein of Salmonella typhimurium and linking the N-terminus and C-terminus of FliC with a linker peptide. Preferably, the linker peptide is GPGPG. More preferably, the amino acid sequence of the truncated flagellin of Salmonella typhimurium is as shown in SEQ ID NO.2.
[0011] The recombinant fusion protein is obtained by linking the B-cell epitope of chicken infectious anemia virus VP1 protein and the flagellin of Salmonella typhimurium with a linker peptide (GPVD). Preferably, the amino acid sequence of the recombinant fusion protein is as shown in SEQ ID NO.3.
[0012] The chicken infectious anemia virus subunit vaccine also contains a pharmaceutically acceptable carrier, such as any one or a combination of two or more of white oil, Span, and Tween.
[0013] The present invention also provides a gene fragment encoding the recombinant fusion protein, named CIAV VP1-ST FliC, which is codon-optimized, and the nucleotide sequence is as shown in SEQ ID NO.4.
[0014] The present invention also provides an expression cassette, a recombinant expression vector or a recombinant strain of the recombinant fusion protein. The recombinant expression vector is obtained by inserting the gene fragment encoding the recombinant fusion protein into the pET28a plasmid vector, and the recombinant expression vector is named pET28a-CIAV VP1-ST FliC. The recombinant strain is obtained by introducing the recombinant expression vector pET28a-CIAV VP1-ST FliC into the Escherichia coli expression strain BL21.
[0015] The present invention also provides a method for constructing the recombinant strain, including the following steps:
[0016] (1) Design a pair of specific primers with repeated sequences on both sides of the pET28a plasmid vector for the gene fragment CIAV VP1-ST FliC encoding the recombinant fusion protein. Using the CIAV VP1-ST FliC fusion gene fragment as a template, perform a PCR amplification reaction. The amplified product is subjected to seamless cloning with the linearized pET28a plasmid vector to construct a recombinant expression vector, named pET28a-CIAV VP1-ST FliC;
[0017] (2) The recombinant expression vector obtained in step (1) was introduced into competent cells of Escherichia coli expression strain BL21 by electroporation to obtain a recombinant strain named BL21(pET28a-CIAV VP1-ST FliC).
[0018] Preferably, the specific primers consist of an upstream primer and a downstream primer, and their nucleotide sequences are as follows:
[0019] Upstream primer: 5’GAGTGCGGCCGCAAGATGGCTCAAGTAATAAAC,
[0020] Downstream primer: 5’GAATTCGAGCTCCGTCTTACCAGTACATGGTGCTATTAG.
[0021] The present invention also discloses the use of the B cell epitope of chicken infectious anemia virus VP1 protein, the flagellin of Salmonella typhimurium, the recombinant fusion protein, the gene fragment encoding the recombinant fusion protein, the expression cassette, the recombinant expression vector, and the recombinant strain in the preparation of chicken infectious anemia virus vaccine.
[0022] [Beneficial effects]
[0023] Compared with the prior art, the present invention has the following advantages: After immunizing 1-day-old SPF chickens with the recombinant fusion protein of the B cell epitope of chicken infectious anemia virus VP1 protein and the flagellin of Salmonella typhimurium prepared by the present invention, it can induce the production of specific IgG antibodies. And 28 days after immunization, the immunized chicken flock can resist the challenge of a virulent strain of chicken infectious anemia virus, and 70% of the challenged chicken flock does not get sick and is protected.
[0024] Bacterial flagellin can activate the host innate immune system through signal pathways such as TLR5 and NLRC4, induce the secretion of pro-inflammatory factors, and thus exert an immune adjuvant effect. By fusing with foreign antigens for expression, it can induce a higher level of specific humoral and cellular immune responses in the body. By truncating recombinant Escherichia coli flagellin and deleting its middle hypervariable region, not only can the TLR5 receptor activity of the full-length flagellin be retained, but also its inherent antigenicity can be avoided. Fusing the B cell epitope of chicken infectious anemia virus VP1 protein and the flagellin of Salmonella typhimurium can obtain better immune effects. Description of the drawings
[0025] Figure 1 It is the prediction result of the B cell epitope of chicken infectious anemia virus VP1 protein.
[0026] Figure 2This is the agarose gel electrophoresis result diagram in Example 1 of the present invention; Lane M: DL 5000 DNA Marker; Lanes 1, 2, and 3: Products of the CIAV VP1-ST FliC fusion gene fragment.
[0027] Figure 3 This is the SDS-PAGE identification result diagram in Example 2 of the present invention; Lane M: Protein Marker; Lane 1: Identification result of the BL21(pET28a) empty vector control strain; Lane 2: Identification result of the BL21(pET28a-CIAV VP1-ST FliC) recombinant strain.
[0028] Figure 4 This is the Western Blot identification result diagram in Example 2 of the present invention; Lane M: Protein Marker; Lane 1: Expression identification result of the BL21(pET28a) empty vector control strain; Lane 2: Identification result of the BL21(pET28a-CIAV VP1-ST FliC) recombinant strain.
[0029] Figure 5 This is the detection result of the CIAV-specific ELISA antibody in Example 3 of the present invention. Among them, when the S / N value > 0.6, it is judged as negative, and when S / N ≤ 0.6, it is judged as positive. Detailed implementation manners
[0030] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, so they are only used as examples and cannot be used to limit the protection scope of the present invention.
[0031] The experimental methods in the following embodiments are all conventional methods unless otherwise specified. The test materials used in the following embodiments are all obtained from regular biochemical reagent stores unless otherwise specified.
[0032] The chicken infectious anemia virus challenge strain CIAV-YB01 used in the embodiments of the present invention was provided by Yangzhou Youbang Biopharmaceutical Co., Ltd.
[0033] Example 1 Obtaining the nucleotide sequence of the fusion gene fragment of the VP1 B cell epitope of chicken infectious anemia virus and the truncated flagellin of Salmonella typhimurium
[0034] The B-cell epitopes contained in the VP1 protein of chicken infectious anemia virus (GenBank accession number: AAM73652.1) were predicted using the B-cell epitope prediction tool (Bepipred Linear Epitope Prediction 2.0, http: / / tools.iedb.org / bcell / ). This database scores each amino acid residue, and when the residue score is greater than 0.5, it is considered antigenic. When the scores of multiple consecutive amino acid residues are greater than 0.5, they are predicted as B-cell epitopes. The prediction results Figure 1 are shown. Each B-cell epitope was linked with a linker peptide (GPGPG) to obtain the B-cell epitope of the VP1 protein of chicken infectious anemia virus with the amino acid sequence shown in SEQ ID NO.1.
[0035] The functional domains of flagellin FliC of Salmonella typhimurium (GenBank accession number: CP029568.1) were predicted using the antigen functional domain prediction tool (InterPro, http: / / www.ebi.ac.uk / interpro / ). Among them, amino acids at positions 144 - 408 were predicted to play a flagellar antigenic function. To prevent the problem that the presence of amino acids at positions 144 - 408 may trigger the body to produce specific antibodies against flagellin itself and thus affect the body's secondary immune response, amino acids at positions 144 - 408 were removed from the functional domain of flagellin FliC before fusion expression of the protein. The amino acid sequence of the truncated flagellin FliC of Salmonella typhimurium after removing amino acids at positions 144 - 408 is shown in SEQ ID NO.2, in which the N-terminus and C-terminus of the protein are linked with a linker peptide (GPGPG).
[0036] After obtaining the B-cell epitope of the VP1 protein of chicken infectious anemia virus (SEQ ID NO.1) and the truncated flagellin sequence of Salmonella typhimurium (SEQ ID NO.2) respectively, they were linked with a linker peptide (GPVD) to obtain a fusion protein with the amino acid sequence shown in SEQ ID NO.3. Using the codon optimization tool (GenSmart TM , https: / / www.genscript.com.cn / tools / gensmart-codon-optimization) for codon preference optimization of Escherichia coli, the expression host was selected as E. coli. Thus, the gene fragment encoding the fusion protein after codon optimization was obtained, named CIAV VP1-ST FliC, and the nucleotide sequence is shown in SEQ ID NO.4.
[0037] Construction, Expression and Identification of Recombinant Escherichia coli Expressing the B-cell Epitope of Chicken Infectious Anemia Virus VP1 and Truncated Flagellin of Salmonella typhimurium
[0038] The fusion gene fragment (CIAV VP1-ST FliC) obtained in Example 1 was entrusted to Anhui General Biology Co., Ltd. for gene synthesis and ligated to the commercial plasmid vector pMD-19T. Using the above plasmid as a template, conventional PCR amplification was carried out with specific primers and the product was recovered by gel electrophoresis. The sequences of the specific primers are as follows:
[0039] Forward primer: 5’GAGTGCGGCCGCAAGATGGCTCAAGTAATAAAC
[0040] Reverse primer: 5’GAATTCGAGCTCCGTCTTACCAGTACATGGTGCTATTAG
[0041] After amplification by the conventional PCR method, the agarose gel electrophoresis results of the CIAV VP1-ST FliC fusion gene fragment are as Figure 2 shown.
[0042] Using the seamless cloning kit ( Ultra One Step Cloning Kit C117), the CIAV VP1-ST FliC fusion gene fragment was ligated to the linearized pET28a plasmid. The reaction system was as follows: 4 μL of the CIAV VP1-ST FliC fusion gene fragment; 1 μL of the linearized pET28a plasmid, and 5 μL of 2×CloneExpress Mix. After reacting at 50 °C for 5 min, it was immediately cooled on ice. The reaction product was added to 100 μL of BL21 Escherichia coli competent cells for chemical transformation, recovery, plating and identification. Finally, positive clones were obtained and named BL21(pET28a-CIAV VP1-ST FliC).
[0043] The positive clone was transferred to 4 mL of LB medium containing kanamycin resistance and cultured overnight in a shaker at 37 °C. The next day, 4 mL of the overnight culture seed solution was inoculated into 200 mL of fresh autoclaved LB medium (kanamycin resistance) at a ratio of 1:100. When the OD600nm reached about 0.6 after shaking culture at 37 °C, IPTG was added to a final concentration of 0.5 mM, and the CIAV VP1-ST FliC fusion protein was induced to express for 4 h at 37 °C. After induction, the bacterial solution was sonicated and centrifuged, and the supernatant was taken. The supernatant was purified by nickel column using the LISUI chromatography system (model: APPS EV 1500). The concentration of the purified CIAV VP1-ST FliC fusion protein was measured by the BCA method to be 1.13 mg / mL.
[0044] After subjecting the purified recombinant protein sample to SDS-PAGE electrophoresis, Western Blot was performed. Among them, the His Tag mouse monoclonal antibody (Guangzhou Huijun Biotechnology, product number: FI01107M) was used as the primary antibody, and goat anti-mouse IgG-HRP (Beijing Borsi, product number: BHR102) was used as the secondary antibody. The results of SDS-PAGE and Western Blot are shown respectively as Figure 3 and Figure 4 shown. The CIAV VP1-STFliC fusion protein is approximately 54 kDa.
[0045] Example 3 Detection of Antibody Levels Induced by the Fusion Expression of Chicken Infectious Anemia Virus VP1 B-Cell Epitope and Truncated Flagellin of Salmonella typhimurium
[0046] An adjuvant vaccine containing the fusion expression of chicken infectious anemia virus VP1 B-cell epitope and truncated flagellin of Salmonella typhimurium was prepared with white oil adjuvant. The volume ratio of the purified protein (the concentration of the fusion protein after purification was 1.13 mg / mL) to the white oil adjuvant was 1:2.5, and a subunit vaccine with a fusion protein concentration of 60 μg / mL was prepared. In addition, the full-length VP1 protein of chicken infectious anemia virus previously expressed in the laboratory of the applicant was prepared into a subunit vaccine with the same concentration for standby.
[0047] Fifteen 1-day-old SPF chickens were randomly divided into 3 groups, with 5 chickens in each of the fusion protein immunization group, the full-length VP1 protein immunization group, and the non-immunized control group. Chickens in the fusion protein immunization group and the full-length protein immunization group were subcutaneously injected with 0.2 mL of the fusion protein and the full-length protein respectively at 1 day old. At 14, 21, and 28 days after immunization, all chickens were bled from the wing vein, the serum was separated, and the specific IgG antibody level was detected using a CIAV ELISA antibody detection kit (IDEXX, product number: 99-08702).
[0048] The results of the specific IgG antibody level detection are shown as Figure 5 shown. An S / N value > 0.6 was judged as negative, and an S / N ≤ 0.6 was judged as positive. The serum antibody detection results of the non-immunized control group chickens were all negative at 14, 21, and 28 days after immunization. In contrast, 40% of the chickens in the fusion protein immunization group (2 / 5) were detected with positive antibodies by the IDEXX kit at 21 days after immunization, and the proportion of positive chickens increased to 100% (5 / 5) at 28 days after immunization. While only 40% (2 / 5) of the chickens in the full-length VP1 protein immunization group were detected with positive antibodies at 28 days after immunization. The above results indicate that, under the same immunization dose, the ability of the fusion protein to induce the production of specific IgG antibody levels is relatively superior to that of the full-length VP1 protein.
[0049] Evaluation of the Protective Efficacy against Challenge of the Fusion Expression of the VP1 B-Cell Epitope of Chicken Infectious Anemia Virus and the Truncated Flagellin of Salmonella typhimurium
[0050] Thirty 1-day-old SPF chickens were randomly divided into 3 groups, with 10 chickens in each of the fusion protein immunization group, the PBS control group, and the healthy control group. The immunization and challenge methods are shown in Table 1. The chickens in the immunization group were subcutaneously immunized with 0.2 mL of subunit vaccine (containing 15 μg of fusion protein) at 1 day old, and the PBS control group was immunized with the same volume of sterile PBS.
[0051] Twenty-eight days after immunization, the chickens in the fusion protein immunization group and the PBS control group were challenged with the CIAV-YB01 strain at a dose of 0.2 mL per chicken via intravenous injection. They were continuously observed for 14 days after challenge, and the morbidity and mortality were recorded. At 14 days after challenge, the chickens were weighed and necropsied, and the thymus was weighed to calculate the thymus index. Among them, the thymus index = weight of immune organ (g) / live body weight (kg). Taking the average thymus index of the chickens in the healthy control group as a reference, if the thymus index of a single chicken in the fusion protein immunization group was not less than 80% of the average thymus index of the chickens in the healthy control group, it was determined to be protected. Additionally, it should be noted that in the PBS control group, the thymus index of 70% or more chickens should not be higher than 60% of the average thymus index of the chickens in the healthy control group to serve as a suitable challenge model. The results of the thymus index of all chickens after necropsy are shown in Table 2. Among them, the average thymus indices of the chicken flocks in the healthy control group, the fusion protein immunization group, and the PBS control group were 3.88, 3.20, and 2.15, respectively. Among them, the thymus indices of 7 / 10 chickens in the fusion protein immunization group exceeded 80% of the average thymus index of the chickens in the healthy control group; the thymus indices of 7 / 10 chickens in the PBS control group were lower than 60% of the average thymus index of the chickens in the healthy control group. The above results indicate that the immunization of chickens with the CIAV VP1-ST FliC fusion protein can provide 70% protective efficacy against the challenge of chicken infectious anemia virus and has the potential for the prevention and control of clinical chicken infectious anemia.
[0052] Table 1 Information on Chicken Flock Grouping, Immunization, and Challenge
[0053]
[0054] Table 2 Results of Protective Efficacy against Challenge
[0055]
[0056]
[0057]
[0058]
[0059] Although the present invention has been disclosed above in its preferred embodiments, it is not intended to limit the present invention. Any person skilled in this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.
Claims
1. A recombinant fusion protein, characterized in that, It is obtained by connecting the B-cell epitope of chicken infectious anemia virus VP1 protein and the truncated flagellin of Salmonella typhimurium through a linker peptide. The B-cell epitope of chicken infectious anemia virus VP1 protein is obtained by connecting the B-cell antigen epitopes contained in chicken infectious anemia virus VP1 protein through a linker peptide; the amino acid sequence of the B-cell epitope of chicken infectious anemia virus VP1 protein is as shown in SEQ ID NO.1; the truncated flagellin of Salmonella typhimurium is obtained by removing the amino acids at positions 144-408 in the full-length FliC protein of Salmonella typhimurium and connecting the N-terminus and C-terminus of FliC with a linker peptide, and the amino acid sequence of the truncated flagellin of Salmonella typhimurium is as shown in SEQ ID NO.
2.
2. The recombinant fusion protein according to claim 1, wherein The amino acid sequence of the recombinant fusion protein is as shown in SEQ ID NO.
3.
3. A subunit vaccine against chicken infectious anemia virus, characterized in that, Contains the recombinant fusion protein according to claim 1 or 2.
4. The subunit vaccine against chicken infectious anemia virus according to claim 3, characterized in that, The chicken infectious anemia virus subunit vaccine also contains a carrier.
5. A gene fragment encoding the recombinant fusion protein according to claim 1 or 2.
6. Use of the recombinant fusion protein according to claim 1 or 2, the gene fragment according to claim 5, the recombinant plasmid or recombinant cell carrying the gene fragment according to claim 5 in the preparation of a chicken infectious anemia virus vaccine.
Citation Information
Patent Citations
Chicken infectious anemia subunit vaccine
CN110028558A
Chicken infectious anemia virus genetic engineering vaccine
CN111729078A