SiRNA for inhibiting AKT1 gene expression and application thereof

Abstract

The invention discloses siRNA for inhibiting AKT1 gene expression and application of the siRNA. The siRNA comprises a positive-sense strand and an antisense strand, the nucleotide sequence of the positive-sense strand is shown as any one of SEQ ID NO.1-15, and the antisense strand and the positive-sense strand are at least partially complementary to form a double-strand region. The invention provides siRNA for inhibiting ATK1 gene expression, the siRNA is modified to ensure the stability and inhibitory activity of the siRNA, and experiments prove that multiple groups of siRNA have obvious inhibitory activity on ATK1 gene expression in human hepatoma carcinoma cells and human breast adenocarcinoma cells, have great application prospects in preparation of drugs for preventing and / or treating ATK1 expression related diseases, and have broad application prospects in preparation of drugs for preventing and / or treating ATK1 expression related diseases. And a new treatment strategy is provided for treatment of Cowden syndrome type 6, Proteus syndrome and tumors.

Description

Technical Field

[0001] This application belongs to the field of biomedical technology, and specifically relates to an siRNA for inhibiting AKT1 gene expression and its application. Background Art

[0002] AKT1 protein, also known as protein kinase B (PKB), is a key molecule in the cell signaling pathway and is involved in regulating various processes such as cell growth, survival, metabolism, and differentiation. AKT1 is a kinase activated by serum and insulin-like growth factor, and it transmits signals by phosphorylating various substrates. The activation of AKT1 depends on the action of phospholipids and kinases on the cell membrane, and this process is crucial for cells to respond to external signals. AKT1 plays a role in multiple cell signaling pathways, including the PI3K / AKT pathway that promotes cell survival and the mTOR pathway that regulates the cell cycle. By phosphorylating different target proteins, AKT1 affects cell growth, differentiation, apoptosis, and metabolism.

[0003] The abnormal activity of AKT1 is closely related to the development of various diseases. Specifically, Proteus syndrome and Cowden syndrome type 6 are both caused by AKT1 mutations, leading to overactivation of the PI3K / AKT pathway, resulting in abnormal cell proliferation and tumor formation. At the same time, AKT1 is also associated with various types of cancers, including breast cancer, colorectal cancer, liver cancer, ovarian cancer, etc. The overactivation of AKT1 can promote the growth and survival of tumor cells. Therefore, AKT1 has become a target for many tumor disease treatment strategies. Small molecule inhibitors targeting AKT1 are being developed to treat tumors and other AKT1-related diseases. By regulating the activity of AKT1, these drugs may provide a new treatment strategy. Summary of the Invention

[0004] The purpose of this application is to provide an siRNA for inhibiting AKT1 gene expression and its application, so as to provide a new treatment strategy for treating cancer and other AKT1-related diseases.

[0005] To achieve the above purpose, in the first aspect of this application, an siRNA for inhibiting AKT1 gene expression is provided, including a sense strand and an antisense strand. The nucleotide sequence of the sense strand is shown as any one of SEQ ID NO.1 to SEQ ID NO.15, and the antisense strand is at least partially complementary to the sense strand to form a double-stranded region.

[0006] In one or more embodiments, the nucleotide sequence of the sense strand is shown as SEQ ID NO.1, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.16.

[0007] In one or more embodiments, the nucleotide sequence of the sense strand is as shown in SEQ ID NO.2, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.17.

[0008] In one or more embodiments, the nucleotide sequence of the sense strand is as shown in SEQ ID NO.3, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.18.

[0009] In one or more embodiments, the nucleotide sequence of the sense strand is as shown in SEQ ID NO.4, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.19.

[0010] In one or more embodiments, the nucleotide sequence of the sense strand is as shown in SEQ ID NO.5, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.20.

[0011] In one or more embodiments, the nucleotide sequence of the sense strand is as shown in SEQ ID NO.6, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.21.

[0012] In one or more embodiments, the nucleotide sequence of the sense strand is as shown in SEQ ID NO.7, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.22.

[0013] In one or more embodiments, the nucleotide sequence of the sense strand is as shown in SEQ ID NO.8, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.23.

[0014] In one or more embodiments, the nucleotide sequence of the sense strand is as shown in SEQ ID NO.9, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.24.

[0015] In one or more embodiments, the nucleotide sequence of the sense strand is as shown in SEQ ID NO.10, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.25.

[0016] In one or more embodiments, the nucleotide sequence of the sense strand is as shown in SEQ ID NO.11, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.26.

[0017] In one or more embodiments, the nucleotide sequence of the sense strand is as shown in SEQ ID NO.12, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.27.

[0018] In one or more embodiments, the nucleotide sequence of the sense strand is as shown in SEQ ID NO.13, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.28.

[0019] In one or more embodiments, the nucleotide sequence of the sense strand is as shown in SEQ ID NO.14, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.29.

[0020] In one or more embodiments, the nucleotide sequence of the sense strand is as shown in SEQ ID NO.15, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.30.

[0021] In one or more embodiments, at least one nucleotide in the sense strand and / or the antisense strand is a modified nucleotide, and the modification includes one or more combinations of 2'-methoxy modification, 2'-fluoro modification, and phosphorothioate modification.

[0022] In one or more embodiments, in the direction from the 5'-end to the 3'-end, the nucleotides at least at positions 1-6 and 10-19 of the sense strand are 2'-methoxy-modified nucleotides, and the nucleotides at least at positions 1, 3-5, 7-13, 15, and 17-21 of the antisense strand are 2'-methoxy-modified nucleotides.

[0023] In one or more embodiments, in the direction from the 5'-end to the 3'-end, the nucleotides at least at positions 7-9 of the sense strand are 2'-fluoro-modified nucleotides, and the nucleotides at least at positions 2, 6, 14, and 16 of the antisense strand are 2'-fluoro-modified nucleotides.

[0024] In one or more embodiments, in the direction from the 5'-end to the 3'-end, the nucleotides at least at positions 1 and 2 of the sense strand are linked by a phosphorothioate group, and the nucleotides at least at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 of the antisense strand are linked by phosphorothioate groups.

[0025] In one or more embodiments, in the direction from the 5'-end to the 3'-end, the nucleotides at least at positions 2 and 3 of the sense strand are linked by a phosphorothioate group.

[0026] In one or more embodiments, the nucleotide sequence of the sense strand is as shown in SEQ ID NO.1 or SEQ ID NO.5, and in the 5'-to-3' direction, between the 18th and 19th nucleotides of the sense strand, there is a phosphorothioate linkage.

[0027] To achieve the above object, a second aspect of the present application provides an siRNA conjugate, comprising the siRNA according to any of the above embodiments and a conjugating group conjugated to the siRNA.

[0028] In one or more embodiments, the nucleotide sequence of the sense strand is as shown in SEQ ID NO.1 or SEQ ID NO.5, the conjugating group is conjugated to the 3'-end of the sense strand of the siRNA, the nucleotide sequence of the conjugating group is as shown in SEQ ID NO.37, and there is a phosphorothioate linkage between each adjacent nucleotide of the conjugating group.

[0029] To achieve the above object, a third aspect of the present application provides an application of the siRNA according to any of the above embodiments or the siRNA conjugate according to any of the above embodiments in the preparation of a drug for preventing or treating a disease associated with abnormal activity of the ATK1 protein.

[0030] In one or more embodiments, the disease includes Cowden syndrome type 6, Proteus syndrome, and tumors.

[0031] To achieve the above object, a fourth aspect of the present application provides an AKT1 inhibitor, and the components of the inhibitor include the siRNA according to any of the above embodiments or the siRNA conjugate according to any of the above embodiments.

[0032] To achieve the above object, a fifth aspect of the present application provides a drug for preventing or treating a disease associated with abnormal activity of the ATK1 protein, comprising the siRNA according to any of the above embodiments or the siRNA conjugate according to any of the above embodiments; and a pharmaceutically acceptable carrier.

[0033] In one or more embodiments, the disease includes Cowden syndrome type 6, Proteus syndrome, and tumors.

[0034] Distinct from the prior art, the beneficial effects of the present application are:

[0035] The present application provides siRNAs for inhibiting the expression of the ATK1 gene, and the siRNAs are modified to ensure their stability and inhibitory activity. Experiments have shown that multiple groups of siRNAs of the present application have significant inhibitory activity on the expression of the ATK1 gene in human liver cancer cells and human breast adenocarcinoma cells. Among them, the inhibition rates of hAKT-1M and hAKT-10M with a final concentration of 10 nM on the expression of the ATK1 gene in Hep3B cells reached 92% and 91% respectively. In particular, at a lower concentration of 0.1 nM, the inhibition rate of hAKT-10M1 on the expression of the ATK1 gene in Hep3B cells could still reach 84%. Therefore, the siRNAs provided by the present application have great application prospects in the preparation of drugs for preventing and / or treating diseases related to ATK1 expression, and provide a new treatment strategy for the treatment of Cowden syndrome type 6, Proteus syndrome and tumors.

[0036] Among the siRNAs provided by the present application, hAKT-86M1, hAKT-87M1, and hAKT-178M1 with different concentrations all showed excellent inhibitory activity on the expression of the ATK1 gene in human tumor cells and mouse tumor cells, demonstrating their application prospects in the preparation of drugs for treating or preventing diseases related to ATK1 expression in different organisms. Brief Description of the Drawings

[0037] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments recorded in the present application. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0038] Figure 1 It is a data graph of the relative expression level of the ATK1 gene mRNA in each group in Example 3 of the present application;

[0039] Figure 2 It is a data graph of the relative expression level of the ATK1 gene mRNA in each group in Example 4 of the present application;

[0040] Figure 3 It is a data graph of the relative expression level of the ATK1 gene mRNA in each group in Example 5 of the present application;

[0041] Figure 4 It is a data graph of the relative expression level of the ATK1 gene mRNA in each group in Example 6 of the present application.

[0042] Figure 5 It is a data graph of the relative expression level of the ATK1 gene mRNA in each group in Example 7 of the present application;

[0043] Figure 6 It is the data graph of the relative expression level of ATK1 gene mRNA in each group in Example 8 of this application;

[0044] Figure 7 It is the data graph of the relative expression level of ATK1 gene mRNA in each group in Example 9 of this application. Detailed implementation manners

[0045] In order to enable those skilled in the art to better understand the technical solutions in this application, the following will clearly and completely describe the technical solutions in the embodiments of this application with reference to the accompanying drawings in the embodiments of this application. Obviously, the described embodiments are only a part of the embodiments of this application, rather than all the embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of this application.

[0046] It should be noted that in the present invention, "modified nucleotide" refers to a nucleotide or nucleotide analogue formed by substituting the hydroxyl group at the 2'-position of the ribose group of the nucleotide with other groups, or a nucleotide whose base on the nucleotide is a modified base, or a compound formed by thiophosphorylating the nucleotide. "Methoxy-modified nucleotide" refers to a nucleotide formed by substituting the 2'-hydroxyl group of the ribose group with a methoxy group. "Fluoro-modified nucleotide" refers to a nucleotide formed by substituting the hydroxyl group at the 2'-position of the ribose group of the nucleotide with a fluorine atom. "Nucleotide analogue" refers to a group that can replace a nucleotide in a nucleic acid but has a structure different from adenosine ribonucleotide, guanosine ribonucleotide, cytosine ribonucleotide, uridine ribonucleotide or thymidine deoxyribonucleotide. Such as an isonucleotide, a bridged nucleic acid (abbreviated as BNA) or an acyclic nucleotide.

[0047] In one embodiment of the present invention, "fluoro-modified nucleotide" refers to a nucleotide formed by substituting the hydroxyl group at the 2'-position of the ribose group of the nucleotide with a fluorine atom, and has the structure shown in the following formula (1). The non-fluoro-modified nucleotide is independently selected from a nucleotide formed by substituting the hydroxyl group at the 2'-position of the ribose group of the nucleotide with a non-fluorine group or a nucleotide analogue.

[0048] In one embodiment of the present invention, the nucleotide formed by substituting the hydroxyl group at the 2'-position of the ribose group with a non-fluorine group is well-known to those skilled in the art, and these nucleotides can be selected from one of 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, 2'-deoxynucleotides.

[0049] In one embodiment of the present invention, the 2'-alkoxy-modified nucleotide is a 2'-methoxy (2'-OMe)-modified nucleotide as shown in formula (2), i.e., methoxy modification; the 2'-substituted alkoxy-modified nucleotide, for example, can be a 2'-O-methoxyethyl (2'-MOE)-modified nucleotide as shown in formula (3), the 2'-amino (2'-NH2)-modified nucleotide as shown in formula (4), and the 2'-deoxynucleotide (DNA) as shown in formula (5):

[0050]

[0051] In one embodiment of the present invention, the phosphate group having a modifying group is a phosphorothioate group having the structure shown in formula (6). In one embodiment of the present invention, the nucleotide linked by the phosphorothioate group is as shown in formula (7):

[0052]

[0053] In one embodiment of the present invention, C18 represents Internal Spacer 18, and the structural formula is as shown in formula (8).

[0054]

[0055] Mutations in AKT1 can lead to overactivation of the PI3K / AKT pathway, resulting in abnormal cell proliferation and tumor formation. By inhibiting the expression of the AKT1 gene, cancer and other AKT1-related diseases can be treated. For this purpose, the applicant has developed an siRNA that can knockdown the expression level of the AKT1 gene based on RNA interference technology, which is introduced in detail below.

[0056] Example 1: Sequence Design

[0057] First, the applicant designed multiple groups of siRNA sequences based on the mRNA sequence encoding the ATK gene in the NCBI database. The reference transcript information is as follows: NM_005163.2; NM_001014431.2; NM_001382430.1; NM_001382431.1; NM_001382432.1; NM_001382433.1; NM_001626.6; NM_005465.7.

[0058] The siRNA sequences designed by the applicant are shown in Table 1:[[]]END]]

[0059] Table 1 siRNA Sequences and Numbers for Inhibiting ATK1

[0060]

[0061]

[0062] Example 2: Modification of siRNA

[0063] In order to improve the stability of siRNA and effectively inhibit the expression of the target gene, the applicant further modified the siRNA sequences in Table 1 above.

[0064] Specifically, in this example, in the direction from the 5'-end to the 3'-end, the nucleotides at positions 1-6 and 10-19 of the sense strand of siRNA were modified with methoxy groups, and the nucleotides at positions 1, 3-5, 7-13, 15, and 17-21 of the antisense strand of siRNA were modified with methoxy groups;

[0065] In the direction from the 5'-end to the 3'-end, the nucleotides at positions 7-9 of the sense strand were modified with fluorine, and the nucleotides at positions 2, 6, 14, and 16 of the antisense strand were modified with fluorine;

[0066] In the direction from the 5'-end to the 3'-end, the nucleotides between positions 1 and 2 and between positions 2 and 3 of the sense strand were linked by phosphorothioate groups, and the nucleotides between positions 1 and 2, between positions 2 and 3, between positions 19 and 20, and between positions 20 and 21 of the antisense strand were linked by phosphorothioate groups.

[0067] Based on the above modification scheme, the modified siRNAs, namely hAKT-1M1, hAKT-2M1, hAKT-4M1, hAKT-6M1, hAKT-10M1, hAKT-42M1, hAKT-55M1, hAKT-82M1, hAKT-86M1, hAKT-87M1, hAKT-115M1, hAKT-155M1, hAKT-178M1, hAKT-181M1, hAKT-191M1, can be specifically seen in Table 2 below.

[0068] In addition, the applicant also adopted another modification scheme for hAKT-1 and hAKT-10. This modification scheme is basically the same as hAKT-1M1 and hAKT-10M1, except that:

[0069] The nucleotides between positions 1 and 2 and between positions 18 and 19 of the sense strand were linked by phosphorothioate groups, and then hAKT-1M1P and hAKT-10M1P were obtained. Specifically, see Table 2 below.

[0070] In Table 2 below, m represents a nucleotide with a methoxy modification on the nucleotide adjacent to its left; f represents a nucleotide with a fluoro modification on the nucleotide adjacent to its left; s represents a phosphorothioate modification between the two nucleotides adjacent to its left and right.

[0071] Table 2 Modified siRNA Sequences

[0072]

[0073]

[0074] Example 3: Detection of the Inhibitory Activity of siRNA on the Expression of the ATK1 Gene in Hep3B Cells

[0075] Hep3B cells (human liver cancer cells, purchased from Wuhan Punosai Life Science Co., Ltd., product number: CL-0102) cultured in a 10 cm culture dish were digested with conventional trypsin 48 h after passage. After digestion, they were resuspended with complete medium, and then the Hep3B cells were diluted to 3×10 5 / mL to obtain a cell suspension.

[0076] The cell suspension was inoculated into a 96-well plate at 50 μL / well. Using Lipofectamine RNAiMAX (purchased from Thermo Fisher, catalog number 11668-019), hAKT-1M1, hAKT-2M1, hAKT-4M1, hAKT-6M1, and hAKT-10M1 in Table 2 were selected as research objects for cell transfection. At the same time, a negative control group NC and a blank control group MOCK were introduced. Each siRNA was set with 3 biological replicates, and the final transfection concentration of the siRNA was 10 nM. Among them, the blank control group MOCK was a group that only added the interference reagent without adding any sequence, and the negative control group NC added NC with a final concentration of 10 nM in the wells. The NC sequence is shown in Table 3.

[0077] 48 h after transfection, the medium was removed and the cells were collected for RNA extraction. According to the instructions, a magnetic bead method cell total RNA extraction kit (GenePharma - E31008-96) was used to extract total RNA to obtain an RNA extraction solution.

[0078] Table 3 Negative Control Group Sequences

[0079]

[0080]

[0081] The qPCR method was used to detect the expression level of the ATK1 gene in the RNA extraction solution. The specific steps of qPCR include:

[0082] 1. Configure the genomic DNA removal reaction system according to Table 4, gently pipette and mix well to remove the genomic DNA in the RNA extraction solution (reaction program: 42 °C, 2 min) to obtain a pure RNA extraction solution;

[0083] Table 4 Genomic DNA removal reaction system

[0084] Reaction solution Dosage for single reaction 4×gDNAwiper Mix 4 μL RNA extraction solution 12 μL

[0085] 2. Configure the cDNA synthesis reaction system according to Table 5, then gently pipette and mix well to perform reverse transcription (reaction program: 50 °C, 15 min; 85 °C, 2 min). After the reverse transcription is completed, a cDNA solution is obtained. Dilute the cDNA solution 5-fold and store it at -20 °C for later use (or store it at 4 °C for short-term).

[0086] Table 5 cDNA synthesis reaction system

[0087] Reaction solution Dosage for single reaction 5×RT Mix 4 μL Pure RNA extraction solution 16 μL

[0088] 3. Use the cDNA solution as a template and the gene encoding glyceraldehyde-3-phosphate dehydrogenase (GAPDH gene) as an internal reference gene to configure the RT-qPCR reaction system according to Table 6, and then perform fluorescence quantitative PCR reaction on the 480II. Among them, the primer sequences in the RT-qPCR reaction system are shown in Table 7.

[0089] Table 6 RT-qPCR probe method reaction system

[0090]

[0091]

[0092] Table 7 RT-qPCR primer information

[0093] Name Sequence 5'-3' Number hAKT1-F ATGCAGCATCGCTTCTTTGC SEQ ID NO.33 hAKT1-R GGCCGTGAACTCCTCATCAA SEQ ID NO.34 hGAPDH-F AGGTCGGAGTCAACGGATTT SEQ ID NO.35 hGAPDH-R TGGAATTTGCCATGGGTGGA SEQ ID NO.36

[0094] Collect the Ct values of the target gene ATK1 and the internal reference gene GAPDH in each experimental group and the control group, and then use the comparative Ct method to analyze the data and perform normalization analysis for the MOCK group.

[0095] Specifically, first perform relative quantification on the Ct values of the target gene ATK1 and the internal reference gene GAPDH, and the calculation method is as follows:

[0096] ΔCt (test group) = Ct (test group target gene) – Ct (test group internal reference gene)

[0097] ΔCt (control group) = Ct (control group target gene) – Ct (control group internal reference gene)

[0098] ΔΔCt (test group) = ΔCt (test group) - ΔCt (average of control groups)

[0099] ΔΔCt (control group) = ΔCt (control group) - ΔCt (average of control groups)

[0100] Define the expression level of the mRNA of the ATK1 gene in the blank control group MOCK as 100%. Based on the blank control group MOCK, normalize the expression level of the mRNA of the ATK1 gene in the test group as follows:

[0101] Relative expression level of the mRNA of the ATK1 gene in the test group = 2^(-ΔΔCt (test group)).

[0102] Inhibition rate of the ATK1 mRNA in the test group = 1 - relative expression level of the ATK1 mRNA in the test group

[0103] For the siRNA of the same test group, the average value of the relative expression level of the mRNA of the ATK1 gene in the test group at each concentration is the arithmetic mean of the relative expression levels of 3 culture wells at this concentration, and the Figure 1 experimental results are obtained.

[0104] Please refer to Figure 1 , Figure 1 which is the data graph of the relative expression level of the mRNA of the ATK1 gene in each group in Example 3 of this application.

[0105] As Figure 1 shown, hAKT-1M1, hAKT-2M1, hAKT-4M1, hAKT-6M1, and hAKT-10M1 all have obvious inhibitory effects on the expression of the ATK1 gene. Among them, AKT1M1 and AKT10M1 have the highest inhibitory activities. Based on the blank control group MOCK, the inhibition rates of the expression of the ATK1 gene in Hep3B cells by hAKT-1M1 and hAKT-10M1 with a final concentration of 10 nM reach 84% and 85% respectively.

[0106] Example 4: Detection of the inhibitory activity of siRNA on the expression of the ATK1 gene in SKBR3 cells

[0107] The applicant selects hAKT-1M1 and hAKT-10M1 with the highest inhibitory activity on the expression of the ATK1 gene in Example 3 as the research objects for further experiments.

[0108] Specifically, SKBR3 cells (human breast adenocarcinoma cells, purchased from Wuhan Punosai Life Science Co., Ltd., product number: CL-0211) were selected as experimental cells. Using the same method as in Example 3, the inhibitory activities of hAKT-1M1 and hAKT-10M1 on the expression of the ATK1 gene in SKBR3 cells were tested. The final concentration of siRNA was set at 10 nM, and the Figure 2 experimental results were obtained.

[0109] Please refer to Figure 2 , Figure 2 which is a graph of the relative expression levels of the ATK1 gene mRNA in each group in Example 4 of this application.

[0110] As Figure 2 shown, hAKT-1M1 and hAKT-10M1 also have significant inhibitory effects on the expression of the ATK1 gene in SKBR3 cells. Based on the blank control group MOCK, the inhibition rates of hAKT-1M1 and hAKT-10M1 with a final concentration of 10 nM on the expression of the ATK1 gene in Hep3B cells reached 92% and 91% respectively.

[0111] Example 5: Single-concentration screening

[0112] The applicant further selected hAKT-2M1, hAKT-42M1, hAKT-55M1, hAKT-82M1, hAKT-86M1, hAKT-87M1, hAKT-115M1, hAKT-155M1, hAKT-178M1, hAKT-181M1, hAKT-191M1 in Table 2 as the research objects. The experimental method was the same as that in Example 3 for activity screening.

[0113] In the experiment of Example 5, the final concentration of siRNA in each well was set at 2.5 nM, the transfection time was set at 24 h, and the experimental cells were Hep3B cells, and the Figure 3 experimental results were obtained.

[0114] Please refer to Figure 3 , Figure 3 which is a graph of the relative expression levels of the ATK1 gene mRNA in each group in Example 5 of this application.

[0115] As Figure 3As shown, siRNAs other than hAKT-115M1 and hAKT-155M1 all have an obvious inhibitory effect on the expression of the ATK1 gene in Hep3B cells. Among them, hAKT-86M1, hAKT-87M1, and hAKT-178M1 have the optimal inhibitory activity. Based on the blank control group MOCK, the inhibition rates of hAKT-86M1, hAKT-87M1, and hAKT-178M1 with a final concentration of 2.5 nM on the expression of the ATK1 gene in Hep3B cells reach 73%, 67%, and 73% respectively.

[0116] Example 6: Detection of the inhibitory activity of siRNAs with different concentrations on the expression of the ATK1 gene in Hep3B cells

[0117] To verify the influence of concentration on the inhibitory activity of siRNAs, the applicant selected hAKT-86M1, hAKT-87M1, and hAKT-178M1 with the optimal inhibitory activity in Example 5 as the research objects; at the same time, to verify the influence of different modification schemes on the inhibitory activity, hAKT-1M1P and hAKT-10M1P in Table 2 were also selected as the research objects; in addition, to verify the activity of the siRNA conjugate, the applicant also conjugated CPG2018 at the 3'-end of the sense strand of hAKT-1M1 and hAKT-10M1 through a linker as the research objects, denoted as hAKT-1M1CPG2018 and hAKT-10M1CPG2018. Specifically, the linker used is C18, and C18 is Internal Spacer 18. The nucleotide sequence of CPG2018 is shown in SEQ ID NO.37, and each adjacent nucleotide of CPG2018 is connected by a phosphorothioate group. The specific modified sequences are shown in Table 8 below.

[0118] Table 8 Sequence information of the siRNA conjugates in Example 6

[0119]

[0120] Specifically, in Example 6, a cell-level screening experiment was conducted on the above groups of siRNAs. The final concentrations of the siRNAs were set to 10 nM, 1 nM, and 0.1 nM respectively. The cells used were Hep3B cells. The experimental method was the same as that in Example 3, and the transfection time was set to 24 h, obtaining Figure 4 the experimental results.

[0121] Please refer to Figure 4 , Figure 4 which is the data graph of the relative mRNA expression level of the ATK1 gene in each group in Example 6 of this application.

[0122] As Figure 4As shown, hAKT-86M1, hAKT-87M1, hAKT-178M1, hAKT-1M1P, hAKT-10M1P, hAKT-1M1CPG2018, and hAKT-10M1CPG2018 at different concentrations all showed significant inhibitory effects on the expression of the ATK1 gene.

[0123] At a higher concentration of 10 nM, compared with the blank control group MOCK, the inhibition rate of hAKT-10M1CPG2018 with the lowest inhibitory activity on the expression of the ATK1 gene in Hep3B cells could reach 78%, while the inhibition rate of hAKT-86M1 with the highest inhibitory activity reached 88%.

[0124] At a medium concentration of 1 nM, compared with the blank control group MOCK, the inhibition rates of each group were all around 85%. Among them, the inhibition rate of hAKT-86M1 was the highest, reaching 86%.

[0125] At a lower concentration of 0.1 nM, compared with the blank control group MOCK, the inhibition rate of hAKT-87M1 with the lowest inhibitory activity on the expression of the ATK1 gene in Hep3B cells could reach 63%, while the inhibition rate of hAKT-10M1 with the highest inhibitory activity reached 84%.

[0126] Example 7: Detection of the inhibitory activity of siRNA on the expression of the ATK1 gene in 4T1 cells

[0127] Examples 3 to 6 above demonstrated the inhibitory activities of the siRNAs of the present application on the expression of the ATK1 gene in human liver cancer cells and human breast adenocarcinoma cells. To further study whether the siRNAs of the present application can inhibit the expression of the ATK1 gene in other biological cells, the applicant also conducted supplementary experiments.

[0128] Specifically, in Example 7, 4T1 cells (mouse breast cancer cells, purchased from Wuhan Punosai Life Science Co., Ltd., product number: CL-0007) were selected as experimental cells, and the same siRNAs as in Example 6 were selected as the research objects. The final concentrations of the siRNAs were set at 10 nM, 1 nM, and 0.1 nM respectively. The experimental method was the same as that in Example 3, and the transfection time was set at 24 h, obtaining Figure 5 the experimental results.

[0129] Please refer to Figure 5 , Figure 5 which is a graph of the relative expression levels of the ATK1 gene mRNA in each group in Example 7 of the present application.

[0130] As Figure 5As shown, hAKT-86M1, hAKT-87M1, hAKT-178M1, and hAKT-1M1CPG2018 showed significant inhibitory activity against the expression of the ATK1 gene in 4T1 cells. At the same time, the inhibitory effect of hAKT1M1 in 4T1 was enhanced after coupling with CPG2018; hAKT-10M1P also showed certain inhibitory activity.

[0131] Among them, compared with the blank control group MOCK, the inhibition rates of hAKT-86M1 and hAKT-87M1 on the expression of the ATK1 gene in 4T1 cells reached 96% and 94% respectively at the final concentration of 10 nM; the inhibition rates could also reach 93% and 92% at the final concentration of 1 nM; at the lower concentration of 0.1 nM, the inhibition rates of the two decreased, but still reached 70% and 61%.

[0132] hAKT-178M1 showed excellent inhibitory activity at different concentrations. Compared with the blank control group MOCK, the inhibition rates of hAKT-178M1 on the expression of the ATK1 gene in 4T1 cells reached 96%, 94%, and 87% at the final concentrations of 10 nM, 1 nM, and 0.1 nM respectively, and the concentration had little effect on its inhibitory activity.

[0133] Example 8: Detection of the inhibitory activity of different concentrations of siRNA on the expression of the ATK1 gene in SKBR3 cells

[0134] Furthermore, the applicant selected hAKT-178M1 with the optimal inhibitory activity in each of the above examples as the research object, selected SKBR3 cells as the experimental cells, and used the same method as in Example 3 to test the inhibitory activity of different concentrations of hAKT-178M1 on the expression of the ATK1 gene in SKBR3 cells; in addition, in order to verify the activity of the siRNA conjugate, the applicant also coupled CPG2018 to the 3' end of the sense strand of hAKT-178M1 through Spacer 18 as the research object, denoted as hAKT-178M1CPG2018. The CPG2018 sequence is shown in Example 6, and the specific modified sequence is shown in Table 9 below.

[0135] Table 9 Sequence information of the siRNA conjugate in Example 8

[0136]

[0137] Specifically, in Example 8, the final concentrations of the above groups of siRNA were set to 10 nM, 1 nM, and 0.1 nM respectively. The experimental cells were SKBR3 cells, and the experimental method was the same as in Example 3. The transfection time was set to 24 h, and the Figure 6 experimental results were obtained.

[0138] Please refer toFigure 6 , Figure 6 is the data graph of the relative expression levels of the ATK1 gene mRNA in each group in Example 8 of this application.

[0139] As Figure 6 shown, both hAKT-178M1 and hAKT-178M1 CPG2018 showed excellent inhibitory activity on the ATK1 gene of SKBR3 cells at different concentrations, and as the concentration increased, the inhibitory activity was further enhanced, while CPG2018 itself had poor inhibitory activity.

[0140] Example 9: Detection of the inhibitory activity of different concentrations of siRNA on the expression of the ATK1 gene in 4T1 cells

[0141] The applicant also selected hAKT-178M1 and hAKT-178M1 CPG2018 in Example 8 as the research objects, selected 4T1 cells as the experimental cells, and used the same method as in Example 3 to test the inhibitory activity of different concentrations of siRNA on the expression of the ATK1 gene in 4T1 cells.

[0142] Specifically, in Example 9, the final concentrations of the above-mentioned groups of siRNA were set to 10 nM, 1 nM, and 0.1 nM respectively. The experimental cells were all 4T1 cells. The experimental method was the same as that in Example 3, and the transfection time was set to 24 h, obtaining Figure 7 the experimental results.

[0143] Please refer to Figure 7 , Figure 7 is the data graph of the relative expression levels of the ATK1 gene mRNA in each group in Example 9 of this application.

[0144] As Figure 7 shown, both hAKT-178M1 and hAKT-178M1 CPG2018 showed excellent inhibitory activity on the ATK1 gene of 4T1 cells at different concentrations, and as the concentration increased, the inhibitory activity was further enhanced, while CPG2018 itself had poor inhibitory activity.

[0145] For those skilled in the art, it is obvious that this application is not limited to the details of the above-mentioned exemplary embodiments, and can be implemented in other specific forms without departing from the spirit or basic characteristics of this application. Therefore, from any point of view, the embodiments should be regarded as exemplary and non-limiting. The scope of this application is defined by the appended claims rather than the above description. Therefore, all changes falling within the meaning and scope of the equivalent elements of the claims are intended to be included in this application. Any reference signs in the claims should not be regarded as limiting the claimed rights.

[0146] In addition, it should be understood that although this specification is described in terms of embodiments, not every embodiment contains only an independent technical solution. This narrative manner of the specification is only for clarity. Those skilled in the art should regard the specification as a whole, and the technical solutions in various embodiments can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. An siRNA for inhibiting the expression of AKT1 gene, characterized in that, It includes a sense strand and an antisense strand. The nucleotide sequence of the sense strand is shown as any one of SEQ ID NO.1 to SEQ ID NO.15, and the antisense strand is at least partially complementary to the sense strand to form a double-stranded region.

2. The siRNA according to claim 1, wherein The nucleotide sequence of the sense strand is shown as SEQ ID NO.1, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.16; or, The nucleotide sequence of the sense strand is shown as SEQ ID NO.2, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.17; or, The nucleotide sequence of the sense strand is shown as SEQ ID NO.3, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.18; or, The nucleotide sequence of the sense strand is shown as SEQ ID NO.4, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.19; or, The nucleotide sequence of the sense strand is shown as SEQ ID NO.5, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.20; or, The nucleotide sequence of the sense strand is shown as SEQ ID NO.6, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.21; or, The nucleotide sequence of the sense strand is shown as SEQ ID NO.7, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.22; or, The nucleotide sequence of the sense strand is shown as SEQ ID NO.8, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.23; or, The nucleotide sequence of the sense strand is shown as SEQ ID NO.9, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.24; or, The nucleotide sequence of the sense strand is shown as SEQ ID NO.10, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.25; or, The nucleotide sequence of the sense strand is shown as SEQ ID NO.11, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.26; or, The nucleotide sequence of the sense strand is shown as SEQ ID NO.12, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.27; or, The nucleotide sequence of the sense strand is shown as SEQ ID NO.13, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.28; or, The nucleotide sequence of the sense strand is shown as SEQ ID NO.14, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.29; or, The nucleotide sequence of the sense strand is shown as SEQ ID NO.15, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.

30.

3. The siRNA according to claim 1 or 2, characterized in that, At least one nucleotide in the sense strand and / or the antisense strand is a modified nucleotide, and the modification includes one or a combination of more than one of 2'-methoxy modification, 2'-fluoro modification, and phosphorothioate modification.

4. The siRNA according to claim 3, wherein In the 5'-to-3' direction, nucleotides at least at positions 1 to 6 and 10 to 19 of the sense strand are 2'-O-methyl-modified nucleotides, and nucleotides at least at positions 1, 3 to 5, 7 to 13, 15, and 17 to 21 of the antisense strand are 2'-O-methyl-modified nucleotides; and / or, In the 5'-to-3' direction, nucleotides at least at positions 7 to 9 of the sense strand are 2'-fluoro-modified nucleotides, and nucleotides at least at positions 2, 6, 14, and 16 of the antisense strand are 2'-fluoro-modified nucleotides; and / or, In the 5'-to-3' direction, nucleotides at least at positions 1 and 2 of the sense strand are linked by a phosphorothioate group, and nucleotides at least at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 of the antisense strand are linked by a phosphorothioate group.

5. The siRNA according to claim 4, wherein In the 5'-to-3' direction, nucleotides at least at positions 2 and 3 of the sense strand are linked by a phosphorothioate group.

6. The siRNA according to claim 4, characterized in that, The nucleotide sequence of the sense strand is as shown in SEQ ID NO.1 or SEQ ID NO.

5. In the 5'-to-3' direction, nucleotides at least at positions 18 and 19 of the sense strand are linked by a phosphorothioate group.

7. An siRNA conjugate, characterized in that, Comprising the siRNA according to any one of claims 1 to 6 and a conjugate group conjugated to the siRNA.

8. The siRNA conjugate according to claim 7, wherein The nucleotide sequence of the sense strand is as shown in SEQ ID NO.1 or SEQ ID NO.

5. The conjugate group is conjugated to the 3'-end of the sense strand of the siRNA. The nucleotide sequence of the conjugate group is as shown in SEQ ID NO.37, and each adjacent nucleotide of the conjugate group is linked by a phosphorothioate group.

9. Use of the siRNA according to any one of claims 1 to 6 or the siRNA conjugate according to claim 7 or 8 in the preparation of a drug for preventing or treating a disease associated with ATK1 expression.

10. The application according to claim 9, wherein The diseases include Cowden syndrome type 6, Proteus syndrome, tumors.

11. An AKT1 inhibitor, characterized in that, The composition of the inhibitor comprises the siRNA according to any one of claims 1 to 6 or the siRNA conjugate according to claim 7 or 8.

12. A drug for preventing or treating a disease related to ATK1 expression, characterized in that, Comprising the siRNA according to any one of claims 1 to 6 or the siRNA conjugate according to claim 7 or 8; and a pharmaceutically acceptable carrier.

13. The drug according to claim 12, wherein The diseases include Cowden syndrome type 6, Proteus syndrome, tumors.

Images