Application of small interfering RNA (Ribonucleic Acid) targeting Zyx gene

Through small interfering RNA targeting the Zyx gene, the treatment problem of fibrotic interstitial lung disease is solved, the survival rate in mice is significantly improved, the degree of pathological damage and fibrosis is reduced, and a more effective, economical and less side effects are provided.

CN120272477APending Publication Date: 2025-07-08WOMEN & CHILDRENS MEDICAL CENTER AFFILIATED WITH GUANGZHOU MEDICAL UNIVERSITY
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510354310.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-25
Publication Date
2025-07-08

AI Technical Summary

Technical Problem

The prior art lacks effective prevention and treatment methods for interstitial fibrosis lung disease. The existing drugs are expensive and have obvious side effects, and cannot reverse pulmonary fibrosis.

Method used

Develop small interfering RNA targeting the Zyx gene, reduce the expression of Zyx genes through RNA interference technology, reduce the transcription level of fibrosis-related genes, and prepare it into a pharmaceutically acceptable drug form for the treatment of fibrotic interstitial lung disease.

Benefits of technology

In the mouse model, it significantly improves survival, reduces pathological damage, reduces collagen fiber deposition, reduces fibrosis degree, and reduces inflammatory response.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005326866330000011
    Figure HDA0005326866330000011
  • Figure HDA0005326866330000012
    Figure HDA0005326866330000012
  • Figure HDA0005326866330000021
    Figure HDA0005326866330000021
Patent Text Reader

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to application of small interfering RNA (Ribonucleic Acid) of a targeted Zyx gene. The invention provides siRNA (small interfering Ribonucleic Acid) of a targeted Zyx gene, and further provides application of the siRNA in prevention and treatment of fibrosis interstitial lung diseases. Experimental data prove that in a mouse bleomycin model, siRNA of a targeted Zyx gene can effectively improve the survival rate of a sick mouse, alveolar wall thickening, lung substantive thickening and inflammatory cell infiltration of a Zyx knock-down group are not obvious, and pathological damage caused by bleomycin is effectively relieved through knock-down of the Zyx gene; collagen fiber deposition of a Zyx knock-down group is reduced, and the transcription level of fibrosis-related genes is obviously reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to the application of small interfering RNA targeting the Zyx gene. Background Art

[0002] Interstitial lung disease is a general term for a heterogeneous group of more than two hundred lung diseases, involving varying degrees of inflammation and fibrosis of the lung interstitium, with gas exchange disorders and dyspnea as the main clinical symptoms, and ultimately leading to respiratory failure and death of patients. It is a serious respiratory disease. According to the different symptoms, lung function and lesion types of patients, interstitial lung disease can be divided into fibrotic interstitial lung disease and non-fibrotic interstitial lung disease. Among them, pneumoconiosis and idiopathic pulmonary fibrosis are the most common fibrotic interstitial lung diseases. With environmental pollution and the decline of air quality, the global incidence and mortality of pulmonary fibrosis show an upward trend every year, and most patients die within 3 to 5 years after diagnosis. The mortality rate is higher than that of most tumors, seriously threatening human health.

[0003] The etiology and pathogenesis of fibrotic interstitial lung disease are complex and unclear, and multiple cells, molecules and physiological processes are involved, with a very poor prognosis. It is currently considered that the continuous damage and abnormal repair of alveolar epithelial cells are the main causes of fibrotic interstitial lung disease. The continuous damage and abnormal repair of alveolar epithelial cells, the abnormal differentiation of lung fibroblasts into myofibroblasts and the continuous secretion of extracellular matrix, and the dysfunction of alveolar macrophages further promote collagen deposition and lung parenchymalization, accompanied by inflammation and lung tissue damage, ultimately leading to the loss of lung function. Clinically, there is no effective preventive measure for the occurrence of fibrotic interstitial lung disease, and there are also difficulties such as limited treatment means and poor treatment effects. The main drugs clinically used to treat fibrotic interstitial lung disease are pirfenidone and nintedanib, which target transforming growth factor-β and tyrosine protein kinase receptor respectively. Randomized controlled trials have shown that both drugs can effectively delay the decline of patients' lung function and moderately reduce the mortality rate. However, these two drugs cannot reverse the pulmonary fibrosis of patients, and have the disadvantages of high price, obvious side effects (including nausea, diarrhea, dyspepsia and photosensitivity, etc.) and cannot be used for disease prevention. Therefore, developing more effective, more economical and less side-effect drugs is the key to the prevention and treatment of fibrotic interstitial lung disease to reduce its incidence and extend the lifespan of patients.

[0004] RNA interference (RNAi) is a gene regulation strategy at the transcriptional level. By interfering with the pairing of interfering RNA (iRNA) and target messenger RNA (mRNA), the target mRNA is degraded or translation is prematurely terminated, achieving the purpose of reducing the expression level of the target gene. Since its discovery in 1998, RNAi has been widely used in the treatment of various diseases, especially tumors and liver diseases. Currently, 6 iRNA drugs have been approved for marketing globally, demonstrating the great medicinal potential of iRNA. However, there is still no relevant report on the application of iRNA in the prevention and treatment of fibrotic interstitial lung disease. Summary of the Invention

[0005] In order to overcome the existing clinical difficulties of fibrotic interstitial lung disease, the technical solution adopted is:

[0006] The purpose of the first aspect of the present invention is to provide a small interfering RNA targeting the Zyx gene, and the sense strand sequence of the small interfering RNA is at least one of a1) and a2):

[0007] a1) shown in any one of SEQ ID NO:1 - 3;

[0008] a2) a small interfering RNA with the same function obtained by substituting and / or deleting and / or adding one or several nucleotides to the nucleic acid sequence shown in any one of SEQ ID NO:1 - 3.

[0009] In some embodiments of the present invention, the small interfering RNA includes pharmaceutically acceptable modifications.

[0010] In some embodiments of the present invention, the pharmaceutically acceptable modifications include but are not limited to at least one of the modification of the phosphate group, the modification of the ribose, and the modification of the base.

[0011] In some embodiments of the present invention, the pharmaceutically acceptable modifications include but are not limited to: thiophosphate modification and borate phosphate modification of the phosphodiester bond, 2'-O-Me modification and 2'-O-F modification of the ribose group, 5'-bromouracil, 5'-pseudouracil, 2'-thiouracil, 5'-iodouracil, etc. of the base.

[0012] The purpose of the second aspect of the present invention is to provide the application of a Zyx gene inhibitor in the preparation of a product for treating fibrotic interstitial lung disease.

[0013] In some embodiments of the present invention, the Zyx gene inhibitor includes the small interfering RNA targeting the Zyx gene described in the first aspect of the present invention. Further, it can also be a mixture of the above-mentioned multiple small interfering RNAs targeting the Zyx gene.

[0014] In some embodiments of the present invention, the fibrotic interstitial lung disease includes but is not limited to: fibrotic interstitial lung disease, non-fibrotic interstitial lung disease, pneumoconiosis, idiopathic fibrosis, cystic fibrosis, or idiopathic nonspecific interstitial pneumonia.

[0015] In some embodiments of the present invention, the product includes a drug.

[0016] In some embodiments of the present invention, the drug includes pharmaceutically acceptable excipients.

[0017] In some embodiments of the present invention, the pharmaceutically acceptable excipients include at least one of a solvent, a propellant, a solubilizer, a cosolvent, an emulsifier, a colorant, a binder, a disintegrant, a filler, a lubricant, a wetting agent, an osmotic pressure regulator, a stabilizer, a glidant, a flavoring agent, a preservative, a suspending agent, a coating material, an aromatic agent, an antiadhesive, a chelating agent, a penetration enhancer, a pH regulator, a buffer, a plasticizer, a surfactant, a foaming agent, a defoaming agent, a thickening agent, a clathrate, a humectant, an absorbent, a diluent, a flocculant and an anti-flocculant, a filter aid, a release retardant, a carrier.

[0018] The above-mentioned pharmaceutically acceptable excipients are generally recognized for this purpose and are used as inactive ingredients of the medicament. Compilations of pharmaceutically acceptable excipients can be found in "Handbook of Pharmaceutical Excipients" (2nd Edition, edited by A. Wade and P. J. Weller; published by the American Pharmaceutical Association, Washington and The Pharmaceutical Press, London, 1994); "List of Medicinal Excipients in the Pharmacopoeia of the People's Republic of China", and other reference books.

[0019] In some embodiments of the present invention, the dosage form of the drug includes at least one of a powder, a tablet, a granule, a sustained-release agent, a solution, a dry suspension, an effervescent tablet, an emulsion, a suspension, a drop.

[0020] In some embodiments of the present invention, the administration object of the product is a mammal.

[0021] In some embodiments of the present invention, the mammal includes a human and a mouse.

[0022] In some embodiments of the present invention, when the administration object is a mouse, the working dose of the small interfering RNA in the product is 0.5 μg / kg to 15 μg / kg.

[0023] In some embodiments of the present invention, when the administration object is a mouse, the administration time can be, but is not limited to: within one week before the onset of the disease.

[0024] In some embodiments of the present invention, when the administration object is a mouse, the administration method can be, but is not limited to: intranasal drip, intravenous injection, intratracheal instillation, intraperitoneal injection, etc.

[0025] In some embodiments of the present invention, when the administration object is a mouse, the administration frequency can be, but is not limited to: once every 5 days, 7 days, 10 days or 14 days.

[0026] Those skilled in the art can understand that when the administration object changes, its dosage, administration method, and administration frequency often need to be adjusted. Therefore, the drug administration conditions in mice in the present invention do not constitute a limitation of the present invention. When the administration object is a human, those skilled in the art can make adaptive adjustments.

[0027] The third aspect of the present invention provides a pharmaceutical composition, comprising the small interfering RNA of the first aspect of the present invention, a pharmaceutically acceptable excipient, and one or more other active ingredients.

[0028] In some embodiments of the present invention, the other active ingredient is a conventional drug used in the art for the treatment of fibrotic interstitial lung disease, such as Pirfendione and Nintedanib.

[0029] The beneficial effects of the present invention are:

[0030] The present invention provides a siRNA targeting the Zyx gene, and further provides its application in the prevention and treatment of fibrotic interstitial lung disease. The present invention proves through experimental data that in a mouse bleomycin model, the siRNA targeting the Zyx gene can effectively improve the survival rate of diseased mice. In the Zyx knockdown group, the alveolar wall thickening, lung parenchymal thickening, and inflammatory cell infiltration are not obvious. The knockdown of the Zyx gene effectively reduces the pathological damage caused by bleomycin; the collagen fiber deposition in the Zyx knockdown group is reduced, and the transcriptional levels of fibrosis-related genes are significantly decreased. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The following further describes the present invention in conjunction with the drawings and embodiments, where:

[0032] Figure 1 For the bleomycin group (BLM group) and the Zyx knockdown group (BLM+siZyx group), on the 7th day after administration, the transcriptional level of the Zyx gene in the mouse lung tissue was detected by real-time quantitative PCR.

[0033] Figure 2Survival rates of mice in different groups were recorded and statistically analyzed within 21 days after bleomycin administration.

[0034] Figure 3 On the 21st day after bleomycin administration, the mice were sacrificed, and lung tissues were taken, paraffin-embedded, stained with H&E, and the pathological lung damage in mice of different groups was analyzed and compared.

[0035] Figure 4 On the 21st day after bleomycin administration, the mice were sacrificed, and lung tissues were taken, paraffin-embedded, stained with Masson, and the degree of pulmonary fibrosis in mice of different groups was analyzed and compared.

[0036] Figure 5 On the 21st day after bleomycin administration, the mice were sacrificed, and lung tissues were taken. Total RNA was extracted, and qPCR was used to analyze and compare the transcriptional levels of fibrosis-related genes in the lung tissues of mice in different groups. Detailed implementation manners

[0037] The concept of the present invention and the technical effects produced will be clearly and completely described below in conjunction with the embodiments to fully understand the purpose, features, and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative efforts shall fall within the scope of protection of the present invention.

[0038] Example 2 Design and synthesis of siRNA targeting the Zyx gene

[0039] In this example, 3 kinds of siRNAs targeting the Zyx gene were designed, and their sense strand sequences are as follows:

[0040] Sense strand of siRNA-SEQ1: 5’-CAGCCUGUGUCUUCUGCUATT-3’ (SEQ ID NO: 1);

[0041] Sense strand of siRNA-SEQ2: 5’-AGACGAGACUGUGCGAGUATT-3’ (SEQ ID NO: 2);

[0042] Sense strand of siRNA-SEQ3: 5’-GCUGAUGCAGGACAUGGAATT-3’ (SEQ ID NO: 3).

[0043] The antisense strand sequences are as follows:

[0044] Antisense strand of siRNA-SEQ1: 5’-TTGUCGGACACAGAAGACGAU-3’ (SEQ ID NO: 4);

[0045] Antisense strand of siRNA-SEQ2: 5’-TTUCUGCUCUGACACGCUCAU-3’ (SEQ ID NO: 5);

[0046] Antisense strand of siRNA-SEQ3: 5’-TTCGACUACGUCCUGUACCUU-5’ (SEQ ID NO: 6).

[0047] The above siRNAs were synthesized and confirmed by Shanghai Sangon Biotech Co., Ltd.

[0048] Example 2 Therapeutic effect of siRNA targeting Zyx gene on bleomycin-induced pulmonary fibrosis

[0049] 1. Experimental method

[0050] Experimental materials:

[0051] Bleomycin was purchased from APExBIO (USA, catalog number: A8331).

[0052] Experimental animals:

[0053] C57BL / 6 mice, male, 6 - 8 weeks old, SPF grade, were purchased from Guangdong Provincial Medical Experimental Animal Center.

[0054] Model establishment:

[0055] The mice were randomly divided into three groups: PBS group, bleomycin group (BLM group), and Zyx gene knockdown group (BLM + siZyx group), with the number of mice in each group ≥ 10; the three groups of mice were kept under the same feeding conditions during the model establishment. One day before bleomycin administration, the control RNA (NC-siRNA) and siRNA (SEQ ID NO: 3) were administered by nasal drip to the bleomycin group and Zyx gene knockdown group respectively. The sense strand sequence of NC-siRNA: 5’-CAGCCUGUGUCUUCUGCUATT-3’ (SEQ ID NO: 7), the antisense strand sequence: 5’-TTGUCGGACACAGAAGACGAU-3’ (SEQ ID NO: 8), the dose was 5 μg / kg, and the administration volume was 30 μL / mouse; on day 0, bleomycin was administered to the bleomycin and Zyx gene knockdown groups by intratracheal instillation, 2 mg / kg, 30 μL / mouse; on day 14, the second siRNA nasal drip was performed by intratracheal instillation, and the NC-siRNA and siRNA (SEQ ID NO: 3) were administered by nasal drip to the bleomycin group and Zyx gene knockdown group respectively, with the dose of 5 μg / kg and the administration volume of 30 μL / mouse.

[0056] Data and sample collection:

[0057] Survival rate record: From day 0 to day 21, observe the health status of the mice and record the number of deaths.

[0058] Lung tissue: On day 21, decapitate the mice and remove the lung tissue by conventional means. Observe the lung injury macroscopically; perform paraffin embedding, H&E staining, and MASSON staining on the lung tissue; extract total RNA from the lung tissue for qPCR and transcriptome analysis. The primer sequences used for qPCR are as follows: Zyx-FW: TTTACGCCCCGCAGAAGAAG (SEQ ID NO: 9), Zyx-RV: TGGAGGGGAGGGGAAGATGT (SEQ ID NO: 10); Col1a1-FW: AGAGCGGAGAGTACTGGATCG (SEQ ID NO: 11), COL1a1-RV: TCGAACGGGAATCCATCGGT (SEQ ID NO: 12); Fn1-FW: AACAGAAATTGACAAGCCGTC (SEQ ID NO: 13), Fn1-RV: TCTGTTTGATCTGGACTGGCA (SEQ ID NO: 14); Timp1-FW: GCAAAGAGCTTTCTCAAAGACC (SEQ ID NO: 15), Timp1-RV: AGGGATAGATAAACAGGGAAACACT (SEQID NO: 16).

[0059] 2. Experimental results

[0060] Analysis of the expression level of Zyx gene in the lung tissue of mice in different groups is as Figure 1 shown: Compared with the bleomycin group (BLM group), in the lung tissue of mice in the Zyx knockdown group (BLM + siZyx group), the transcriptional level of the Zyx gene was significantly decreased, proving that the above-mentioned siRNA effectively targeted the Zyx gene and significantly reduced its transcriptional level.

[0061] Statistics of the survival rate of mice in different groups are as Figure 2 shown: In the bleomycin group (BLM group), deaths began to occur in mice from day 6 and continued until day 14. When counted until day 21, the survival rate was approximately 20%; the first death in the Zyx knockdown group (BLM + siZyx group) was delayed to day 7. When counted until day 21, the survival rate was approximately 60%. Compared with the bleomycin group, the survival rate was significantly increased; the above proves that knockdown of the Zyx gene can effectively reduce the mortality caused by the disease.

[0062] The results of H&E staining of lung tissue of mice in different groups are as Figure 3Shown as follows: In the bleomycin group (BLM group), obvious alveolar wall thickening, pulmonary parenchymal thickening, and inflammatory cell infiltration were visible; in the Zyx knockdown group (BLM+siZyx group), alveolar wall thickening, pulmonary parenchymal thickening, and inflammatory cell infiltration were not obvious; the above proves that the knockdown of the Zyx gene effectively reduces the pathological damage caused by bleomycin.

[0063] The MASSON staining of the lung tissues of mice in different groups was as Figure 4 Shown as follows: Obvious collagen fiber deposition was visible in the bleomycin group (BLM group); quantitative data showed that the degree of collagen fiber deposition in the bleomycin group (BLM group) was significantly higher than that in the Zyx knockdown group (BLM+siZyx group); the above proves that the knockdown of the Zyx gene effectively reduces the degree of pulmonary fibrosis.

[0064] Analysis of the transcriptional levels of fibrosis-related genes in the lung tissues of mice in different groups was as Figure 5 Shown as follows: Compared with the bleomycin group (BLM group), the transcriptional levels of fibrosis-related genes in the Zyx knockdown group (BLM+siZyx group) were significantly decreased; the above proves that the knockdown of the Zyx gene effectively reduces the expression of fibrosis-related genes.

Claims

1. A small interfering RNA targeting the Zyx gene, characterized in that: The sense strand sequence of the small interfering RNA is at least one of a1) and a2): a1) As shown in any one of SEQ ID NO:1 to 3; a2) A small interfering RNA with the same function obtained by substituting and / or deleting and / or adding one or several nucleotides to the nucleic acid sequence shown in any one of SEQ ID NO:1 to 3.

2. The small interfering RNA according to claim 1, characterized in that: The small interfering RNA includes pharmaceutically acceptable modifications.

3. The small interfering RNA according to claim 2, characterized in that: The pharmaceutically acceptable modifications include but are not limited to at least one of modification of the phosphate group, modification of the ribose, and modification of the base.

4. Use of a Zyx gene inhibitor in the preparation of a product for treating fibrotic interstitial lung disease; The Zyx gene inhibitor includes the small interfering RNA targeting the Zyx gene according to any one of claims 1 to 3.

5. The use according to claim 4, characterized in that: The fibrotic interstitial lung disease includes but is not limited to: fibrotic interstitial lung disease, non-fibrotic interstitial lung disease, pneumoconiosis, idiopathic pulmonary fibrosis, cystic fibrosis, or idiopathic nonspecific interstitial pneumonia.

6. The use according to claim 4, characterized in that: The product includes a drug.

7. The use according to claim 6, characterized in that: The drug includes pharmaceutically acceptable excipients.

8. The use according to claim 7, characterized in that: The pharmaceutically acceptable excipients include at least one of a solvent, a propellant, a solubilizer, a cosolvent, an emulsifier, a colorant, a binder, a disintegrant, a filler, a lubricant, a wetting agent, an osmotic pressure regulator, a stabilizer, a glidant, a flavoring agent, a preservative, a suspending agent, a coating material, an aromatic agent, an antiadhesive, a chelating agent, a penetration enhancer, a pH regulator, a buffer, a plasticizer, a surfactant, a foaming agent, a defoaming agent, a thickening agent, an inclusion agent, a humectant, an absorbent, a diluent, a flocculant and an anti-flocculant, a filter aid, a release retarder, a carrier.

9. The use according to claim 6, characterized in that: The dosage form of the drug includes at least one of a powder, a tablet, a granule, a sustained-release agent, a solution, a dry suspension, effervescent tablets, an emulsion, a suspension, a drop.

10. A pharmaceutical composition, characterized in that: The pharmaceutical composition includes the small interfering RNA according to any one of claims 1 to 3, pharmaceutically acceptable excipients; and one or more other active ingredients.

Citation Information

Cited By

  • Application of Zyxin protein in preparation of product for treating renal interstitial fibrosis caused by hypertension

    CN120643672A