FAP CAR mRNA and application and product thereof
By introducing FAP CAR mRNA into T cells, the chimeric antigen receptors are solved, and the drug side effects in the treatment of myocardial fibrosis are achieved efficient killing of overactivated fibroblasts and the treatment of myocardial and renal fibrosis is achieved.
Patent Information
- Application Number
- CN202311758223.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-19
- Publication Date
- 2025-07-08
AI Technical Summary
The existing treatment methods for myocardial fibrosis are mostly mainly drug treatment, but the effect is mild and there are toxic side effects for long-term use. It is necessary to find treatment methods that are non-toxic or low-toxic side effects.
By designing FAP CAR mRNA, the chimeric antigen receptor targeted by T cells is introduced to express the fibroblast activation protein, and the recognition and killing ability of T cells to overactivated fibroblasts is improved, and drugs to treat fibrotic diseases are prepared.
It improves the killing ability of T cells to overactivate fibroblasts, effectively treats myocardial fibrosis and renal fibrosis, has good therapeutic effect and no obvious toxicity.
Smart Images

Figure CN120272503A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular, to an FAP CAR mRNA and its applications and products. Background Art
[0002] The incidence of fibrosis in tissues and organs is currently continuously increasing worldwide and is a major determinant of death from various diseases. The pathological characteristics of fibrotic diseases are the destruction of normal tissue structure, excessive proliferation of myofibroblasts, and massive deposition of extracellular matrix (ECM). Moreover, the further development of fibrosis will lead to damage and even failure of organ structure and function, seriously threatening human health and life. Myocardial fibrosis is the dilation of the cardiac interstitium caused by the accumulation of extracellular matrix proteins. Myocardial fibrosis is an important pathological state for almost all chronic cardiovascular diseases to progress to heart failure. Cardiac fibrosis is one of the inevitable pathological changes in various cardiovascular diseases, mainly due to the excessive deposition of extracellular matrix, resulting in impaired cardiac systolic and diastolic functions, and ultimately leading to arrhythmia and heart failure.
[0003] Currently, the treatment of myocardial fibrosis mainly relies on drug therapy. However, clinical trials of anti-fibrotic drugs have only shown relatively mild effects, and the long-term use of some drugs will bring toxic and side effects. Therefore, it is necessary to find a method for treating fibrotic diseases with no or low toxic and side effects.
[0004] Through the research of the inventors, it is found that eliminating activated fibroblasts in a mouse model of heart disease can significantly reduce cardiac fibrosis and improve cardiac function. Fibroblast activation protein (FAP) is overexpressed in disease-related fibroblasts and promotes disease occurrence in various aspects, such as mechanism remodeling, angiogenesis, chemotherapy resistance, and immunosuppression. Since FAP is expressed at a very low level in most normal organs and is not easily mutated to cause drug resistance, it is speculated that FAP may be an important protein target for fibrosis treatment.
[0005] In view of this, the present invention is specifically proposed. Summary of the Invention
[0006] The first object of the present invention is to provide an FAP CAR mRNA to solve at least one of the above problems.
[0007] The second object of the present invention is to provide a nucleic acid molecule of FAP CAR.
[0008] The third object of the present invention is to provide a recombinant vector.
[0009] The fourth object of the present invention is to provide a transgenic cell.
[0010] The fifth object of the present invention is to provide the use of the above-mentioned FAP CAR mRNA in the preparation of a drug for treating fibrotic diseases.
[0011] The sixth object of the present invention is to provide a nucleic acid drug.
[0012] In order to test the above objects, the following technical solutions are proposed.
[0013] In a first aspect, the present invention provides an FAP CAR mRNA, which sequentially includes a 5'UTR, a coding region, a 3'UTR, and a Poly A tail from 5' to 3';
[0014] The nucleic acid sequence of the coding region is as shown in SEQ ID NO.1.
[0015] As a further technical solution, the nucleic acid sequence of the 5'UTR is as shown in SEQ ID NO.2;
[0016] The nucleic acid sequence of the 3'UTR is as shown in SEQ ID NO.3;
[0017] The nucleic acid sequence of the Poly A tail is as shown in SEQ ID NO.4.
[0018] As a further technical solution, it further includes RISR-RIAD;
[0019] The 5' end of the RISR-RIAD is connected to the 3' end of the coding region through a linker peptide, and the 3' end of the RISR-RIAD is connected to the 3'UTR;
[0020] The nucleic acid sequence of the RISR-RIAD is as shown in SEQ ID NO.6.
[0021] As a further technical solution, the linker peptide includes P2A;
[0022] The nucleic acid sequence of the P2A is as shown in SEQ ID NO.5.
[0023] In a second aspect, the present invention provides a nucleic acid molecule of FAP CAR, which transcribes the above-mentioned FAP CAR mRNA.
[0024] In a third aspect, the present invention provides a recombinant vector, which contains the above-mentioned nucleic acid molecule.
[0025] In a fourth aspect, the present invention provides a transgenic cell, which contains the above-mentioned nucleic acid molecule, or contains the above-mentioned recombinant vector.
[0026] As a further technical solution, the transgenic cell includes T cells.
[0027] In a fifth aspect, the present invention provides the use of the above-mentioned FAP CAR mRNA in the preparation of a medicament for treating fibrotic diseases.
[0028] In a sixth aspect, the present invention provides a nucleic acid medicament, which comprises the above-mentioned FAP CAR mRNA.
[0029] Compared with the prior art, the present invention has the following beneficial effects:
[0030] The FAP CAR mRNA provided by the present invention can express a chimeric antigen receptor specific to fibroblast activation protein (FAP). Introducing the FAP CAR mRNA into T cells can improve the recognition and killing ability of T cells against over-activated fibroblasts, and treat fibrotic diseases by killing over-activated fibroblasts, and can be used in the preparation of medicaments for treating fibrotic diseases. Description of the Drawings
[0031] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for use in the description of the specific embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.
[0032] Figure 1 It is the detection result of the hydrodynamic diameter of CD5 / LNP-FAP CAR nanoparticles;
[0033] Figure 2 It is the detection result of the polydispersity index of CD5 / LNP-FAP CAR nanoparticles;
[0034] Figure 3 It is the detection result of the Zeta potential of CD5 / LNP-FAP CAR nanoparticles;
[0035] Figure 4 It is the electron microscopy result of CD5 / LNP-FAP CAR nanoparticles on a copper grid;
[0036] Figure 5 It is the standard curve of mRNA encapsulation efficiency;
[0037] Figure 6 It is the result of the cell safety experiment;
[0038] Figure 7 It is the in vitro transfection result of T cells in Test Example 2;
[0039] Figure 8For the in vitro killing results of T cells in Test Example 2;
[0040] Figure 9 For the results of myocardial injury tissue sections;
[0041] Figure 10 For the results of renal interstitial fibrosis tissue sections;
[0042] Figure 11 For the in vitro transfection results of T cells in Test Example 1;
[0043] Figure 12 For the in vitro killing results of T cells in Test Example 1. Specific implementation manner
[0044] Next, the embodiments of the present invention will be described in detail in conjunction with the implementation manners and examples. However, those skilled in the art will understand that the following implementation manners and examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention. Based on the examples in the present invention, all other examples obtained by those of ordinary skill in the art without creative efforts shall fall within the scope of protection of the present invention. Those not specified in specific conditions are carried out according to conventional conditions or conditions recommended by the manufacturer. Those reagents or instruments not specified in the manufacturer are all conventional products that can be obtained through commercial purchase.
[0045] In the first aspect, the present invention provides an FAP CAR mRNA, which sequentially includes a 5'UTR, a coding region, a 3'UTR, and a Poly A tail from 5' to 3';
[0046] The nucleic acid sequence of the coding region is as shown in SEQ ID NO.1:
[0047]
[0048] The mRNA provided by the present invention is codon-optimized and can be expressed in mammalian cells, and comprises an expression fragment of a chimeric antigen receptor targeting specific FAP, 41BB, and CD3ζ cytoplasmic signaling domain.
[0049] In some preferred embodiments, the nucleic acid sequence of the 5’UTR is as shown in SEQ ID NO.2:
[0050] GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCC (SEQ ID NO.2).
[0051] The nucleic acid sequence of the 3’μUR is as shown in SEQ ID NO.3:
[0052] GCUGGAGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGCA (SEQ ID NO.3).
[0053] The nucleic acid sequence of the PoLy A tail is as shown in SEQ ID NO.4:
[0054] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCAUAUGACUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO.4).
[0055] In some preferred embodiments, it further comprises RISR-RIAD;
[0056] The 5’ end of the RISR-RIAD is connected to the 3’ end of the coding region through a linker peptide, and the 3’ end of the RISR-RIAD is connected to the 3’UTR;
[0057] The nucleic acid sequence of the RISR-RIAD is as shown in SEQ ID NO.6:
[0058] GAGAGCAAGAGACGGCAGGAAGAGGCCGAGCAGAGAAAGCUGGAGCAGUACGCCAACCAGCUGGCCGACCAGAUCAUCAAGGAAGCUACCGAG (SEQ ID NO.6).
[0059] The inventors have found through research that FAP CAR mRNA containing the RISR-RIAD sequence has stronger killing ability against over-activated fibroblasts.
[0060] In some preferred embodiments, the linker peptide includes P2A;
[0061] The nucleic acid sequence of the P2A is as shown in SEQ ID NO.5:
[0062] GGAAGCGGAGCCACGAACUUCUCUCUGUUAAAGCAAGCAGGAGAUGUUGAAGAAAACCCCGGGCCU(SEQ ID NO.5).
[0063] In a second aspect, the present invention provides a nucleic acid molecule of FAP CAR, and the nucleic acid transcribes the above-mentioned FAP CAR mRNA.
[0064] In a third aspect, the present invention provides a recombinant vector, and the recombinant vector contains the above-mentioned nucleic acid molecule.
[0065] In a fourth aspect, the present invention provides a transgenic cell, and the transgenic cell contains the above-mentioned nucleic acid molecule, or contains the above-mentioned recombinant vector.
[0066] In the present invention, the transcription sequence of the nucleic acid can be cloned into a plasmid by genetic engineering techniques for in vitro transcription and used for mRNA synthesis; for example: 1) cloning the DNA fragment corresponding to the mRNA into an expression plasmid to obtain a recombinant plasmid; 2) transferring the recombinant plasmid into a host cell to obtain a recombinant cell, extracting the plasmid from the propagated recombinant cell, and performing PCR amplification to obtain a DNA template for in vitro expression of mRNA; 3) constructing an RNA in vitro synthesis system including the DNA template for in vitro synthesis of mRNA to obtain the active ingredient mRNA.
[0067] In some alternative embodiments, the transgenic cell includes a T cell. This CAR-T cell can express the above-mentioned mRNA, has a chimeric antigen receptor specific to fibroblast activation protein, and can specifically recognize fibroblast activation protein, thereby achieving the treatment of fibrotic diseases.
[0068] In a fifth aspect, the present invention provides the application of the above-mentioned FAP CAR mRNA in the preparation of a drug for treating fibrotic diseases.
[0069] The FAP CAR mRNA provided by the present invention can be expressed to form a chimeric antigen receptor specific to fibroblast activation protein (FAP). Introducing this FAP CAR mRNA into T cells can enhance the recognition and killing ability of T cells against over-activated fibroblasts, and thus be used for the treatment of fibrotic diseases.
[0070] In some alternative embodiments, the fibrotic disease includes myocardial fibrosis or renal fibrosis.
[0071] In a sixth aspect, the present invention provides a nucleic acid drug, which includes the aforementioned FAP CAR mRNA.
[0072] In some alternative embodiments, the nucleic acid drug further includes a delivery vector for targeted delivery of FAP CAR mRNA.
[0073] By targeting the delivery of FAP CAR mRNA to T cells, the recognition and killing ability of T cells against over-activated fibroblasts is enhanced, thereby achieving the treatment of fibrotic diseases.
[0074] The present invention will be further illustrated by specific examples and comparative examples below. However, it should be understood that these examples are only for more detailed illustration and should not be construed as limiting the present invention in any way.
[0075] In the following examples, the FAP CAR mRNA includes 5' UTR, coding region, 3' UTR, and Poly A tail in sequence from 5' to 3'. The nucleic acid sequence of the coding region is: SEQ ID NO.1 + P2A (SEQ ID NO.5) + RISR-RIAD (SEQ ID NO.6); the nucleic acid sequence of the 5' UTR is as shown in SEQ ID NO.2; the nucleic acid sequence of the 3' UTR is as shown in SEQ ID NO.3; the nucleic acid sequence of the Poly A tail is as shown in SEQ ID NO.4.
[0076] Unless otherwise specified, "mRNA" hereinafter refers to FAP CAR mRNA.
[0077] Example 1
[0078] FAP CAR mRNA (FAP CAR (without-RISR-RIAD)) was obtained by artificial synthesis.
[0079] Comparative Example 1
[0080] FAP CAR mRNA (FAP CAR (with-RISR-RIAD)), which is different from Example 1 in that it does not contain the P2A + RISR-RIAD sequence.
[0081] Experimental Example 1
[0082] Mouse T cells were extracted and transfected with the mRNAs of Example 1 and Comparative Example 1, respectively. After the transfection was completed, the cells were digested with 0.25% trypsin without EDTA, collected after terminating the digestion, centrifuged at 1500 rpm for 5 min, the supernatant was discarded, and the cells were collected; the cells were resuspended with pre-cooled PBS twice and centrifuged at 1500 rpm for 5 min to wash the cells; after adding 5 μL of His-Tag-FAP and mixing well, it was incubated in the dark at room temperature for 15 min; after adding 10 μL of PE-Anti-His and mixing well, it was incubated in the dark at room temperature for 15 min, and detected by flow cytometry. The results were as Figure 11 (Control in the figure is untransfected T cells) shown. The results showed that the mRNA was successfully transfected into T cells, and the transfection efficiencies of Example 1 and Example 2 were similar.
[0083] After mixing the T cells transfected with the mRNAs of Example 1 and Comparative Example 1 above with the target HEK 293T cells stably expressing FAP protein and GFP protein (green fluorescent protein) for 24 hours, the culture medium was removed, the cells were recollected, and the green fluorescent protein signal was detected using a microplate reader with an excitation wavelength of 488 nm and an emission wavelength of 507 nm. The killing effect of T cells on FAP-HEK 293T cells was calculated. The results were as Figure 12 (Control in the figure is untransfected T cells) shown. It can be seen from the figure that the killing ability of T cells transfected with the mRNAs of Example 1 and Comparative Example 1 was significantly improved, and the killing ability of Example 1 was stronger.
[0084] Preparation of Example 2 CD5 / LNP-FAP CAR nanoparticles
[0085] Ionizable lipid SM-102 (1.93 mg), DMG-PEG-maL (0.21 mg), DSPC (0.43 mg), and cholesterol (0.81 mg) were dissolved in 1 mL of absolute ethanol and stirred until a clear solution A was formed; FAP CAR mRNA was dissolved in a Tris buffer solution with pH = 4.0 and 25 mM to form solution B; solution A was added to a 10 mL centrifuge tube, vortexed rapidly, and solution B was added while vortexing. After vortexing for 15 minutes, LNP-FAP CAR was obtained.
[0086] The LNP-FAP CAR is conjugated and modified with a CD5 antibody through a maleimide functional group (DMG-PEG-maL). The CD5 antibody was functionalized with SATA (n-succinimidyl S-acetylthioacetate) (MiLLipore Sigma) to introduce a thiol group that can be conjugated to maleimide. 0.5 M hydroxylamine was used to deprotect SATA, and then an unreacted component was removed using a G-25 Sephadex rapid spin protein column (Roche AppLied Science, IndianapoLis, IN). Then, the reactive thiol group on the antibody was conjugated to the maleimide group using thioether coupling chemistry. Purification was performed using a Sepharose CL-4B gel filtration column (MiLLiporeSigma). After adding the targeting ligand, all LNP-targeted (LNPs modified with CD5 antibody) and non-targeted (not modified with CD5 antibody) preparations were stored at 4 °C and used within 3 days after preparation.
[0087] Comparative Example 2
[0088] The CD5 / LNP-FAP CAR nanoparticles are different from those in Example 2 in that the mass ratio of the ionizable lipid, DSPC, cholesterol, and DMG-PEG-maL is 1:0.1:0.1:10.
[0089] Comparative Example 3
[0090] The CD5 / LNP-FAP CAR nanoparticles are different from those in Example 2 in that the mass ratio of the ionizable lipid, DSPC, cholesterol, and DMG-PEG-maL is 10:0.1:10:0.1.
[0091] Test Example 2 Characterization of the Physicochemical Properties of CD5 / LNP-FAP CAR Nanoparticles
[0092] 1. The liposomal nanoparticles loaded with FAP CAR mRNA in Example 2 were characterized by dynamic light scattering using a Zetasizer Nano ZS (MaLvern Instrμments, MaLvern μK) to detect the hydrodynamic diameter, polydispersity index (PDI), and Zeta potential of the nanoparticles.
[0093] The experimental procedure was as follows: The nanoparticles were suspended in PBS buffer, added to the sample cell, the sample cell was placed on the sample stage of the Zetasizer instrument, and it was ensured that the sample completely covered the measurement optical path. The measurement requirements, hydrodynamic diameter, PDI, and Zeta potential, were selected, and the instrument automatically measured and saved the data for subsequent analysis. The results are as Figure 1 、 Figure 2 and Figure 3 ( Figures 1 - 3Among them, LNP refers to nanoparticles that are neither encapsulating RNA nor conjugated (as shown). The results show that the CD5 / LNP-FAP CAR nanoparticles provided by the present invention have good stability.
[0094] 2. Take a small amount of nanoparticles, disperse them, drop them on a copper grid. After drying, add uranyl acetate staining solution and stain for 3 - 5 min. Then, use filter paper to absorb the excess staining solution. After air-drying, place it under a transmission electron microscope for observation and take pictures. The results are as Figure 4 shown.
[0095] 3. Use the Qμant-iT TM RiboGreen RNA Assay Kit to detect the content of mRNA and calculate the encapsulation efficiency. Take 6 μL of the RNA standard sample provided in the kit, add 294 μL of TE buffer to prepare a 2 μg / mL RNA stock solution. Dilute it to 0 / 10 / 25 / 50 / 100 / 250 / 500 / 750 / 1000 ng / mL using TE buffer, and add 100 μL of each volume to a 96-well plate. Take 1 μL of Ribogreen dye for each well, dilute it to 100 μL using TE buffer, add it to the above samples, and incubate for 5 min at room temperature. Use a microplate reader, set the excitation wavelength to 485 nm and the emission wavelength to 528 nm for detection, record the data, and plot the standard curve of fluorescence signal intensity vs mRNA concentration and the linear regression equation. As Figure 5 shown, the standard curve is F = 33534.38C - 1350000, R 2 = 0.99564.
[0096] Detect the encapsulation efficiency of the CD5 / LNP-FAP CAR nanoparticles provided in Example 2 and Comparative Examples 2 - 3 respectively. The experimental steps are as follows:
[0097] Take 50 μL of CD5 / LNP-FAP CAR nanoparticles and mix them with 50 μL of TE buffer, add them to a 96-well plate. Take 1 μL of Ribogreen dye for each well, dilute it to 100 μL using TE buffer, add it to the above samples, and incubate for 5 min at room temperature. Use a microplate reader to detect the concentration of free RNA (C 游离 ).
[0098] Take 50 μL of CD5 / LNP-FAP CAR nanoparticles and mix them with 50 μL of TE-Triton100 (1x TE buffer: Triton = 49:1), add them to a 96-well plate. Take 1 μL of Ribogreen dye for each well, dilute it to 100 μL using TE buffer, add it to the above samples, and incubate for 5 min at room temperature. Use a microplate reader to detect the total RNA concentration (C 总 ).
[0099] Concentration of encapsulated RNA (C包封 ) = C 总 - C 游离 。
[0100] Encapsulation efficiency (%) = C 包封 / C 包封 * 100%.
[0101] The results are shown in Table 1.
[0102] Table 1
[0103]
[0104] It can be seen from the results in Table 1 that the CD5 / LNP-FAP CAR nanoparticles provided by the present invention have a high encapsulation efficiency.
[0105] 4. Cell experiments
[0106] Grouping of cell experiments:
[0107] Extraction of mouse T cells: Mouse T cells were isolated from wild-type male mice aged 10 - 14 weeks, activated with CD3 / CD28 Dynabeads (Gibco 11453D), and amplified with 100 units / mL recombinant mouse interleukin-2 (R&D Systems 402-ML). The T cells were cultured in RPMI 1640 (Invitrogen 11875085) containing 10% fetal bovine serum (AtLanta BioLogicaLs S11150), 4 mM glutamine (Invitrogen 25030081), penicillin / streptomycin (Invitrogen 15140122), 1 mM sodium pyruvate (Invitrogen 11360079), and 50 μM 2-mercaptoethanol (Gibco 21985023).
[0108] Drug safety detection:
[0109] Digest and collect mouse T cells, centrifuge at 1000 rpm for 5 min, discard the supernatant, and resuspend the cells in fresh complete medium. Inoculate the cell suspension (100 μL / well) in a 96-well plate. Set up a blank control group, LNP (differing from Example 2 in that it was not CD5-modified and did not carry mRNA), mRNA, CD5, CD5 / LNP-FAPCAR (Example 2), unify the dose with an mRNA concentration of 5 μg / mL, and co-incubate with T cells for 24, 48, and 72 hours. Then add 10 μL of CCK-8 reaction solution to each well and incubate for 2 h, and measure the absorbance at 450 nm with an enzyme-linked immunosorbent assay reader. Normalize the data with the blank control group and draw an image, as Figure 6As shown. The results show that the nanoparticles are not significantly toxic.
[0110] The T cells were grouped and treated as follows:
[0111] (1) Mouse T cells (blank control T cells);
[0112] (2) Mouse T cells + LNP-FAPCAR (compared with Example 2, the T cells were not treated with lipid nanoparticles modified with CD5 antibody, and FAP CAR mRNA was normally carried);
[0113] (3) Mouse T cells + CD5 / LNP (compared with Example 2, the T cells were treated with lipid nanoparticles without carrying mRNA, and CD5 antibody was normally modified);
[0114] (4) Mouse T cells + CD5 / LNP-FAPCAR (Example 2).
[0115] The mouse T cells were treated according to the above groups. After in vitro incubation for 48 hours, the cells were digested with 0.25% trypsin without EDTA, collected after terminating the digestion, centrifuged at 1500 rpm for 5 min, the supernatant was discarded, and the cells were collected; the cells were resuspended twice with pre-cooled PBS and centrifuged at 1500 rpm for 5 min to wash the cells; 5 μL of His-Tag-FAP was added and mixed well, incubated in the dark at room temperature for 15 min; 10 μL of PE-Anti-His was added and mixed well, incubated in the dark at room temperature for 15 min, and detected by flow cytometry. The results are as Figure 7 shown. The results indicate that the CD5 / LNP-FAP CAR nanoparticles provided in Example 2 of the present invention can achieve targeted delivery of mRNA to T cells and have a high transfection efficiency.
[0116] The T cells expressing FAPCAR obtained in the (4) group were mixed with target HEK 293T cells stably expressing FAP protein and GFP protein (green fluorescent protein) for 24 hours, then the culture medium was removed, the cells were collected again, and the green fluorescent protein signal was detected using an enzyme-linked immunosorbent assay reader with an excitation wavelength of 488 nm and an emission wavelength of 507 nm. The killing effect of FAPCAR T cells on FAP-HEK 293T cells was calculated. The results are as Figure 8 shown. The results show that compared with untransfected T cells, the transfected FAPCAR T cells have a stronger killing effect on FAP-HEK 293T cells.
[0117] 5. Animal experiment:
[0118] Cardiac fibrosis model: C57BL6 / J mice aged 8 - 12 weeks were used. Angiotensin II (Ang II) was intraperitoneally injected. A cardiac fibrosis model was constructed by administering 0.3 - 1 μg of Ang II per kilogram of body weight to each mouse. The animals were under anesthesia during the injection process.
[0119] Therapeutic treatment: Two days after modeling, 100 μL of CD5 / LNP - FAPCAR dispersion was injected via the tail vein. The mice were sacrificed 7 days later, and the heart tissues were taken for HE staining and MASSON staining for observation. The results are as Figure 9 shown. The results indicate that the CD5 / LNP - FAPCAR provided by the present invention has a good therapeutic effect on cardiac fibrosis.
[0120] Renal fibrosis model: Sprague - Dawley (SD) rats aged 8 - 12 weeks were used. After anesthesia, the rats were fixed in the supine position. The abdomen was opened, and the ureter was dissected free using a glass probe. Permanent ligations were made at the opening of the renal pelvis and at the upper 1 / 3 position of the ureter respectively. Then, the ureter was cut between the two ligation points and then sutured.
[0121] Therapeutic treatment: Fourteen days after modeling, 1 ml of CD5 / LNP - FAPCAR (Example 2) dispersion was injected via the tail vein. The mice were sacrificed 7 days later, and the kidney tissues were taken for HE staining and MASSON staining for observation. The results are as Figure 10 shown. The results indicate that the CD5 / LNP - FAPCAR provided by the present invention has a good therapeutic effect on renal fibrosis.
[0122] The steps of HE staining are as follows:
[0123] 1. The sections were successively placed in xylene I for 10 min, xylene II for 10 min, absolute ethanol I for 5 min, absolute ethanol II for 5 min, 95% alcohol for 5 min, 90% alcohol for 5 min, 80% alcohol for 5 min, 70% alcohol for 5 min, and then rinsed with distilled water.
[0124] 2. The sections were stained with Harris hematoxylin for 3 - 8 min, rinsed with tap water, differentiated with 1% hydrochloric acid alcohol for a few seconds, rinsed with tap water, blued with 0.6% ammonia water, and rinsed with running water.
[0125] 3. The sections were stained with eosin staining solution for 1 - 3 min.
[0126] 4. The sections were successively placed in 95% alcohol I for 5 min, 95% alcohol II for 5 min, absolute ethanol I for 5 min, absolute ethanol II for 5 min, xylene I for 5 min, xylene II for 5 min for dehydration and clearing. The sections were taken out from xylene, slightly air - dried, and mounted with neutral gum.
[0127] 5. Microscopic examination and image acquisition and analysis.
[0128] The steps of MASSON staining are as follows:
[0129] 1. Sequentially place the sections into xylene Ⅰ for 20 min, xylene Ⅱ for 20 min, absolute ethanol Ⅰ for 10 min, absolute ethanol Ⅱ for 10 min, 95% ethanol for 5 min, 90% ethanol for 5 min, 80% ethanol for 5 min, 70% ethanol for 5 min, and wash with distilled water.
[0130] 2. Take Weigert's iron hematoxylin in the masson staining kit, stain for 5 min, wash with tap water, differentiate with 1% hydrochloric acid alcohol for several seconds, then rinse with tap water, and rinse with running water for several minutes to blue back.
[0131] 3. Take ponceau acid fuchsin solution in the masson staining kit, stain for 5 - 10 min, and quickly rinse with distilled water.
[0132] 4. Treat with phosphomolybdic acid aqueous solution in the masson staining kit for about 3 - 5 min.
[0133] 5. Counterstain with aniline blue solution in the masson staining kit for 5 min.
[0134] 6. Treat with 1% glacial acetic acid for 1 min.
[0135] 7. Sequentially place the sections into 95% ethanol I for 5 min, 95% ethanol II for 5 min, absolute ethanol Ⅰ for 5 min, absolute ethanol Ⅱ for 5 min, xylene Ⅰ for 5 min, xylene Ⅱ for 5 min, dehydrate and make transparent. Take out the sections from xylene, air dry slightly, and seal with neutral gum.
[0136] 8. Microscopic examination and image acquisition and analysis.
[0137] Finally, it should be noted that: the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A FAP CAR mRNA, characterized in that, The FAP CAR mRNA sequentially includes a 5' UTR, a coding region, a 3' UTR, and a Poly A tail from 5' to 3'; The nucleic acid sequence of the coding region is as shown in SEQ ID NO.
1.
2. The FAP CAR mRNA according to claim 1, wherein The nucleic acid sequence of the 5' UTR is as shown in SEQ ID NO.2; The nucleic acid sequence of the 3' UTR is as shown in SEQ ID NO.3; The nucleic acid sequence of the Poly A tail is as shown in SEQ ID NO.
4.
3. The FAP CAR mRNA according to claim 1, wherein It further includes RISR-RIAD; The 5' end of the RISR-RIAD is connected to the 3' end of the coding region through a linker peptide, and the 3' end of the RISR-RIAD is connected to the 3' UTR; The nucleic acid sequence of the RISR-RIAD is as shown in SEQ ID NO.
6.
4. The FAP CAR mRNA according to claim 3, wherein The linker peptide includes P2A; The nucleic acid sequence of the P2A is as shown in SEQ ID NO.
5.
5. A nucleic acid molecule of FAP CAR, characterized in that, Transcribing the nucleic acid of the FAP CAR mRNA according to any one of claims 1-4.
6. A recombinant vector, characterized in that, The recombinant vector contains the nucleic acid molecule according to claim 5.
7. A transgenic cell, characterized in that, The transgenic cell contains the nucleic acid molecule according to claim 5, or contains the recombinant vector according to claim 6.
8. The transgenic cell according to claim 7, wherein The transgenic cell includes a T cell.
9. Use of the FAP CAR mRNA according to any one of claims 1-4 in the preparation of a medicament for treating fibrotic diseases.
10. A nucleic acid drug, characterized in that, The medicament includes the FAP CAR mRNA according to any one of claims 1-4.