A method for establishing and applying a TRV virus-induced canna endogenous gene silencing expression system

Abstract

The present invention belongs to the field of plant biotechnology, and specifically relates to a method for establishing and applying a TRV virus-induced canna endogenous gene silencing expression system. The method comprises: CiPDS Specific fragment construction and recombination pTRV2‑PDS This invention utilizes an Agrobacterium-mediated viral infection system, uses Nicotiana benthamiana as a transitional host, and prepares viral sap. This method effectively infects canna with the TRV virus through friction inoculation. This invention establishes a VIGS technology system in canna for the first time, overcoming the limitations of traditional heterologous transformation techniques and addressing the lag in canna floral organ development research caused by the lack of efficient gene function verification tools. Furthermore, by optimizing temperature and inoculum material selection, silencing stability and phenotypic observability are significantly improved.

Description

Technical Field

[0001] The invention belongs to the field of plant biotechnology, and particularly relates to a method for establishing a TRV virus-induced canna endogenous gene silencing expression system and its application. Background Art

[0002] Virus-induced gene silencing (VIGS) is an RNA silencing technology based on plant antiviral defense mechanisms. Its core principle is that a recombinant virus carrying an endogenous plant gene fragment infects the host. The double-stranded RNA (dsRNA) formed during viral replication is cleaved by the plant enzyme Dicer into 21-25 bp small interfering RNAs (siRNAs). These siRNAs are then amplified by the RNA-dependent RNA polymerase (RdRp) to form secondary siRNAs. These siRNAs bind to the RNA-induced silencing complex (RISC) and degrade the target mRNA in a sequence-specific manner, thereby achieving gene silencing. Compared to traditional transgenic techniques, VIGS offers significant advantages: it does not require the generation of stable transgenic plants, can silence gene family members, requires minimal target sequence information, and supports simultaneous silencing of multiple genes, making it particularly suitable for studying the function of lethal genes. VIGS has become an important tool for functional genomics research in non-model plants.

[0003] Tobacco Rattle Virus (TRV) is a vector widely used in virus-induced gene silencing (VIGS) technology. TRV belongs to the genus Tobravirus, and its genome consists of two single-stranded RNAs (RNA1 and RNA2), of which RNA2 can be modified to insert target gene fragments, thereby silencing specific genes. TRV vectors can infect a variety of monocotyledonous and dicotyledonous plants, and have the advantages of a wide host range, high silencing efficiency, and simple operation. TRV vectors have been successfully used in the study of gene function in many plants. For example, in tomato ( Solanum lycopersicum ) for studying the functions of genes related to fruit development and disease resistance; in cotton ( Gossypium hirsutum ) to study the functions of genes related to fiber development and stress resistance; in petunia ( Gossypium hirsutum ) to study the functions of genes related to flower color and flower type. However, despite the remarkable success of TRV vectors in various plant species, their application in canna has not yet been reported.

[0004] Canna ( Canna indica) is a perennial bulbous flower of the Canna family, known for its diverse inflorescence morphology and vibrant colors, earning it the nickname "Queen of the Flowerbed." Its unique spathe-like calyx, petalized stamens, and asymmetrical flower pattern reveal significant developmental differences from the model plant Arabidopsis thaliana. Current research is largely limited to homologous gene cloning and expression profiling, with functional validation primarily relying on heterologous transformation (e.g., Arabidopsis thaliana or tobacco). However, heterologous systems struggle to accurately reflect the unique regulatory networks underlying canna development. Due to the low efficiency (<5%) and long cycles (>12 months) of traditional genetic transformation, there is an urgent need to develop efficient VIGS techniques applicable to canna itself to uncover the molecular mechanisms underlying floral organ development. Summary of the Invention

[0005] The purpose of the present invention is to address the existing problems and provide a method for establishing a TRV virus-induced canna endogenous gene silencing expression system and its application.

[0006] The present invention is achieved through the following technical solutions:

[0007] A method for establishing a TRV virus-induced canna endogenous gene silencing expression system comprises the following steps:

[0008] (1) Extraction of target genes from canna CiPDS Primers were designed to amplify the 400-600 bp CDS segment of the specific fragment, and restriction enzyme sites and homologous recombination sequences were introduced at the 5' end of the primers;

[0009] (2) The gene fragment obtained in step (1) is connected to the linearized pTRV2 Vector, construction of recombinant viral vector pTRV2-CiPDS ;

[0010] (3) Transform the recombinant viral vector into Agrobacterium GV3101 and combine with the auxiliary vector TRV1 Mix the Agrobacterium in equal proportions and inject it into Nicotiana benthamiana leaves. Collect the virus juice after 6 to 12 days of culture.

[0011] (4) Inoculate the virus sap onto canna leaves by friction and incubate at 18°C ​​to induce target gene silencing;

[0012] (5) Verify gene silencing efficiency through phenotypic observation and qRT-PCR.

[0013] Furthermore, the CiPDS The coding region sequence of the gene is 804 bp, encoding a total of 268 amino acids (aa);

[0014] described CiPDS The full-length nucleotide sequence of the gene coding region is shown in SEQ ID NO.1.

[0015] SEQ ID NO.1:

[0016] ATGGATATCATCGGGGCCATTTCCCCTGTGAAGATAAATGGAACCAACCAGAGAAGATACTGGTGGGAAAATCCCGGTCAAAGATGTTCCTTTCCGAAAGATTCTGTTAGCAGCAACCTCCAAACATTCCGGAACAGTGAGTGTATGGGTTGCAAAATGAAGGTTCCAATCACATCGTTCACATACATGAAGCCAAAATAT AGAAACAAAACTCTTCAGGTTGTCTGCAAAGATTTTCCAAGGCCGGAACTTGAAAACACTATTAATTTTTTAGAAGCTGCACAGTTGTCTTCATCCTTCCGAAATGGTCCTCATCCAAATATACCACTGAAGGTTGTAATAGCTGGTGCAGGTTTGGCTGGCCTATCTACAGCAAAATATCTAGCAGACGCAGGTCATAAA CCTATACTGTTGGAGGCAAGGGATGTTCTGGGTGGAAAGATTGCTGCTTGGAAGGACAATGATGGAGACTGGTATGAGACAGGGCTCCATATATTCTTTGGAGCATCCCAACATGCAGAACTTGTTTGGGGAACTTGGTATCAATGATCGTTTGCAGTGGAAAGAGCACTCAATGATATTTGCAATGCCAAACAAGCCA GGAGAGTTTAGCAGATTTGACTTTCCAGAGATTCTTCCGGCACCTCTGAATGGAATATTCGCAATTTTGAGAAATAATGAAATGCCTGACTTGGCCAGAGAAAGTACGTTTTGCAATTGGACTTCTGCCAGCCATGCTAGGGGGGCAAGCATATGTTGAGGCTCAGGATGGTTTGACTGTTAAAGAGTGGATGAGAAGGCAG

[0017] Furthermore, 1% (w / v) diatomaceous earth was added as an abrasive before inoculation of the virus juice.

[0018] A method for establishing a TRV virus-induced canna endogenous gene silencing expression system is used in canna gene function research or variety improvement.

[0019] Phytoene dehydrogenase ( Phytoene Desaturase , PDS ) is a key enzyme in the carotenoid biosynthesis pathway. Its silencing can lead to leaf photobleaching, with an intuitive and non-lethal phenotype. It is widely used as a reporter gene in the VIGS system. PDS Quantitative analysis of silencing efficiency (such as the proportion of albino area and chlorophyll content) can systematically optimize inoculation methods, viral vector construction strategies, and environmental parameters. PDS It was introduced into the Canna VIGS system as an internal reference reporter gene to provide technical support for the establishment of a standardized silencing evaluation system.

[0020] Compared with the prior art, the present invention has the following advantages:

[0021] 1. This invention addresses the existing challenges of a lack of methods for studying gene function in difficult-to-transform plants, such as canna, and low genetic transformation efficiency. By providing a highly efficient method for studying gene function based on virus-induced gene silencing (VIGS), this method constructs a recombinant TRV viral vector carrying the target gene fragment and optimizes the viral inoculation system using Nicotiana benthamiana as a transitional host, achieving efficient silencing of endogenous genes in canna. This method further significantly improves silencing efficiency by selecting appropriate inoculum materials (rhizome seedlings) and incubation temperature (18°C), addressing technical bottlenecks such as unstable silencing effects and unclear phenotypes in canna, often associated with traditional methods. This method provides reliable technical support for gene function analysis and molecular breeding in canna, while also offering new insights for genetic research in other difficult-to-transform plants.

[0022] The present invention is constructed by carrying CiPDS Recombinant viral vectors containing gene-specific fragments pTRV2-CiPDS , and optimized the virus juice friction inoculation method using Nicotiana benthamiana as the transitional host, achieving CiPDS The experimental results show that this method can significantly reduce CiPDSThe gene expression level decreased by 59.58% (transcription level decreased by 59.58%) and induced a distinct albinism phenotype (e.g., dotted, striped, or patchy) in newly grown canna leaves, effectively verifying the gene silencing efficacy. Furthermore, by optimizing inoculation conditions (e.g., using rhizome seedlings as experimental material and culturing at 18°C), the silencing efficiency was further increased to 90%, significantly outperforming the traditional seedling inoculation method (which only achieved an efficiency of 50% at 25°C). This invention establishes a virus-induced gene silencing (VIGS) technology system in canna for the first time, overcoming the limitations of traditional heterologous transformation techniques and addressing the lag in canna floral organ development research caused by the lack of efficient tools for gene function verification. Furthermore, by optimizing temperature and inoculum material selection, the stability of silencing and phenotypic observability were significantly improved, providing an innovative technical platform for gene function analysis and molecular breeding in canna and other non-model ornamental plants. The present invention is simple to operate and highly stable, providing a reliable technical means for studying gene function in canna and an important reference for optimizing virus-induced gene silencing (VIGS) systems in other difficult-to-transform plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic diagram of the TRV vector structure;

[0024] Figure 2 This is the flowchart of TRV virus gene silencing mediated by Nicotiana benthamiana;

[0025] Figure 3 To detect the leaf albino phenotype caused by CiPDS gene silencing and the gene silencing effect;

[0026] Figure 4 To investigate the effects of culture temperature and seedling age on canna VIGS experiments. DETAILED DESCRIPTION

[0027] In order to further explain the present invention, it is described below with reference to the following specific embodiments.

[0028] Example 1

[0029] Construction of pTRV2 vector and CiPDS Gene silencing

[0030] 1. CiPDS Gene-specific fragment cloning

[0031] Extraction of total RNA from canna leaves

[0032] Take fresh canna leaves (approximately 0.1 g) and quickly grind them into powder in liquid nitrogen. Refer to the instructions for the RNAprep Pure Plant Total RNA Isolation Kit (Tiangen) for detailed extraction procedures. All pipette tips and centrifuge tubes used in the experiment are RNase-free. Mortars and other related glassware should be baked at 180°C for 4 hours. Plastic containers should be sterilized by autoclaving for 30 minutes and then dried before use.

[0033] Reverse transcription synthesis of first-strand cDNA

[0034] Using the full-strength gold reverse transcription kit ( TransScript First-strand cDNA was synthesized using One-Step gDNA Removal and cDNA Synthesis SuperMix.

[0035] 1) Add the following reagents to an RNase-free centrifuge tube: 10 μL of reverse transcription premix (2× TS Reaction Mix), primers; 0.5 μg / μL (Anchored Oligo(dT) 18 Primer) 1 μL, total RNA 50 ng–5 μg, gDNA Remover 1 μL, reverse transcriptase ( TransScript Add 1 μL of RT Enzyme Mix and RNase-free water to 20 μL.

[0036] 2) Mix gently, centrifuge briefly, and incubate at 42°C for 30 min.

[0037] 3) Terminate the reaction by heating at 85°C for 5 s.

[0038] (3) CiPDS Gene cloning

[0039] Primer Design: The target region for VIGS silencing experiments is generally between 400-600 bp and located within the CDS region of the gene. Specific fragments should be used to avoid sequences that are identical to other genes for more than 21 consecutive bp. Forward and reverse primers should be designed based on the selected specific region. In addition to meeting standard requirements for GC content, length, and annealing temperature, primer design should include a restriction enzyme site and homologous recombination sequence (underlined) at the 5' end of the primer.

[0040] TRV-PDS-Xbal-F: AGGTTACCGAATTCT ATGGATATCATCGGGGCCAT

[0041] TRV-PDS-Xbal-R: CCCCATGGAGGCCTTAAAATCTTTGCAGACAACCT

[0042] Using leaf cDNA as a template, Takara PrimeSTAR Max DNA Polymerase (R045A) was used to amplify the CDS-specific sequence of the target gene.

[0043] The PCR reaction system was as follows: 2 μL cDNA, 2 μL forward primer, 2 μL rear primer, 25 μL premix (2× PrimeSTARMax Premix), 19 μL ultrapure water, and a total volume of 50 μL.

[0044] The reaction conditions are shown in Table 1 below:

[0045] Table 1

[0046]

[0047] (4) PCR product purification:

[0048] A small amount of PCR product was analyzed by agarose gel electrophoresis. If a single specific band was detected, purification was performed using a standard DNA product purification kit (Tiangen). If nonspecific bands were present, the PCR product was recovered by gel excision using an agarose gel purification kit (Bomaide). For detailed instructions, refer to the instructions.

[0049] The concentration of the purified DNA was determined using a Nanodrop microspectrophotometer and agarose gel electrophoresis.

[0050] 2. Construction of VIGS gene silencing vector

[0051] (1) pTRV2 Vector linearization:

[0052] Add the following reagents to a 200 μL centrifuge tube: pTRV2 Plasmid <1 μg, Xbal endonuclease (Takara) 1 μL, 10× buffer 5 μL, add ultrapure water to 50 μL.

[0053] Mix gently and centrifuge briefly. Digest the enzyme at 37°C for 10 minutes (star activity will not be generated within 16 hours). Verify complete digestion by electrophoresis. Purify the digested product using a standard DNA purification kit (Tiangen). Concentrate the purified DNA using a Nanodrop and agarose gel electrophoresis.

[0054] (2) Use the Novozymes One Step Cloning Kit (C112) to construct a binary expression vector. The specific steps are as follows:

[0055] 1) Calculate the amount of linearized vector (X) and insert (Y) required for the recombination reaction according to the kit instructions.

[0056] 2) Prepare the following reaction system in an ice-water bath: Linearization pTRV2 Vector X μL, insert fragment Y μL, buffer (5× CE II Buffer) 4 μL, homologous recombinase (Exnase TM II) 2 μL, add ultrapure water to 20 μL.

[0057] Gently mix the components by pipetting up and down several times. Incubate at 37°C for 30 min. Immediately after the reaction, place the reaction tube in an ice-water bath and chill for 5 min. The recombinant product can be used directly in transformation experiments or stored at -20°C.

[0058] (3) Transformation of Escherichia coli:

[0059] 1) Take the competent E. coli (JM109) out of the -80°C freezer and place it on ice until it is half-thawed.

[0060] 2) Add 10 μL of the ligation product (2 μL of the plasmid), gently rotate the tube to mix the contents, and place it in an ice bath for 30 min.

[0061] 3) Quickly transfer the centrifuge tube to a 42°C metal bath and heat shock for 60 seconds. Then quickly transfer the tube to an ice bath and allow the cells to cool for 2 minutes. Do not shake the centrifuge tube during this process.

[0062] 4) Add 700 μL of sterile LB medium (without antibiotics) to the centrifuge tube, mix thoroughly, and incubate the tube at 37°C, 180 rpm, and shake for 60 min to allow the expression of the resistance marker gene on the plasmid and to allow the bacteria to recover.

[0063] 5) Remove the tube and centrifuge at low speed for 2–3 minutes to collect the cells. Discard some of the culture medium and pipette the remaining approximately 100 μL to mix thoroughly. Add the remaining volume to a plate containing LB solid medium containing the appropriate antibiotic. Use a sterile spreader to evenly spread the cells. Once the liquid in the plate has been completely absorbed, invert the plate and incubate at 37°C for 12–16 hours.

[0064] (4) Identify positive clones by PCR. The primer sequences are as follows:

[0065] F206:5'-GGATGACGCAACAATCCCACTA-3'

[0066] R206:5'-TTCACCCTCTCCACTGACAGA-3'

[0067] 3. Virus sap friction inoculation using Nicotiana benthamiana as a transitional host

[0068] (1) Transformation of Agrobacterium:

[0069] 1) Thaw competent Agrobacterium tumefaciens (GV3101) stored at -80°C in ice water.

[0070] 2) Add 4 μL (about 500 ng) of plasmid to the competent cells, mix gently, and place in an ice-water bath for 20 min.

[0071] 3) Quickly freeze the centrifuge tube in liquid nitrogen for 5 minutes.

[0072] 4) Place in a 37°C metal bath for 5 minutes without shaking. Quickly transfer to an ice water bath and let stand for 5 minutes.

[0073] 5) Add 800 μL of antibiotic-free LB liquid medium and culture at 28°C with shaking at 180 rpm for 2 h.

[0074] 6) Centrifuge at 5000 rpm for 1 min to collect the cells. Discard some of the supernatant medium, retaining approximately 100 μL. Gently pipette to resuspend the cells, then spread the suspension onto an LB plate containing the appropriate antibiotic. Incubate the plate upside down at 28°C for 2–3 days.

[0075] (2) Agrobacterium preparation:

[0076] Remove Agrobacterium from -80°C freezer and streak onto LB plates (containing the appropriate antibiotics) for 2–3 days. Pick a single colony and inoculate into 5 mL of Rif / Kan LB medium and incubate at 28°C with shaking for 24 hours. Inoculate 0.5 mL of the activated bacterial suspension into 50 mL of Rif / Kan resistant LB medium and incubate at 28°C with shaking for 12–16 hours. Collect the cells by centrifugation at 4000 rpm for 10 minutes at 4°C. Discard the supernatant and resuspend the pelleted Agrobacterium in 10 mL of resuspension solution (10 mM MgCl₂, 10 mM MES, 100 μM acetosyringone, pH 5.6) to an OD₀⁻¹ of approximately 2.0. Let the mixture stand at room temperature for at least 3 hours before mixing the two strains of Agrobacterium, TRV1 and TRV2-PDS, in equal proportions.

[0077] (3) Virus inoculation:

[0078] The target fragment TRVThe Agrobacterium mixture was injected into Nicotiana benthamiana leaves at the 8–10-leaf stage. Six to 12 days later, the infected leaves and one to two leaves above the infected leaves were collected and placed in a mortar. Phosphate buffer (20 mM, pH 7.0) was added at a 1:1 (w / v) ratio and then ground. After thorough grinding, diatomaceous earth (celite) was added to a final concentration of 1%. Before inoculation, canna leaves were sprayed with corundum and then inoculated with the resulting viral sap by rubbing. After inoculation, the leaves were rinsed with clean water, covered with plastic wrap, and incubated in the dark for 24 hours before being transferred to normal culture.

[0079] 4. Testing of gene silencing efficiency

[0080] Two weeks after virus inoculation, extract total RNA from newly grown canna leaves using a kit or Trizol method. Reverse transcribe the RNA using random primers to synthesize first-strand cDNA. Perform PCR with the following primers. Amplification of a band of the appropriate length indicates that the virus has been transported within the plant and that the insert has not been lost.

[0081] TRV2 Positive clone detection primers:

[0082] pTRV2-Up:5'-TGGGAGATGATACGCTGTT-3'

[0083] pTRV2-Down:5'-CCTAAAACTTCAGACACG-3'

[0084] After gene silencing occurred, total RNA was extracted from plant materials in the experimental and control groups using a kit. Reverse transcription was performed using Oligo dT as a primer to synthesize first-strand cDNA. Equal amounts of reverse transcription products were then subjected to quantitative qRT-PCR using a kit to compare differences in endogenous gene transcription levels. The qRT-PCR primers are as follows:

[0085] CiPDS-qPCR-F: 5'-ATTGTGAACCATGTCGCCCT-3'

[0086] CiPDS-qPCR-R: 5'-TTTTCCCGACAAAACCGCAC-3'

[0087] 5. Phenotypic Observation

[0088] Using Nicotiana benthamiana as the transitional host and inoculating the virus juice into the leaves of Canna can achieve the effect of infection. CiPDS fragmentary TRVThe Agrobacterium mixture was injected into Nicotiana benthamiana leaves at the 8-10 leaf stage. After 6-12 days, the injected leaves and 1-2 leaves above the injected leaves of the diseased Nicotiana benthamiana were collected and ground thoroughly. The resulting juice was then rubbed and inoculated into Canna indica. Figure 3 As a result, it can be seen that 15 days after inoculation, yellow spots appeared on the new leaves of canna; 42 days later, the leaves showed partial bleaching ( Figure 3 Figure A and Figure 3 Total RNA was extracted from leaves at 12 dpi (inoculation days), 24 dpi, and 35 dpi using the trizol method. TRV2 Primers were designed based on the sequences at both ends of the vector insertion site and semi-quantitative RT-PCR was performed. The results showed that a band of the expected length was amplified in the sample at 24 dpi, but not at 12 dpi and 35 dpi ( Figure 3 In addition, the present invention also extracted total RNA from leaves at 15 dpi, 24 dpi, 47 dpi and normal leaves, and used OligodT as a primer for cDNA first-strand synthesis. CiPDS Semi-quantitative RT-PCR experiments were performed using gene-specific RT-PCR primers (this amplified fragment avoids overlapping with the target fragment inserted in the vector). The results showed that 15 dpi, 24 dpi, and 47 dpi PDS The gene expression is lower than that in normal leaves ( Figure 3 The results showed that the virus juice friction inoculation method using Nicotiana benthamiana as the transitional host can effectively TRV It infects canna and can cause a decrease in the expression of the endogenous PDS gene in canna.

[0089] Figure 3 Middle: Figure A is CiPDS Gene silenced plants, L0: inoculated leaves, L1 and L2: upper leaves; Panel B is a close-up of leaf bleaching; Panels C and D are the results of semi-quantitative RT-PCR. Panel C is the amplification of viral gene fragments to show the spread of the virus in the plant; Panel D shows the CiPDS Gene expression decreased.

[0090] Example 2

[0091] Optimization of experimental conditions

[0092] To investigate the effects of temperature and inoculum on the efficiency of virus-induced gene silencing (VIGS), the second to fourth leaves of 20 seedlings and 10 rhizome seedlings were tested at 18°C ​​and 25°C, respectively. TRV-PDS (carry CiPDS Recombinant virus with gene fragments) to infect TRV-Mock(Empty vector control, half the number of plants) was used as a control. Observe the phenotypic changes of newly grown leaves (1-2 leaves) 20-25 days after inoculation.

[0093] Phenotypic analysis results ( Figure 4 ) shows that TRV-Mock In the control group, new leaves of all rhizome seedlings showed typical yellow spot symptoms of TRV infection ( Figure 4 Only 10% of the seedlings showed slight yellow spots, indicating that the rootstock seedlings were more sensitive to TRV infection. TRV-PDS In the treatment group, 90% of the rhizome seedlings showed PDS Gene silencing-induced albinism phenotypes, including punctate albinism ( Figure 4 Figure A in the figure), stripe whitening ( Figure 4 Figure B in the figure), block whitening ( Figure 4 Figure C in the figure) and severe whitening that prevents the leaves from expanding normally ( Figure 4 At 25°C, the incidence of albinism was reduced to 50%. In contrast, no obvious albinism phenotype was observed in seedlings at either temperature. TRV-PDS The treated rhizome seedlings were verified and the results showed CiPDS Gene transcription levels decreased by 59.58% ( Figure 4 The combined experimental results showed that rhizome seedlings were more suitable for canna VIGS experiments than seed seedlings, and had higher gene silencing efficiency when cultured at 18°C.

[0094] Figure 4 Middle: A to D are inoculations in rhizome seedlings TRV2-PDS Then different degrees of albinism phenotypes were produced; Figure E shows the root seedlings TRV2-Mock The virus-infected yellow spots produced by the treatment; Figure F is the probability diagram of the corresponding phenotypes produced under different combinations of culture temperature and seedling age; Figure G represents TRV2-PDS Canna indica after inoculation CiPDS The expression levels of genes were decreased, and the error bars represent the standard deviation.

[0095] The above embodiments are merely illustrative of the principles and effects of the present invention and are not intended to limit the present invention. Any person skilled in the art may modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by persons skilled in the art without departing from the spirit and technical concepts disclosed herein shall be encompassed by the claims of the present invention.

Claims

1. A method for establishing a TRV virus-induced canna endogenous gene silencing expression system, characterized in that: The steps include: (1) Extraction of target genes from canna CiPDS Primers were designed to amplify the CDS segment of the specific fragment and restriction enzyme sites and homologous recombination sequences were introduced at the 5' end of the primers. The primer sequences are: TRV-PDS-Xbal-F: AGGTTACCGAATTCT ATGGATATCATCGGGGCCAT TRV-PDS-Xbal-R: CCCCATGGAGGCCTT AAAATCTTTGCAGACAACCT; (2) The gene fragment obtained in step (1) is connected to the linearized pTRV2 Vector, construction of recombinant viral vector pTRV2-CiPDS ; (3) Recombinant viral vector pTRV2-CiPDS Transform Agrobacterium GV3101 with helper vector TRV1 Mix the Agrobacterium in equal proportions and inject it into Nicotiana benthamiana leaves. Collect the virus juice after 6 to 12 days of culture. (4) Inoculate the virus sap onto canna leaves by friction and incubate at 18°C ​​to induce target gene silencing; (5) Verify gene silencing efficiency through phenotypic observation and qRT-PCR; described CiPDS The coding region sequence of the gene is 804 bp, encoding a total of 268 amino acids; described CiPDS The full-length nucleotide sequence of the gene coding region is shown in SEQ ID NO.1.

Images